Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples
|
|
- Sharlene Brooks
- 6 years ago
- Views:
Transcription
1 Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Patient ID Age (yrs) BIC classification * HGVS classification # 1 2 BRCA1 del exon BRCA1g ?_71681+?del (del exon) 2 BRCA1 562 T>A (V188E) BRCA1c.551T>A (p.val188glu) BRCA G>A (A182T) BRCA1c.5467G>A (p.ala182thr) 4 27 BRCA1 IVS 6-2 del A BRCA1c.2-2delA 5 44 BRCA1 185_186 del AG (STOP BRCA1c.68_69delAG (p.glu2valfsx17) 9) 6 48 BRCA1 T>G (C61G) BRCA1c.181T>G (p.cys61gly) 7 4 BRCA1 del exon 24 BRCA1g.8296-?_8446+?del (del exon24) 8 9 BRCA1 1996insTAGT BRCA1c.1874_1877dupTAGT 9 BRCA G>A (A182T) BRCA1c.5467G>A (p.ala182thr) 29 BRCA1 726 C>T (R1X) BRCA1c.7C>T (p.arg1x) 11 BRCA1 4184_4187 del TCAA (STOP 164) BRCA1c.65_68delTCAA (p.asn155lysfsx) 12 BRCA1 del exons 21_2 BRCA1g.776-?_894+?del (del exons21_2) 1 49 BRCA C>T (Q94X) BRCA1c.2C>T (p.gln94x) 14 9 BRCA1 519 G>T (E114X) BRCA1c.G>T (p.glu114x) BRCA1 2_21 del AA (STOP 91) BRCA1c.2681_2682delAA (p.lys894thrfsx8) BRCA1 Ex 1 Dup n (STOP 14) g4469_5449 dup 6kb BRCA1g.4469_5449 dup6kb (dup exon1) 17 1 BRCA1 74_75 ins GA (STOP 87) BRCA1c.254_255dupGA (p. Leu86AspfsX2) 18 2 BRCA del C (STOP 845) BRCA1c.2475delC (p.asp825glufsx21) 19 BRCA del CT (STOP 1572) BRCA1c.4625_4626delCT (p.ser1542trp) 1 BRCA1 582_58 ins C (STOP BRCA1c.5266dupC (p. Gln1756ProfsX74) 1829) BRCA1 6 del C (STOP 2) BRCA1c.514delC (p.gln172asnfsx62) 22 5 BRCA1 del A (STOP 7) BRCA1c.1961delA (p.lys654serfsx47) 2 42 BRCA1 T>G (C61G) BRCA1c.181T>G (p.cys61gly) 24 BRCA1 _6 del GAAGATACTAG (STOP 116) BRCA1c.481_491delGAAGATACTAG (p.glu1161phefsx) All prophylactic mastectomy samples were from premenopausal women with no personal history of cancer. *BIC: Breast cancer Information Core database ( #HGVS: Human Genome Variation Society ( Nature Medicine: doi:.8/nm.4118
2 Supplementary Table 2. and L expression in normal breast tissue Gene Mutation Number p-value L p-value Status of samples H-score H-score BRCA1 BRCA1 mut/ Non-BRCA BRCA2 BRCA2 mut/ Non-BRCA Normal breast tissue (either tumor adjacent or contralateral breast) from the kconfab cohort 41 was scored for BRCA1 and BRCA2 expression. The H-score incorporates intensity (scale of - ) multiplied by percent cells staining positive for or L (see Methods). P-values (Wilcoxon Rank Sum test) compare BRCA1 mutation carriers with non-brca1 mutant tissue (i.e. women with a positive family history but no BRCA1 germline mutation; includes BRCA2- mutation carriers) and BRCA2 mutation carriers with non-brca2 mutant tissue (i.e. women with a positive family history but no BRCA2 germline mutation; includes BRCA1-mutation carriers). Analysis was not adjusted for menopausal status or menstrual cycle stage. Nature Medicine: doi:.8/nm.4118
3 Supplementary Table. Incidence scores of and L expression in primary breast tumors Patient Genotype + (%) L + (%) Wild-type (WT) 1/11 (%) 7/12 (12%) BRCA1 mut/+ 61/144 (42%) 1/141 (9%) BRCA2 mut/+ 17/115 (15%) 5/116 (4%) Tumors were scored from tissue microarrays from the kconfab cohort 41. BRCA1- and BRCA2- associated tumors were from known mutation carriers, while WT were from BRCAX cases with a positive family history, where no BRCA1 or BRCA2 germline mutation was identified by germline testing. BRCA1-associated tumors are more frequently + than WT (Fisher s exact test p = 1.8e-14) or BRCA2 (p = 1.4e-6). No association was observed for L staining between different groups. Nature Medicine: doi:.8/nm.4118
4 Supplementary Table 4. Clinicopathological characteristics of primary human tumors a. Characteristics of the primary tumor cohort Marker Marker BRCA1 BRCA2 WT p-value Status ER Negative 165 (77.1%) 2 (17.9%) 146 (2.1%) 1.9e-49 Positive 49 (22.9%) 147 (82.1%) 486 (76.9%) Total PR Negative 19 (9.6%) 8 (.%) 25 (9.7%) 6.75e-42 Positive (9.4%) 72 (.%) 79 (.%) Total HER2 Negative 172 (86.%) 127 (74.7) 54 (85.7%). Positive 28 (14.%) 4 (25.%) 84 (14.%) Total Triple-Neg False 71 (4.8%) 15 (84.%) 52 (85.4%) 2.e-4 True 1 (65.2%) 28 (15.7%) 91 (14.6%) Total EGFR Negative 181 (9.5%) 1 (96.4%) 88 (74.%) 4.e-14 Positive 19 (9.5%) 6 (.6%) 14 (25.7%) Total CK5 Negative 59 (.1%) 92 (57.5%) 265 (51.9%) 2.88e-8 Positive 17 (69.9%) 68 (42.5%) 246 (48.1%) Total Negative 9 (59.2%) 115 (85.8%) 28 (87.1%) 2.6e-11 Positive 62 (.8%) 19 (14.2%) 42 (12.9%) Total L Negative 121 (9.%) 11 (95.8%) (86.7%).2 Positive 1 (9.7%) 5 (4.2%) 46 (1.%) Total b. Proportion of + tumors within patient genotypes and tumor subtypes Genotype TNBC HR + HER2 BRCA1.472 (42/89).24 (12/7).64 (4/11) BRCA2.412 (7/17).112 (12/7). (/1) WT.244 (19/78). (19/184).16 (/22) BRCA1 vs WT overall: p =.62e-11 BRCA1 vs WT for TNBC only: p =.2 BRCA1 vs WT for not-tnbc: p =.4 BRCA1 vs WT for HR + : p =.1 BRCA1 vs WT for HER2: p =.186 Tumors were scored from the kconfab cohort 41 (tissue microarrays) and Amgen Tissue Bank (tissue sections). BRCA1- and BRCA2-associated tumors were from known mutation carriers. Wild-type (WT) were cases where no BRCA1 or BRCA2 mutation had been identified on genetic testing. HR, Hormone Receptor. P values were calculated using Fisher s exact test. Nature Medicine: doi:.8/nm.4118
5 Supplementary Table 5. L levels in normal breast tissue from high-risk women Hormonal Status BRCA1 BRCA2 WT L + L Total L + L Total L + L Total Pre-men 25 (9.1%) 9 (.9%) (4.9%) 28 (65.1%) 4 68 (44.2%) 86 (55.8%) 154 Post-men 1 (8.%) 11 (91.7%) 12 (.%) (%) (6.8%) 41 (9.2%) 44 p =.49 p =.46 p = 1.7e-6 L expression was scored in normal breast tissue (either tumor adjacent or contralateral breast) from tissue microarrays in the kconfab cohort 41. High-risk women included patients with pathogenic mutations in BRCA1 or BRCA2, or WT (patients had a positive family history, but no BRCA1 or BRCA2 germline mutation was identified). Menstrual cycle status for premenopausal populations is unknown. The definition of post-menopausal hormonal (Post-men) breast status was based on either: age >55 years, prior oophorectomy, or on tamoxifen at the sample collection day or within days prior to collection day. In all three groups (BRCA1, BRCA2 and WT), the fraction of samples from pre-menopausal (Pre-men) women that was L-positive, was significantly greater than samples obtained from post-menopausal (post-men) women (p <.5, Fisher s exact test). Nature Medicine: doi:.8/nm.4118
6 Stroma Isotype Stroma Stroma Lin Stroma EpCAM 25 Fwd scatter (x) CD49f Isotype Relative fold change e WT1 WT2.5 Stroma f Isotype Stroma Stroma Stroma Stroma d Isotype Stroma Fwd scatter (x) L mrna 1. Isotype Percentage of max Percentage of max Stroma BRCA1mut/+ WT Stroma c Percentage of max Isotype Percentage of max BRCA1mut/+ EpCAM 4 CD1, CD45, CD25-a CD1, CD45, CD25-a b WT Expression relative to GAPDH a CD49f mrna L + segments of TDLU L+ duct L M Ba S /M l sa a L TDLU m ro St Supplementary Figure 1. expression in human breast epithelium. (a,b) Additional examples of FACS plots showing delineation of distinct subpopulations isolated from (a) wild-type or (b) histologically normal BRCA1mut/+ breast tissue based on expression of CD1, CD45, CD25-α, EpCAM, CD49f and. Each row of plots correspond to an individual patient. Cells negative for CD1, CD45 and CD25-α define the lineage negative () population. expression (blue) was compared to an isotype-matched control antibody (grey). (c) Representative histograms portraying the lack of expression in the mature luminal () and stroma subsets within wild-type (n = patients) or BRCA1mut/+ (n = 24) breast tissue. (d) Expression analysis of in the, basal/masc-enriched () and luminal progenitor () subpopulations from reduction mammoplasties from three WT patients by qrt-pcr. Data is depicted as mean ± s.e.m. Expression was normalized to GAPDH. (e) Expression analysis of L in the,, and stroma subpopulations from reduction mammoplasties from two patients (WT1 and WT2) by qrtpcr. Expression was normalized to GAPDH and is depicted as fold-change relative to the mature luminal subset. (f) Representative images showing heterogeneous expression of L and in histologically normal human breast tissue by immunohistochemistry. Scale bar = μm. Nature Medicine: doi:.8/nm.4118
7 a Side scatter (x) With DEAB b No DEAB Aldefluor/BAA Relative fold change Aldefluor/BAA MFI BRCA1 mut/+ WT + c H-score **** * WT BRCA1 BRCA2 Mean = 2. Mean = 1.6 Mean = 5. d L e ALDH1 Supplementary Figure 2. + progenitors exhibit enhanced Aldefluor activity. (a) Representative bodipyaminoacetate (BAA) fluorescence profiles of luminal progenitor cells after incubation with Aldefluor in the presence or absence of the inhibitor diethylaminobenzaldehyde (DEAB). Aldefluor-positive cells are outlined in red (b) Mean fluorescence intensity (MFI) values for the Aldefluor/BAA fluorescence of + luminal progenitor cells isolated from BRCA1 mut/+ (n = 4 patients) and WT (n = 5) breast tissue, relative to the MFI of the corresponding luminal progenitor subset. Data is depicted as mean ± s.e.m ** P <.1, *** P <.1 (c) Elevated expression in BRCA1-mutated breast tumors. expression was determined by immunohistochemistry of breast tumors on kconfab tissue microarrays (TMAs). The overall expression was generated using the H-scoring method (staining intensity multiplied by percent positive cells). Bar, mean score. * P <.5, **** P <.1. (d) L immunostaining in serial sections of a + BRCA1-mutated breast tumor showing distribution within normal breast tissue adjacent to the tumor. Scale bar = μm. (e) Representative images showing overlapping distribution of and ALDH1 immunostaining in sequential sections from the same BRCA1-mutated breast tumor. Scale bar = μm. Statistical significance was determined using two-tailed t-tests. ALDH1, aldehyde dehydrogenase 1. Nature Medicine: doi:.8/nm.4118
8 a Cell cycle Oocyte meiosis DNA replication Fanconi anemia pathway Fatty acid metabolism Homologous recombination Steroid biosynthesis Biosynthesis of unsaturated fatty acids MicroRNAs in cancer Fatty acid degradation Glycoxylate/Dicarboxylate metabolism Ketone bodies Pyruvate metaolism Butanoate metabolism p5 signalling pathway Tryptophan metabolism Glycosphingolipid biosynthesis Mismatch repair Valine/leucine/isoleucine degradation Fatty acid elongation Pentose/Glucuronate interconversions Arachidonic acid metabolism Lysine degradation Carbon metabolism Fat digestion and absorption c Olive tail moment e 5 UT HU IR UT HU IR + log (P value) 5 15 d Olive tail moment 1 1 b Relative fold change WT BRCA1 Lum B Basal Normal Basal Enrichment 2.7 Enrichment 5.6 Enrichment 2. BRCA1 mut/+ Unsorted Epithelial + + UT HU IR Enrichment 2 Weight P value =.1 P value =.1 Weight Weight Weight Supplementary Figure. BRCA1 mut/+ + luminal progenitor cells have enhanced mitotic activity and correlate with basal-like breast cancers. (a) KEGG analysis following RNA-seq of freshly sorted + and luminal progenitors () revealed significant enrichment of cell cycle, DNA repair and metabolic pathways in + cells (n = 4 patients) (b) Fold change in BRCA1 expression in + cells relative to the corresponding subset for WT (n = patients) and BRCA1 mut/+ (n = ). Data represent mean ± s.e.m. (c) A representative patient sample showing the olive tail moment for individual + or cells in BRCA1 mut/+ tissue. Cells were either untreated (UT), treated with hydroxyurea (HU) or irradiated at Gy (IR), and harvested 4 h post-treatment. Bar, mean score. (d) Comet assays on epithelial subsets of BRCA1 mut/+ cells. The histograms represent the mean olive tail movement ± s.e.m. for at least cells per population. Shown are olive tail movements for unpurified cells (epithelium and stroma), epithelial cells, basal/ MaSC, and and + luminal progenitors. Comet tails are evident in all subsets, but are most pronounced in the + subset (n = patients). (e) Barcode plots depicting association between the + expression signature and basal breast tumors, compared to luminal B and normal-like breast tumors. Genes are ordered from right to left as most upregulated to most downregulated in basal tumors. Vertical red bars designate genes upregulated in + cells compared to cells, whereas blue bars designate downregulated genes. Weight refers to the log-fold change in expression of each gene compared to cells, with a higher fold change represented as a greater bar length. ROAST P values assess overall correlation. Nature Medicine: doi:.8/nm.4118
9 a Prog Prog + denosumab BRCA1mut/+ #5 BRCA1mut/+ #4 BRCA1mut/+ # BRCA1mut/+ #2 BRCA1mut/+ #1 Vehicle b Post-denosumab Ki67 Pre-denosumab Supplementary Figure 4. L inhibition attenuates progesterone-mediated proliferation in BRCA1mut/+ breast tissue. (a) Representative images from each of the five BRCA1mut/+ patients showing Ki67 immunostaining in freshly isolated organoids that were treated with vehicle (EtOH), progesterone (Prog, nm) or progesterone ( nm) plus the L-inhibitor denosumab ( µg/ml) for 24 h. The enlargement shows each image at x magnification. Scale bars = 5 μm. (b) Representative images showing Ki67 immunostaining of pre- (left) and post-denosumab treatment (right) core biopsies from subject # in the BRCA-D study. Scale bars = 5 µm. Nature Medicine: doi:.8/nm.4118
10 a b CD29 (HR ) CD49b c (HR+) Vehicle anti-l d Sca1 CD % Relative fold change (HR ) 28.5% 8.% 9.5% (HR+) Mat Lum anti-l Sca1 CD24 Vehicle CD29 46.% 9.6% 1..8 *.6.4 CD49b Colony-forming capacity 1.2 Vehicle anti-l **.2. (HR ) 8.5 dp 1 dl MMTV-cre/Brca1fl/fl/p5+/ p5+/ MMTV-Neu Ligand 6 wk virgin (HR+) e Individual female MMTV-cre/Brca1fl/fl/p5+/ (9 weeks) Randomly assigned to treatment group Vehicle or a-l Tumor harvested Nature Medicine: doi:.8/nm.4118 g Tumor-free survival (%) f *** Vehicle a-l Days
11 Supplementary Figure 5. L inhibition attenuates tumor onset in vivo. (a) Representative FACS plots showing expression of CD24, CD29, Sca1 and CD49b in mouse mammary glands pooled from virgin FVB/J mice treated with either anti-l (5 mg/kg) or an isotype-matched control antibody (5 mg/kg) for 7 days. Differential expression of Sca1 and CD49b was used to delineate the mature luminal (Sca1 + CD49b ), hormone receptor-positive luminal progenitor (HR +, Sca1 + CD49b + ) and hormone receptor-negative luminal progenitor (HR, Sca1 CD49b + ) subsets. It has not been possible to sort + and subsets from the mouse mammary gland, owing to a lack of suitable antimouse antibodies for flow cytometry. (b) Representative images showing Giemsa-stained colonies from basal/ MaSC-enriched (basal/ms), HR + and HR cells isolated from vehicle versus anti-l treated mice, plated on fibroblast feeder layers. (c) Bar graph depicting reduced clonogenic capacity in basal/ms and HR subsets isolated from anti-l treated mice compared to control mice. Data represents mean ± s.e.m. (n = 6 mice). *P <.5, **P <.1. (d) Representative images showing immunostaining for mu and mul in mammary glands harvested from virgin, 8.5 day pregnant or 1 day lactating FVB/J mice. Scale bar = 5 μm. (e) Representative images showing enrichment of mu immunostaining in premalignant mammary glands harvested from MMTV-cre/Brca1 fl/fl /p5 +/ mice, compared to p5 +/ and MMTV-Neu mice (n = 5 mice per model). Scale bar = 5 μm (f) Overview of alternative prevention therapy strategy. Individual 9-week old MMTV-cre/Brca1 fl/fl /p5 +/ mice were randomly assigned to receive either an anti-l neutralizing antibody (5 mg/kg) or an isotype-matched control antibody (vehicle, 5 mg/kg). Tumors were harvested once ethical endpoint ( mm ) was reached. (g) Kaplan-Meier survival curves of MMTV-cre/Brca1 fl/fl / p5 +/ mice following treatment with anti-l (n = 9) or vehicle (n = 9). The dotted line depicts median tumor onset. *** P <.1. Statistical significance was determined using two-tailed t-tests. Nature Medicine: doi:.8/nm.4118
12 a BRCA1-mutant PDX b c Percentage of max Isotype d Tumor volume (mm ) 7 5 Survival (%) Vehicle OPG-Fc Docetaxel Docetaxel + OPG-Fc 9 Days Days Supplementary Figure 6. L inhibition augments tumor response to docetaxel in a + BRCA1-mutant patient derived xenograft model. (a) Representative FACS plot showing expression in a BRCA1-mutant patient derived xenograft (PDX 1). expression (blue) was compared to an isotype-matched control antibody (grey). Approximately % of tumor cells in this PDX model are +. (b) immunostaining of PDX 1. Scale bar = µm. (c) Tumor growth curve and (d) Kaplan-Meier survival curves for mice bearing tumors that were treated with vehicle, docetaxel ( mg/kg i.p every 21 days), OPG-Fc ( mg/kg, times per week) or both docetaxel and OPG-Fc (n = mice per arm). Tumors were harvested once ethical endpoint ( mm ) was reached. Mice were treated as previously described 55, although estradiol pellets were omitted to minimize the induction of endogenous OPG. The dotted line depicts median tumor onset. Statistical significance was determined using a twotailed t-test. **** P <.1. Nature Medicine: doi:.8/nm.4118
Supplementary information for
Supplementary information for Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers Elgene Lim, François Vaillant, Di Wu, Natasha C Forrest,
More informationMohamed Bentires-Alj
San Antonio Breast Cancer Symposium, December 6-10, 2016 Mohamed Bentires-Alj Professor of experimental surgical oncology Department of Biomedicine University of Basel University Hospital Basel m.bentires-alj@unibas.ch
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSupplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
More information5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationSupplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationPearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSupplementary. properties of. network types. randomly sampled. subsets (75%
Supplementary Information Gene co-expression network analysis reveals common system-level prognostic genes across cancer types properties of Supplementary Figure 1 The robustness and overlap of prognostic
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationSUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationInhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of
SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.
More informationEx vivo functional assays for Homologous Recombination deficiency in breast cancer. Dik C. van Gent
Ex vivo functional assays for Homologous Recombination deficiency in breast cancer Dik C. van Gent Breast cancer types treatments ER/PR: anti-hormonal therapy HER2: Herceptin Triple negative (TNBC): no
More informationInhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative
SUPPLEMENTARY INFORMATION Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative breast cancer Roman Camarda, Alicia Y. Zhou, Rebecca A. Kohnz, Sanjeev Balakrishnan, Celine
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
More informationInteractions between cancer stem cells and their niche govern metastatic colonization
Correction Interactions between cancer stem cells and their niche govern metastatic colonization Ilaria Malanchi, Albert Santamaria-Martínez, Evelyn Susanto, Hong Peng, Hans-Anton Lehr, Jean-Francois Delaloye
More informationSupplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
More informationSUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationSupplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
More informationChronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationPrevalence and clinical implications of BRCA1/2 germline mutations in Chinese women with breast cancer Yuntao Xie M.D., Ph.D.
Prevalence and clinical implications of BRCA1/2 germline mutations in Chinese women with breast cancer Yuntao Xie M.D., Ph.D. Hereditary Cancer Center, Peking University Cancer Hospital 1 Breast cancer
More informationSupplemental Table 1 Molecular Profile of the SCLC Cell Line Panel
Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel p53 RB Myc Cell Line Mutation A Mutation A Amplification B COR-L103 C p.y234c p.d584e L-Myc NCI-H526 p.s33_splice None N-Myc NCI-H1048
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSupplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
More information% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2697 Figure S1 Cytokeratin 5 is a specific marker for basal and intermediate cells in all mouse prostate lobes. (a) Immunofluorescence staining showing co-localization of YFP with p63 in
More informationPredictive Assays in Radiation Therapy
Outline Predictive Assays in Radiation Therapy Radiation Biology Introduction Early predictive assays Recent trends in predictive assays Examples for specific tumors Summary Lecture 4-23-2014 Introduction
More informationMaterial and Methods. Flow Cytometry Analyses:
Material and Methods Flow Cytometry Analyses: Immunostaining of breast cancer cells for HER2 was performed by incubating cells with anti- HER2/neu APC (Biosciences, Cat# 340554), anti-her2/neu PE (Biosciences,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationFig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
More informationSupplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationSupplementary Information Titles
Supplementary Information Titles Please list each supplementary item and its title or caption, in the order shown below. Note that we do NOT copy edit or otherwise change supplementary information, and
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationSupplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationWorld Congress on Breast Cancer
World Congress on Breast Cancer 05.08.2015 How pregnancy at early age protects against breast cancer Fabienne Meier-Abt, MD PhD Background: Early age pregnancy protects against breast cancer. MacMahon,
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationNHOLUA. September 20, 2016 Lincoln, NE
NHOLUA September 20, 2016 Lincoln, NE UNDERWRITING BREAST CANCER, A NEW APPROACH Dr Robert Lund Basics in Determination of Breast Cancer Prognosis Age at Diagnosis Tumor Size Lymph Node Status Title of
More informationBreast Cancer Statistics
1 in 8 Breast Cancer Statistics Incidence Mortality Prevalence 2 Breast Cancer Incidence Breast Cancer Mortality Breast Cancer Prevalence ~$100,000 Female Breast Anatomy Breasts consist mainly of fatty
More informationBezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationFunctional genomics reveal that the serine synthesis pathway is essential in breast cancer
Functional genomics reveal that the serine synthesis pathway is essential in breast cancer Results Presented by Stacey Lin Lloyd Lab http://www.amsbio.com/expression-ready-lentiviral-particles.aspx Overview
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationNature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
More informationSupplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationSupplementary Materials
Supplementary Materials Supplementary figure 1. Taxonomic representation summarized at genus level. Fecal microbiota from a separate set of Jackson and Harlan mice prior to irradiation. A taxon was included
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/318/ra29/dc1 Supplementary Materials for Antagonism of EGFR and HER3 Enhances the Response to Inhibitors of the PI3K-Akt Pathway in Triple-Negative Breast Cancer
More informationactivation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationTriple Negative Breast Cancer
Triple Negative Breast Cancer Prof. Dr. Pornchai O-charoenrat Division of Head-Neck & Breast Surgery Department of Surgery Faculty of Medicine Siriraj Hospital Breast Cancer Classification Traditional
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationSupplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationSupplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells
Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Fong PC, Boss DS, Yap TA, et al. Inhibition of poly(adp-ribose)
More informationPostn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More information* * * * Supplementary Figure 1. DS Lv CK HSA CK HSA. CK Col-3. CK Col-3. See overleaf for figure legend. Cancer cells
Supplementary Figure 1 Cancer cells Desmoplastic stroma Hepatocytes Pre-existing sinusoidal blood vessel New blood vessel a Normal liver b Desmoplastic HGP c Pushing HGP d Replacement HGP e f g h i DS
More information