Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
|
|
|
- Colleen Cain
- 5 years ago
- Views:
Transcription
1 Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ), and heterozygous germ cell mutants (dnrar flox/+, Stra8-Cre +, RARElacZ) (C ) at 6-week-old. (C) A lacz-stained section from a control, heterozygous germ cell mutant, and germ cell mutant testes. Cells with a positive signal are shown in blue. Nuclei were counterstained with fast red. Scale bar: 20 m.
2 Figure S2. Complete blockage of spermatogonial differentiation in germ cell mutants at 2- and 3- week-old. (A-D) Hematoxylin and eosin staining of control (A and C) and germ cell mutant (B and D testes. (E-H) Immunohistochemical staining for STRA8 (red) in sections of 2- and 3-week-old control (E and G) and germ cell mutant (F and H) testes. Costaining for a germ cell marker, GCNA (green). (I- L) Immunohistochemical staining for LIN28 (red) and SOX9 (green) in sections of 2- and 3-week-old control (I and K) and germ cell mutant (J and L) testes.
3 Figure S3. Impaired spermatogonial differentiation in germ cell mutant testes. (A and B) Immunofluorescence staining for KIT (red) in sections of control (A), germ cell mutant (B). (C and D) Immunofluorescence staining for PLZF (red) and SOX9 (green) in sections of control (C), germ cell mutant (D). Costaining with DAPI (blue). White arrowheads indicate representative germ cells (differentiating spermatogonia). Scale bar, 20μm.
4 Figure S4. (A and B) Detection of apoptotic cells (TUNEL assays, green signal) from testis of (A) control and germ cell mutant (B) testes. Scale bar, 10μm. (C) Quantification of apoptotic spermatogonia (PLZF positive cells) in control and germ cell mutant testes. n=3-4, P>0.1; Student t test.
5 Figure S5. (A and B) FACS analysis showing stimulation of RA on cell cycle progression in spermatogonoa. The data (inset) shows one of the representative FACS. (C-E) Immunostaining for STRA8 (green) and EdU (red) in sections of WIN18,466-treated control (C), RA-injected WIN18,466- treated control (D), and RA-injected germ cell mutant (E) testes. Arrowheads indicate both STRA8 and EdU positive representative spermatogonia. Scale bar, 10μm.
6 Figure S6. Altered expression of genes for cell cycle progression in germ cell mutant spermatogonia. (A) Differential expression of genes for cell cycle progression between controls and germ cell mutants. (B) RT-qPCR analysis of mrna levels of Ccnd2 in control and germ cell mutant spermatogonia. (C) RT-qPCR analysis of mrna levels of Ccnd2 in WIN18,466-treated and RAinjected WIN18,466-treated mouse spermatogonia. Data (B and C) are expressed as fold differences compared with controls or WIN18,466-treated, respectively, normalized Rps2 (mean ± s.d., n=3; *P<0.05, Student t-test).
7 Table S1. Summary of differentially expressed genes in control and germ cell mutant THY1 + spermatogonia. Click here to Download Tables S1 Table S2. Primers used for quantitative RT-PCR. Gene Primer sequence Ccnd2 Forward: 5 -GAACCTGGCCGCAGTCACCC-3 5 -GGCTGCTCCCACGCTTCCAG-3 Hist1h1b Forward: 5 -TCCAAAGAAAGCGAAGAAGC-3 5 -GCCTTAGGCTTAGCGGTCTT-3 Hist1h2ai Forward: 5 -GCGACAACAAGAAGACGCGCAT-3 5 -CTGGATGTTGGGCAGGACGCC-3 Hist1h2bl Forward: 5 -AAGAAGGACGGCAAGAAGCGCA-3 5 -CGCTCGAAGATGTCGTTCACGA-3 Hist1h2bg Forward: 5 -TCGTGAACGACATCTTCGAG-3 5 -AGTGACAGCCTTGGTGCCCT-3 Hist1H3i Forward: 5 -TACCAGAAGTCGACCGAGCTG-3 5 -AGCCGAGCTCTGGAAGCG-3 Hist1H2bf Forward: 5 -AAGGAGAGCTACTCGGTGTACG-3 5 -AAACGAGTTCATGATGCCCA-3 Hist1H2bn Forward: 5 -GTGTACGTGTACAAGGTGCTGAAG-3 5 -TGTGATGGTCGAGCGCTTGT-3 Hist1h4k Forward: 5 -AACATCCAGGGCATCACCAAGC-3 5 -GTTCTCCAGGAACACCTTCAGC-3 Kit Forward: 5 -GCCACGTCTCAGCCATCTG-3 5 -GTCGGGATCAATGCACGTCA-3 Rps2 Forward: 5 -CTGACTCCCGACCTCTGGAAA-3 5 -GAGCCTGGGTCCTCTGAACA-3 Stra8 Forward: 5 -GTTTCCTGCGTGTTCCACAAG-3 5 -CACCCGAGGCTCAAGCTTC-3
8 Table S3. Primers used for ChIP quantitative-pcr. Stra8 Forward: 5 -ACCTCAAGTGACCTCCGTTT-3 5 -CACCACATCAGTTTGGCACA-3 Hist1 Forward: 5 -TTTCACTTCCCCTTGGCCTT-3 5 -ACAAGAAGACGCGCATCATC-3 Control Forward: 5 -GGCCAAGAAGCTGGTTGTAG-3 5 -ACTGCTCAGCTATCCAGTCC-3
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
SUPPLEMENTARY INFORMATION
Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.
IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina
Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed
Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed in the testes. The testes were immunostained with GFP
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants
SUPPLEMENTAL FIGURE LEGENDS: Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants (Sgpl1 -/- and Plekha1 -/- ). Using an antibody against CYP11a1 to label Leydig
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
a b c periosteum parietal bone bone marrow dura periosteum suture mesenchyme osteogenic front suture mesenchyme 1
coronary suture sagittal suture DOI: 10.1038/ncb3139 a b c e parietal bone suture mesenchyme parietal bone bone marrow ura ura ura f parietal bone ura suture mesenchyme bone g ura osteogenic front suture
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,
Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
Development Supplementary information
Supplemental Materials and Methods Mosaic clonal analysis GSC and SP clones were induced with the FLP/FRT-mediated mitotic recombination technique (Xu and Rubin, 1993) in files with following genotypes:
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic
Supplementary information Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic development Shilpi Minocha 1*, Delphine Valloton 1*, Yvan Arsenijevic 2, Jean-René Cardinaux 3, Raffaella
stability and tumor suppression
Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplemental Information. Nodal Signaling Regulates Germ Cell. Development and Establishment of Seminiferous. Cords in the Human Fetal Testis
Cell Reports, Volume 25 Supplemental Information Nodal Signaling Regulates Germ Cell Development and Establishment of Seminiferous Cords in the Human Fetal Testis Anne Jørgensen, Joni Macdonald, John E.
Nature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
SUPPLEMENTAL INFORMATION FOR. PAX7 expression defines germline stem cells in the adult testis
SUPPLEMENTAL INFORMATION FOR PAX7 expression defines germline stem cells in the adult testis Gina M. Aloisio, Yuji Nakada, Hatice D. Saatcioglu, Christopher G. Peña, Michael D. Baker, Edward D. Tarnawa,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,
Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
Ahtiainen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Ahtiainen et al., http ://www.jcb.org /cgi /content /full /jcb.201512074 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Distinct distribution of different cell cycle phases in the
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
AP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Huarui Zheng, Lou Chang, Neha Patel, Jiong Yang, Lori Lowe, Dennis K. Burns, and Yuan Zhu
Cancer Cell, Volume 13 Supplemental Data Induction of Abnormal Proliferation by Nonmyelinating Schwann Cells Triggers Neurofibroma Formation Huarui Zheng, Lou Chang, Neha Patel, Jiong Yang, Lori Lowe,
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Tissue-dependent consequences of Apc inactivation on proliferation and differentiation of ciliated cell progenitors via Wnt and Notch signaling
Washington University School of Medicine Digital Commons@Becker Open Access Publications 1-1-2013 Tissue-dependent consequences of Apc inactivation on proliferation and differentiation of ciliated cell
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Supplementary Information
Supplementary Information Figure S1: Follicular melanocytes in the wound peripheral area migrate to the epidermis in response to wounding stimuli. Dorsal skin of Trp2-LacZ mice stained with X-gal and analyzed
The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11
Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
SUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Myod +/ or Myod / females and Myod +/ ;Igf2 +/ males and
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
Supplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins
Supplemental Material PDGFRb regulates craniofacial development through homodimers and functional heterodimers with PDGFRa Katherine A. Fantauzzo and Philippe Soriano Supplemental materials provided: Supplemental
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Supplementary Materials and Methods
Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph
Supporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
Supplementary Figure S1: TIPF reporter validation in the wing disc.
Supplementary Figure S1: TIPF reporter validation in the wing disc. a,b, Test of put RNAi. a, In wildtype discs the Dpp target gene Sal (red) is expressed in a broad stripe in the centre of the ventral
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Overview of the transplant procedure and supplementary data to Figure 1. a. Under isofluorane anesthesia, the lumen of the colon is washed by a gentle PBS enema. b. Using a p200
Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
BNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine
Kanazawa, et al. Supplementary figure legends Supplementary Figure 1 DS rats had congestive heart failure. (A) DR and DS rat hearts. (B) QRT-PCR analysis of BNP mrna expression in DR and DS rat left ventricles
Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
Supplemental Data. Wnt/β-Catenin Signaling in Mesenchymal Progenitors. Controls Osteoblast and Chondrocyte
Supplemental Data Wnt/β-Catenin Signaling in Mesenchymal Progenitors Controls Osteoblast and Chondrocyte Differentiation during Vertebrate Skeletogenesis Timothy F. Day, Xizhi Guo, Lisa Garrett-Beal, and
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Supporting Information
Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal. Glucose Transport in Goldfish (Carassius auratus)
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal Glucose Transport in Goldfish (Carassius auratus) Ayelén Melisa Blanco 1,2, Juan Ignacio Bertucci 2,3, Naresh Ramesh 2, María Jesús Delgado
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/3/e1400244/dc1 Supplementary Materials for PlGF-induced VEGFR1-dependent vascular remodeling determines opposing antitumor effects and drug resistance to
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell
Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later