% of Nestin-EGFP (+) cells
|
|
|
- Sharyl James
- 5 years ago
- Views:
Transcription
1 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay Line Numer of ells injete CD GFAP TUJ x x 3 x 8 8±. 88±7..±.7.±.3 / () 3/3 () / () 9±6.3 89±6. 3.3±..3±.7 3/3 () 3/3 () 3/3 () pe-nes-8 79±. ±3.9.±.9 6.±. 3/3 () 3/3 () 3/3 () pe-nes- 9±6. 88±7.8.±..±.8 3/3 () 3/3 () 3/3 () Supplementary Figure. Charaterization of stemness an tumorigeni features of GSCs (a) Expression levels of stemness markers (,, Nestin an CD) in GSCs (8,, pe-nes-8 an pe-nes-) an serially transplante-gscs (8 an ). level ompare to that in human ES ell (H) is iniate in Y-axis. Error ars iniate s.. () Frequenies of EGFP-positive (Nestin-positive) ells in - an -positive ells in pe-nes- an pe- Nes-8. an positive ells were ounte in multiple spheres an alulate (left graph). Image of pe-nes--gsc is shown (right panel). Error ars iniate s.. Bar, μm. () Summary of GSC harateristis. Expression level of stemness an ifferentiation markers was assesse y immunostaining. Expression levels of eah marker were evaluate y frequenies (%) of immunopositive ells among GSC neurospheres. A total of ells per line were ounte in tripliate. Tumorigeniity of the GSCs was evaluate y limiting ilution assay (transplante with x, x 3 anx ells) in vivo. The tumorigeni rate (%) is shown in rakets.
2 8 (si-nc) (si-nc) R² =.9 R² =.9 RNA-seq FPKM (log ) RNA-seq FPKM (log ) Miroarray signal intensity (log ) Miroarray signal intensity (log ) Numer of lnrnas ownregulate y si-jag Numer of lnrnas ownregulate y si-noth RNA-seq 3 7 Miroarray RNA-seq 3 8 Miroarray Supplementary Figure. Comparison etween RNA-seq an miroarray analyses in si-jag an si-noth treate GSCs (a) Satterplot omparison of gloal expression profiles of GSCs (8 an ) y using RNA-seq an miroarray tehnology. Relationship etween RNA-seq ata an miroarray ata is estimate y Regression analysis. () Venn iagram epits the numers of ownregulate lnrnas ientifie y RNA-seq an miroarray tehnology. List of lnrnas were summarize in Supplementary Date an.
3 Noth si-nc si-noth JAG si-nc si-jag HES HES HES HES DAPT DAPT HES HES HES HES RO9997 RO9997 e (TUG / GAPDH) f (TUG / GAPDH) 3 g (TUG / GAPDH) 3 RO9997 si-noth si-jag Supplementary Figure 3. Effets of Noth signaling on TUG expression in GSCs (a, ) Expression hanges of iniate genes in GSCs treate with sirna against Noth (a) or JAG (). Values are iniate relative to aunane in si-nc-treate ells., P<., Stuent s t-test. (, ) Expression levels of HES an HES in GSCs treate with ifferent onentrations of DAPT () or RO9997 (). Values are iniate relative to aunane in DMSO-treate ells., P<., Kruskal-Wallis analysis. (e-g) Effet of NICD overexpression on TUG expression. Expression levels of TUG in GSCs treate with either RO9997 (e), sirna against Noth (f) or JAG (g). Empty vetor (pdna3.) an plasmi vetors expressing luiferase (Lu) were use for negative ontrols. Values are iniate relative to aunane in DMSO or si-nc-treate ells., P<., Kruskal-Wallis analysis. For all experiments ata, error ars iniate s.. (n=3).
4 Noth (+) (-) 3 JAG (+) (-) % of positive ells 8 6 Trypan lue (-) Trypan lue (+) (+) (-) Nestin-EGFP (+) Nestin-EGFP (-) Nestin-EGFP Nestin-EGFP Nestin-EGFP Phase ontrast Nestin- EGFP si-nc si-noth si-jag e Relative Nestin-EGFP Intensity Numer of viale ell f MALAT NEAT g Phase ontrast Nestin- EGFP si-nc si-malat si-neat h Relative Nestin-EGFP Intensity Numer of viale ell Supplementary Figure. Phenotypi haraterization of GSC-pE-Nes (a-) Charaterization of EGFP-positive (i.e. Nestin-positive) an EGFP negative (i.e. Nestin-negative) GSCs. (a) Expression levels of Noth an JAG in Nestin-EGFP-positive an -negative ells. level ompare to that in Nestin-EGFP (+) is iniate on the Y-axis., P<., Stuent s t-test. () Numer of viale ells in EGFP-positive an -negative GSCs was assesse y trypan lue staining., P<., Stuent s t-test. () Nestin-EGFP-positive an -negative ells were transplante intraranially to NOD/SCID mie. Representative image ( weeks post-transplantation) of HE staining is shown. Tumor areas are surroune y re otte line. Bars, mm. () Effets of sirna-meiate inhiition against Noth- an JAG. Phase-ontrast an Nestin-EGFP images of GSC-pE-Nes- transfete with the iniate sirnas are shown. Bars, μm. (e) Relative intensity of Nestin-EGFP (left) an numer of viale ell (right) to si-nc ontrol were analyze. Viale ells were assesse y trypan lue staining., P<., Stuent s t- test. (f) Expression levels of stemness markers ( an ) in GSCs after either si-nc, si-malat or si-neat treatment. Y-axis iniates relative expression level ompare to that in si-nc-treate ells., P<., Kruskal-Wallis analysis. (g) Phase-ontrast an Nestin-EGFP images of pe-nes- after treatment with either si-nc, si-malat, or si-neat. Bar, μm. (h) Intensity of Nestin- EGFP (left) an numer of viale ells (right) to si-nc ontrol were quantifie. Viale ells were assesse y trypan lue staining. For all the experimental ata, error ars iniate s.. (n=3).
5 GSC TUG / DAPI Average spot numers per ell Nulei Cytoplasm % input TUG mir- % input TUG mir e. f Relative numer of viale ell % of annexin V an 7-AAD oule positive ells Nestin CD g (mir- / RNU6B) Phase ontrast Nestin- EGFP NC mir- h Relative Nestin-EGFP Intensity Numer of viale ell Supplementary Figure. Interation etween TUG an mir- an its iologial signifiane (a) RNA-FISH analysis of TUG (re) in GSCs. Nulei are staine with DAPI. Bar, μm. () Ratio of suellular loalization of TUG in GSCs. Multiple GSC lines are examine. Error ars iniate s.. () RIP analysis of TUG an mir- using an antioy against AGO or IgG. Enrihment of TUG an mir- are expresse as a perentage of input RNA. () GSCs were transfete with expression vetors enoing either Flag-AGO (WT) or Flag-AGO laking PAZ omain ( PAZ). RIP analysis of TUG an mir- was performe y using an antioy against Flag. Enrihment of TUG an mir- are expresse as a perentage of input RNA. (e) The numer of viale ells (left) an apoptoti ells (right) among GSCs treate with a preursor moleule of mir- (mir-) or negative ontrol mirna preursor (NC). Viale ells were assesse y trypan lue staining. Apoptoti ells were ounte y FACS analysis with 7-AAD an PE Annexin V staining. (f) Effet of mir- on expression of the stemness-assoiate genes (,, Nestin an CD). Y-axis iniates relative expression level ompare to that seen in NC-treate ells. (g, f) Effet of exogenous mir- on Nestin ativity. (g) GSC-pE-Nes- were treate with a preursor moleule of mir- (mir-) or negative ontrol mirna preursor (NC). Expression level of mir- (values are iniate relative to aunane in NC-treate ells, left). Phase-ontrast an Nestin-EGFP images. Bar, μm (right). (h) Intensity of Nestin-EGFP (left) an numer of viale ells (right) ompare to NC ontrol were quantifie. Viale ells were assesse y trypan lue staining. For all the experimental ata, error ars iniate s.. (n=3), P<., Stuent s t-test. EGFP
6 NC mir- 3 3 TUG WT TUG MUT TUG DEL mir- ( nm) mir- ( nm) Supplementary Figure 6. Quantitative interation etween TUG an mir- (a) Expression levels of an in GSCs treate with the iniate oses of mir- or negative ontrol mirna preursor (NC). Values are iniate relative to aunane in non-treate ells ( nm)., P<., Stuent s t-test. () Different onentrations of partial TUG transripts ( to 3 nuleoties), whih ontain the see sequene of mir- (TUG WT), mutate TUG (MUT) or see sequene-elete TUG (DEL) were ae to GSCs treate with mir- (nm). Equivalent ose (nm) of partial TUG transripts quenhe mir- ativities. Expression levels of enogenous an were measure y qpcr. Values are iniate relative to aunane in non-treate ells ( nm)., P<., Kruskal-Wallis analysis. For all experiments ata, error ars iniate s.. (n=3).
7 Relative numer of viale ell % of annexin V an 7-AAD oule positive ells si-noth si-noth Nestin CD si-noth si-noth Relative numer of viale ell e % of annexin V an 7-AAD oule positive ells si-jag si-jag f Nestin CD si-jag si-jag Supplementary Figure 7. Roles of eah TUG exon transript for the stemness features of GSCs (a-f) Effets of TUG overexpression on ell viaility (a, ), apoptosis (, e) an expression of the stemness-assoiate genes (,, Nestin an CD) (, f) in GSCs treate with sirna against Noth (a-) or JAG (-f). Plasmi vetors expressing iniate TUG exons or NICD were ae to GSCs. Empty vetor (pdna3.) an plasmi vetors expressing luiferase (Lu) were use for negative ontrols, while NICD overexpression (NICD) was use for a positive ontrol for these experiments. Viale ells were assesse y trypan lue staining (a, ). The numer of apoptoti ells were ounte y FACS analysis with 7-AAD an PE Annexin V staining (, e). Expression levels of stemness-assoiate genes were analyze y qrt-pcr. Y-axis iniates relative expression level ompare to that seen in si-nc -treate ells (, f). Values are iniate relative to aunane in si-nc-treate ells. For all the experimental ata, error ars iniate s.. (n=3), P<., Kruskal-Wallis analysis.
8 Noth expression (log ) 3 r = TUG expression (log ) expression (log ) r = TUG expression (log ) expression (log ) 6 r = TUG expression (log ) BDNF expression (log ) 6 r = TUG expression (log ) NGF expression (log ). r = TUG expression (log ) NTF3 expression (log ) r = TUG expression (log ).6 Mesenhymal Classial Proneural Neural Normalize expression value.. -. TUG Noth Normalize log value ( ; TCGA GBM, ; GSC-8, ; GSC-) Supplementary Figure 8. Expression analysis of TUG in linial GBM samples (a) Correlation etween TUG, Noth, mir- target genes ( an ), an TUG target gene (BDNF, NGF an NTF3) expression in linial GBM samples. Data were otaine from TCGA ata sets. Eah omparison is performe etween the genes iniate on the X- an Y-axes, respetively. () Hierarhial lustering analysis of gene expression profiles using GBM ata sets from the TCGA an the GSC lines (8- an ) stuie here. Color orrespons to expression level as iniate in the log-transforme sale ar elow the matrix. Re an lue reflet high an low levels, respetively. On the X-axis, a grey ar iniates TCGA GBM samples. Re an lue ars iniate 8- an -GSC, respetively. () Expression levels of TUG an Noth in TCGA GBM samples. Error ars iniate s.e.m.
9 TUG / DAPI () Nake-TUG (n = 3) TUG-DDS (n = 3) Epi-fluoresene High Pre-treatment After injetion ( hours) Low Raiant Effiieny (p/se/m /sr) (μw/m ) Relative fluoresene intensity Nake-TUG TUG-DDS Time after injetion (hours) Supplementary Figure 9. Analysis of TUG expression an TUG-DDS aumulation in the mouse (a) Representative image of HE staining of mouse xenograft after 3 ays of transplantation. Tumor areas are surroune y re otte line. Bar, mm. () RNA-FISH analysis of TUG (re) in tumor ells aroun area (perivasular region) in panel a. Nulei were staine with DAPI. Asterisk iniates loo vessel. Bar, mm. () Mie earing rain tumors were intravenously aministere with nake (without DDS) Alexa67 laele ASO-TUG (Nake-TUG, n=3; left) or Alexa67 laele TUG-DDS (right, n=3). Fluoresene intensity was analyze using an IVIS imaging system. () TUG-DDS was staly aumulate in the tumors at least for hours. Values are iniate relative to intensities at the point of pre-treatment ( hour). Error ars iniate s.e.m.
10 ( ; motif) K : TSS outsie R R R3 3 -outsie TUG exon. 8. % input.8.8 si-nc si-.... ( / GAPDH) (TUG / GAPDH) Supplementary Figure. promotes TUG expression in GSCs (a, ) ChIP analysis of in the upstream region of TUG TSS. (a) Shemati iagram showing motifs aroun the TSS of TUG. Open irles iniate motifs. () Enrihment of in GSCs treate with either si-nc or si-. Regions examine y ChIP analysis are iniate as -outsie, R, R, R3 an 3 -outsie in a. Enrihment of is expresse as a perentage of input DNA., P<., Stuent s t-test. () Expression level of in GSCs treate with sirna against the iniate genes on the X-axis. Relative expression level to the sirna-negative ontrol (si-nc) is iniate on the Y-axis. P<., Kruskal-Wallis analysis. () Expression hanges of TUG in GSCs treate with sirna against. Values are iniate relative to aunane oserve in si-nc-treate ells., P<., Stuent s t-test. For all experiments ata, error ars iniate s.. (n=3).
11 Fig. f -atin Fig. EZH IgG Fig. h BDNF NGF -atin Fig. EZH YY Supplementary Figure. The original immunolot images utilize in this stuy The re setions iniate lot results shown in the iniate figures.
100 μm. Axon growth cones. Tubulin (red) + scr (green)
Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1
b PolyA RNA-seq c RNA-seq read distribution FPKM
a Repliate 2 (FPKM) Poly+ RN-seq 14 1-2 R2 =.998 1-4 -4-2 1 1 14 Repliate 1 (FPKM) Repliate 2 (FPKM) Poly RN-seq 14 1-2 R2 =.996 1-4 1-4 1-2 14 Repliate 1 (FPKM) RN-seq rea istriution Intron 12% 14% Intergeni
Supplementary Figure 1 - Ling
HA1 (%) Insulin seretion (SI) e 7. p=....... 7 p=.7 1 7 a-ell granules -ell granules BMI (kg/m ) -ells / (a- + -ells) p=. 1 7 1. p=.1..... 7 Age: -ell ontent: % Age: -ell ontent: % Age: -ell ontent: %
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
Rho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling
Rho-kinase Regulates Energy Balane y Targeting Hypothalami Leptin Reeptor Signaling Hu Huang 1, Dong Kong 1, Kyung Hee Byun 2, Chianping Ye 1, Shuihi Koda 1, Dae Ho Lee 1, Byung-Chul Oh 2, Sam W Lee 3,
FOXO3 signalling links ATM to the p53 apoptotic pathway following DNA damage
Reeive 19 Jan 212 Aepte 11 Jul 212 Pulishe 14 Aug 212 DOI: 1.138/nomms28 signalling links to the p apoptoti pathway following DNA amage Young Min Chung 1, *, See-Hyoung Park 1, *, Wen-Bin Tsai 2, Shih-Ya
Supplementary Material for. Inflammation induced repression of Foxp3-bound chromatin in regulatory T cells
Supplementary Material for Inflammation inue repression of -oun hromatin in regulatory T ells Aaron Arvey 1,2, Joris van er Veeken 1,2, Roert M. Samstein 1,2, Yongqiang Feng 1,2, John A. Stamatoyannopoulos
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Supplementary Figure 1. Verification of drug infusions into the IPN. a. Representative
Supplementary Figure 1. Verifiation of drug infusions into the IPN. a. Representative neutral red-stained oronal setion from a mouse with a guide annula targeting the IPN. The guide annula sar is irled
Cytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor
Cytomegalovirus and tumor stress-surveillane y human γδ T ell reeptor inding to Endothelial Protein C Reeptor Carrie R. Willox, Vinent Pitard, Sonia Netzer, Lionel Couzi, Mahoo Salim, Toias Silerzahn,
ALX4, an epigenetically down regulated tumor suppressor, inhibits breast cancer progression by interfering Wnt/β-catenin pathway
Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 DOI 10.1186/s13046-017-0643-9 RESEARCH Open Aess ALX4, an epigenetially own regulate tumor suppressor, inhiits reast aner progression
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplementary Figure 1. MLN8237 treatments show an unusual camel-back response pattern.
Supplementary Figure 1. MLN8237 treatments show an unusual camel-ack response pattern. NCI-H1819 cells were treated with serial concentrations of MLN8237 and four days after treatment, cell viaility was
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Implication of Long noncoding RNAs in the endothelial cell response to hypoxia revealed y RNAsequencing. Voellenkle C., Garcia-Manteiga J. M., Pedrotti S., Perfetti A., De Toma
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Information
Supplementary Information Optial ontrolling reveals time-dependent roles for adult-orn dentate granule ells Yan Gu, Maithe Arruda-Carvalho 3,4, Jia Wang, Stephen Janoshka,, Sheena Josselyn 3-5, Paul Frankland
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Supplementary Figure 1. Implants derived from human embryoid body preparations contain non-cardiac structures. In early studies, infarcted hearts
a Supplementary Figure 1. Implants derived from human emryoid ody preparations ontain non-ardia strutures. In early studies, infarted hearts reeived ell preparations of low ardia purity (
100 osimertinib. concentration of drugs (nm) Ba/F3 C797S/del19. concentration of drugs (nm) Ba/F3 C797S/T790M/L858R. relative cell vaibility (% of
Ba/F3 del19 Ba/F3 L858R a afatini afatini EGF-816 EGF-816 ty (% of ontrol) relative ell vaiilit elative ell vaiility (% of ontrol) 5 1 1 5 ty (% of ontrol) relative ell vaiilit 5 1 1 Ba/F3 T79M/L858R Ba/F3
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
Figure S1, Beyer et al.
Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
SUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
Spontaneous persistent ac.vity in entorhinal cortex modulates cor.co- hippocampal
Spontaneous persistent a.vity in entorhinal ortex moulates or.o- hippoampal intera.ons in vivo Thomas T. G. Hahn, James M. MFarlan, Sven Bererih, Bert Sakmann, Mayank R. Mehta Neoortial persistent Up states
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Learned spatiotemporal sequence recognition and prediction in primary visual cortex
Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
a b Pml F/F Prrx1-cre f 1.4 n.s.
a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1
mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Cos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
MicroRNA-494 promotes cancer progression and targets adenomatous polyposis coli in colorectal cancer
Zhang et al. Moleular Caner (8) 7: DOI.86/s94-7-75- RESEARCH Open Aess MiroRNA-494 promotes aner progression and targets adenomatous polyposis oli in oloretal aner Ying Zhang, Lu Guo,, Yuhuan Li,, Gui-Hai
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
Table S1. Total and mapped reads produced for each ChIP-seq sample
Tale S1. Total and mapped reads produced for each ChIP-seq sample Sample Total Reads Mapped Reads Col- H3K27me3 rep1 125662 1334323 (85.76%) Col- H3K27me3 rep2 9176437 7986731 (87.4%) atmi1a//c H3K27m3
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
The metabolic checkpoint kinase mtor is essential for IL-15 signaling during the development and activation of NK cells
The metaoli hekpoint kinase mtor is essential for IL- signaling uring the evelopment an ativation of NK ells Antoine Marçais, Julien Cherfils-Viini 6,, Charlotte Viant 7,, Sophie Degouve, Séastien Viel,8,
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
Supplementary Figure 1. Schematic illustrating major conclusions of this study.
ORNs GABA A GABA B glomeruli LN PNs Supplementary Figure 1. Shemati illustrating major onlusions of this study. This study represents the most diret evidene to date of inhiitory interations etween olfatory
Study of Necrosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mice
THE JOURNAL OF TROPICAL LIFE SCIENCE OPEN ACCESS Freely available online VOL. 3, NO. 1, pp. 58 62, January, 2013 Study of Nerosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mie Ahmad Soni,
Supplementary Information Computational Methods
Supplementary Information Computational Methods Data preproessing In this setion we desribe the preproessing steps taken to establish the data matrix of hepatoyte single ell gene expression data (Table
5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplemental Figure 1
mrn/ mirn expression 3.5 3.5.5.5 +Jagged mir-5+jagged Supplemental Figure HS mir-5 Z H HS mir-5 Z H HS mir-5 Z H HM MF PT HM JG HS Percentage of 4-44 + cells (%) mrn/mirn 8 6 4.5.5.5 mir-5 sh-jg +Jagged
Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Tethering by lamin A stabilizes and targets the ING1 tumour suppressor
Tethering y lamin A stailizes an targets the tumour suppressor Xijing Han 1,6, Xiaolan Feng 1,6, Jerome B. Rattner 2, Heather Smith 1, Pinaki Bose 1, Keiko Suzuki 1, Mohame A. Soliman 1,3, Mihelle S. Sott
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
a n a ly s i s Probabilistic modeling of Hi-C contact maps eliminates systematic biases to characterize global chromosomal architecture
Proailisti moeling of Hi-C ontat maps eliminates systemati iases to haraterize gloal hromosomal arhiteture Eitan Yaffe & Amos Tanay 2 Nature Ameria, In. All rights reserve. Hi-C experiments measure the
Supplementary Information
Supplementary Information Temozolomide suppresses MYC via activation of TAp63 to inhibit progression of human glioblastoma Tomohiro Yamaki, Yusuke Suenaga, Toshihiko Iuchi, Jennifer Alagu, Atsushi Takatori,
Acute transcriptional up-regulation specific to osteoblasts/osteoclasts in medaka fish
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Aute transriptional up-regulation speifi to osteoblasts/osteolasts in medaka fish immediately after exposure to mirogravity Masahiro Chatani, 1, Hiroya Morimoto,
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma
Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma cells were treated with celecoxib ( 5.0 M) and/or sildenafil (, 2.0 M). ls were isolated after
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +
FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP
The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake
Plum et al., Supplementary online material The Oesity Suseptiility Gene Caroxypeptidase E Links FoxO1 Signaling in Hypothalami Pro opiomelanoortin Neurons with Regulation of Food Intake Leona Plum, Hua
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
Supplemental Figures Supplemental Figure 1:
Supplemental Figures Supplemental Figure 1: Representative FACS data showing Concurrent Brain cell type Acquisition using either Percoll PLUS (top row) or myelin removal beads (bottom two rows). Debris
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)
3 (0.17) 24 (17.3) Sirt1 Hmg20 Gm4763 877 (857) c d Suppl. Figure 1. Screen validation for top candidate antagonists of Dot1L (a) Numer of genes with one (gray), two (cyan) or three (red) shrna scored
Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
tom tom 24hpf tom tom 48hpf tom 60hpf tom tom 72hpf tom
a 24hpf c 48hpf d e 60hpf f g 72hpf h i j k ISV ISV Figure 1. Vascular integrity defects and endothelial regression in mutant emryos. (a,c,e,g,i) Bright-field and (,d,f,h,j) corresponding fluorescent micrographs
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Supplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
oocytes were pooled for RT-PCR analysis. The number of PCR cycles was 35. Two
Supplementary Fig. 1 a Kdm3a Kdm4b β-actin Oocyte Testis Oocyte Testis Oocyte Testis b 1.8 Relative expression.6.4.2 Kdm3a Kdm4b RT-PCR analysis of Kdm3a and Kdm4b expression in oocytes and testes. Twenty
Supplementary Figure 1: Experimental design. DISCOVERY PHASE VALIDATION PHASE (N = 88) (N = 20) Healthy = 20. Healthy = 6. Endometriosis = 33
DISCOVERY PHASE (N = 20) Healthy = 6 Endometriosis = 7 EAOC = 7 Quantitative PCR (mirnas = 1113) a Quantitative PCR Verification of Candidate mirnas (N = 24) VALIDATION PHASE (N = 88) Healthy = 20 Endometriosis
Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan
Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin
Table S1. qpcr primer list.
Table S1. qpr primer list. Genes Forward primer Reverse primer NANOG AAATGGGAAGAATAGA GGTTAGTGGGTTA PAX6 TTTTGTTGGGAAATG TGGTTAAATTTAG ASL1 AAGATGAAAGAAAG GGAGTTTGATTAA NHLH GTGGATAGATATTT ATATTTTGGAATTT
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Nature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration
An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration Sabrina M. Lehmann, Christina Krüger, Boyoun Park, Katja Derkow, Karen Rosenberger, Jan Baumgart, Thorsten
LETTER. Journal Club. Pathogen-induced human T H 17 cells produce IFN-c or IL-10 and are regulated by IL-1b. Markus Geuking April 27 th, 2012
Journal Clu LETTER oi:1.138/nature1957 Pathogen-inue human T H 17 ells proue IFN- or IL-1 an are regulate y IL-1 Christina E. Zielinski 1, Feerio Mele 1, Dominik Ashenrenner 1, Davi Jarrossay 1, Franesa
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module
Supplementary Information Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module O Neil Wiggan, Bryce Schroder, Diego Krapf, James R. Bamurg and Jennifer G. DeLuca
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)