SUPPLEMENTARY INFORMATION
|
|
- Tyler Powell
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTRY INFORMTION Supplementary Figure 1. Q-Q plot of RE/NIMH autism family TDT results. The quantile-quantile plot of the expected and observed P-values is shown. The blue circles represent the observed data, the grey line is the expectation under the null hypothesis of no association, and the red curves are the boundaries of the 95% confidence interval. Data included are those passing our final QC. 1
2 SUPPLEMENTRY INFORMTION log 10 P chr X Supplementary Figure 2. enome-wide ssociation Results. The genome-wide TDT results are shown, with each chromosome represented by a different color. The blue line indicates P < 10-4, the significance at which we attempted to replicate results, and the red line indicates P < Data included are those passing our final QC. 2
3 SUPPLEMENTRY INFORMTION Supplementary Figure 3. Top TDT result. The 5p15 region is shown. The light blue lines represent recombination frequency, green lines represent the annotated genes, observed data are shown as diamonds, and imputed data are shown as circles. The most significant SNP is shown in blue with other SNPs in LD shaded in red, with darker colors indicating stronger LD. n imputed SNP (rs ) showed stronger association than the genotyped SNP in the same region. The green symbol represents the results of meta-analysis. 3
4 SUPPLEMENTRY INFORMTION Supplementary Figure 4. enotype plots of RE ffymetrix 5.0 data for rs plate plate rs enotype data is shown for each of the well plates of RE samples genotyped at plate plate plate 5 the Broad Institute, as well as the combined data (bottom right). Intensity data are plotted, with genotype calls indicated by color: blue, yellow, green plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate plate all 4
5 SUPPLEMENTRY INFORMTION Supplementary Figure 4. enotype plots of RE ffymetrix 5.0 data for rs enotype data is shown for each of the well plates of RE samples genotyped at the Broad Institute, as well as the combined data (bottom right). Intensity data are plotted, with genotype calls indicated by color: blue, yellow, green. Supplementary Table 1. Families used for genetic analysis. See file s2 pp 1-80 RE and NIMH families included in the genome-wide analysis. Each family and individual ID is shown, along with affection status used for analysis. Supplementary Table 2. Linkage analysis. See file s2 pp Linkage analysis results (see Methods) are given with LOD scores for all families and for families with both parents genotyped. 5
6 SUPPLEMENTRY INFORMTION Supplementary Table 3. Top TDT results. scan replication meta-analysis chr position SNP proxy_ld T U OR P P (w case-control) T U OR P (1sided) Pmeta Pproxy rs E rs E rs rs r 2 = 0.48, rs rs E N rs r 2 = 0.67, rs N rs E N rs E N rs E N rs rs E rs E E rs rs rs r 2 =0.71, rs N rs E E rs E N rs E rs E rs rs r 2 =0.74, rs N N N N N rs E rs E rs E rs r 2 =1,rs N N N N N rs E rs E rs N rs E rs r 2 =0.6, rs N N N N N rs E N rs E rs E E rs E N rs E N rs E rs E N rs rs E N rs E rs E N rs E E rs N rs E N XY rs E Top results from the RE-NIMH TDT (P < 10-4 ) are shown, with replication data, where it exists. For Sequenom genotyping that used a proxy SNP, that SNP and its LD (r 2 ) with the SNP of interest is shown. Transmitted (T) and untransmitted (U) counts and odds ratios (OR) for the minor allele are shown for each SNP. Replication results are shown for additional autism family data using ffymetrix and Sequenom genotyping technology. The meta-analysis P-value is shown, and the P-value for meta-analysis where proxy SNP data was included. Bold font, P < 10-5 TDT/case-control analysis, P < 0.05 replication, P < 2.5 x 10-7 meta-analysis. 6
7 SUPPLEMENTRY INFORMTION Supplementary Table 4. Imputation analysis in autism. imputation for RE/NIMH samples direct genotyping CHR SNP BP INFO T U OR P all_or all_p 1 rs E rs E-06 5 rs E E-06 5 rs E E-05 5 rs E-06 5 rs E-06 5 rs E-07 5 rs E-06 6 rs E-06 6 rs E rs E-06 9 rs E rs E rs E The top results from imputation analysis (P < 10-5 ) are shown for autosomes in the complete sample (RE and NIMH multiplex families). The odds ratio and P-value for direct genotyping are shown, where available. 7
8 SUPPLEMENTRY INFORMTION Supplementary Table 5. Set-based Tests of Candidate enes and Regions in utism TDT analysis of microdeletion and microduplication regions implicated in autism Region # SNPs Best TDT SNP & P value (OR) Empirical P region set 15q rs (2.1) 16p ns Potocki-Lupski 248 rs syndrome (0.43) Prader-Willi & ngelman 863 rs syndromes (0.64) Velo-Cardio-Facial 287 SNP_ syndrome (0.56) Williams syndrome 73 rs (0.56) (S1) TDT analysis of Mendelian disease genes implicated in autism Disease (gene) # SNPs Best TDT SNP & P Empirical P region set value (OR) Joubert syndrome 8 ns (HI1) Timothy syndrome 103 rs (CCN1C) (0.89) Smith-Lemli-Opitz 3 ns syndrome (DHCR7) Fragile X syndrome 1 ns (FMR1) Rett syndrome 5 rs (S5) ns (MECP2) (0.79) Neurofibromatosis type I 11 ns (NF1) Cowden disease 3 ns (PTEN) Tuberous Sclerosis type 7 rs I (TSC1) (1.3) Tuberous Sclerosis type II (TSC2) 2 rs (0.77) (S1) ns 8
9 SUPPLEMENTRY INFORMTION TDT analysis of genes with rare mutations implicated in autism ene # SNPs Best TDT SNP & P value (OR) Empirical P region set NRXN1 182 rs (0.70) NLN4X 40 rs (0.82) SHNK3 2 ns TDT analysis of candidate genes implicated by association studies in autism ene # SNPs Best TDT SNP & P value (OR) Empirical P region set VPR1 3 ns CNTNP2 355 rs (0.68) DISC1 69 rs (1.2) RIK2 59 rs (0.87) EN2 2 ns BRB3 27 rs (1.3) ITB3 14 ns MET 14 rs (0.87) OXTR 7 ns RELN 87 rs (0.85) SLC ns SLC64 3 ns Supplementary Table 5. Set-based tests of candidate genes and regions in autism. Four sets of regions and genes of prior interest in autism were examined: microdeletion and microduplications, Mendelian disease genes, genes with rare mutations, and genes with common variant association reported in autism 1. For each, the number of SNPs in the region (or gene +/- 2kb), the best single SNP TDT result and its odds ratio (OR), the best empirical P-value with number of SNPs used, the gene-based corrected test, and setbased corrected test are shown. 9
10 SUPPLEMENTRY INFORMTION Supplementary Table 6. ssociation results in linkage regions. SNPs in linkage regions P < 0.01 chr snp bp a1 a2 T 6q27 rs T C p13 rs p13 rs C T p13 rs C T 728 haplotypes in linkage regions P < chr snps haplo bp_first bp_last T 6q27 rs rs rs rs rs CC q27 rs rs rs rs rs TCCC q27 rs rs rs rs rs CTTTC q27 rs rs rs rs rs TTTC p13 rs rs rs rs rs CCTC p13 rs rs rs rs rs CCCT Single SNP (P < 10-2 ) and 5-SNP haplotype association results (P < 10-3 ) in the significant and suggestive linkage regions are shown. 10
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
More informationSupplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer
Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer risk in stage 1 (red) and after removing any SNPs within
More informationDan Koller, Ph.D. Medical and Molecular Genetics
Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationNIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2010 April 8.
NIH Public Access Author Manuscript Published in final edited form as: Nature. 2009 October 8; 461(7265): 802 808. doi:10.1038/nature08490. A GENOME-WIDE LINKAGE AND ASSOCIATION SCAN REVEALS NOVEL LOCI
More informationRole of Molecular Genetic Assessment for Autism in Clinical Setting
Role of Molecular Genetic Assessment for Autism in Clinical Setting Young Shin Kim, MD, MS, MPH, PhD Director STAR Center for ASD and NDDs Psychiatric Genetic Epidemiology Associate Professor Dept. of
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationIntroduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder
Introduction to linkage and family based designs to study the genetic epidemiology of complex traits Harold Snieder Overview of presentation Designs: population vs. family based Mendelian vs. complex diseases/traits
More informationIntroduction to Genetics and Genomics
2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,
More information# For the GWAS stage, B-cell NHL cases which small numbers (N<20) were excluded from analysis.
Supplementary Table 1a. Subtype Breakdown of all analyzed samples Stage GWAS Singapore Validation 1 Guangzhou Validation 2 Guangzhou Validation 3 Beijing Total No. of B-Cell Cases 253 # 168^ 294^ 713^
More informationNature Genetics: doi: /ng Supplementary Figure 1. Study design.
Supplementary Figure 1 Study design. Leukopenia was classified as early when it occurred within the first 8 weeks of thiopurine therapy and as late when it occurred more than 8 weeks after the start of
More informationTutorial on Genome-Wide Association Studies
Tutorial on Genome-Wide Association Studies Assistant Professor Institute for Computational Biology Department of Epidemiology and Biostatistics Case Western Reserve University Acknowledgements Dana Crawford
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationGenetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder)
Genetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder) September 14, 2012 Chun Xu M.D, M.Sc, Ph.D. Assistant professor Texas Tech University Health Sciences Center Paul
More informationIntroduction to the Genetics of Complex Disease
Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome
More informationLarge-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017
Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2
More informationSUPPLEMENTARY DATA. 1. Characteristics of individual studies
1. Characteristics of individual studies 1.1. RISC (Relationship between Insulin Sensitivity and Cardiovascular disease) The RISC study is based on unrelated individuals of European descent, aged 30 60
More informationInvestigating causality in the association between 25(OH)D and schizophrenia
Investigating causality in the association between 25(OH)D and schizophrenia Amy E. Taylor PhD 1,2,3, Stephen Burgess PhD 1,4, Jennifer J. Ware PhD 1,2,5, Suzanne H. Gage PhD 1,2,3, SUNLIGHT consortium,
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationSupplementary information. Supplementary figure 1. Flow chart of study design
Supplementary information Supplementary figure 1. Flow chart of study design Supplementary Figure 2. Quantile-quantile plot of stage 1 results QQ plot of the observed -log10 P-values (y axis) versus the
More informationSupplementary Information. Data Identifies FAN1 at 15q13.3 as a Susceptibility. Gene for Schizophrenia and Autism
Supplementary Information A Scan-Statistic Based Analysis of Exome Sequencing Data Identifies FAN1 at 15q13.3 as a Susceptibility Gene for Schizophrenia and Autism Iuliana Ionita-Laza 1,, Bin Xu 2, Vlad
More informationBig Data Training for Translational Omics Research. Session 1, Day 3, Liu. Case Study #2. PLOS Genetics DOI: /journal.pgen.
Session 1, Day 3, Liu Case Study #2 PLOS Genetics DOI:10.1371/journal.pgen.1005910 Enantiomer Mirror image Methadone Methadone Kreek, 1973, 1976 Methadone Maintenance Therapy Long-term use of Methadone
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationindicated in shaded lowercase letters (hg19, Chr2: 217,955, ,957,266).
Legend for Supplementary Figures Figure S1: Sequence of 2q35 encnv. The DNA sequence of the 1,375bp 2q35 encnv is indicated in shaded lowercase letters (hg19, Chr2: 217,955,892-217,957,266). Figure S2:
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts
More informationImaging Genetics: Heritability, Linkage & Association
Imaging Genetics: Heritability, Linkage & Association David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University July 17, 2011 Memory Activation & APOE ε4 Risk
More informationSupplementary Figures
Supplementary Figures Supplementary Fig 1. Comparison of sub-samples on the first two principal components of genetic variation. TheBritishsampleisplottedwithredpoints.The sub-samples of the diverse sample
More informationSupplementary Online Content
Supplementary Online Content Lotta LA, Stewart ID, Sharp SJ, et al. Association of genetically enhanced lipoprotein lipase mediated lipolysis and low-density lipoprotein cholesterol lowering alleles with
More informationWhole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis
HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control
More informationUNIVERSITY OF CALIFORNIA, LOS ANGELES
UNIVERSITY OF CALIFORNIA, LOS ANGELES BERKELEY DAVIS IRVINE LOS ANGELES MERCED RIVERSIDE SAN DIEGO SAN FRANCISCO UCLA SANTA BARBARA SANTA CRUZ DEPARTMENT OF EPIDEMIOLOGY SCHOOL OF PUBLIC HEALTH CAMPUS
More informationAssociation-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis
Supplementary Material Association-heterogeneity mapping identifies an Asian-specific association of the GTF2I locus with rheumatoid arthritis Kwangwoo Kim 1,, So-Young Bang 1,, Katsunori Ikari 2,3, Dae
More informationName: PS#: Biol 3301 Midterm 1 Spring 2012
Name: PS#: Biol 3301 Midterm 1 Spring 2012 Multiple Choice. Circle the single best answer. (4 pts each) 1. Which of the following changes in the DNA sequence of a gene will produce a new allele? a) base
More informationSupplementary Figure S1A
Supplementary Figure S1A-G. LocusZoom regional association plots for the seven new cross-cancer loci that were > 1 Mb from known index SNPs. Genes up to 500 kb on either side of each new index SNP are
More informationSupplementary Information. Common variants associated with general and MMR vaccine-related febrile seizures
Supplementary Information Common variants associated with general and MMR vaccine-related febrile seizures Bjarke Feenstra, Björn Pasternak, Frank Geller, Lisbeth Carstensen, Tongfei Wang, Fen Huang, Jennifer
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationAn Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018
An Introduction to Quantitative Genetics I Heather A Lawson Advanced Genetics Spring2018 Outline What is Quantitative Genetics? Genotypic Values and Genetic Effects Heritability Linkage Disequilibrium
More informationFigure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022
96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo
More informationClinical evaluation of microarray data
Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray
More informationFrequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R
Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB
More informationRACP Congress 2017 Genetics of Intellectual Disability and Autism: Past Present and Future 9 th May 2017
RACP Congress 2017 Genetics of Intellectual Disability and Autism: Past Present and Future 9 th May 2017 Why causation? Explanation for family Prognosis Recurrence risk and reproductive options Guide medical
More informationChromatin marks identify critical cell-types for fine-mapping complex trait variants
Chromatin marks identify critical cell-types for fine-mapping complex trait variants Gosia Trynka 1-4 *, Cynthia Sandor 1-4 *, Buhm Han 1-4, Han Xu 5, Barbara E Stranger 1,4#, X Shirley Liu 5, and Soumya
More informationunderlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
More informationWelcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm
Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease
More informationLTA Analysis of HapMap Genotype Data
LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap
More informationCONTENT SUPPLEMENTARY FIGURE E. INSTRUMENTAL VARIABLE ANALYSIS USING DESEASONALISED PLASMA 25-HYDROXYVITAMIN D. 7
CONTENT FIGURES 3 SUPPLEMENTARY FIGURE A. NUMBER OF PARTICIPANTS AND EVENTS IN THE OBSERVATIONAL AND GENETIC ANALYSES. 3 SUPPLEMENTARY FIGURE B. FLOWCHART SHOWING THE SELECTION PROCESS FOR DETERMINING
More informationAutism spectrum disorders (ASDs) encompass a broad range
STRUCTURED REVIEW Copy number variation in the dosage-sensitive 16p11.2 interval accounts for only a small proportion of autism incidence: A systematic review and meta-analysis Kyle M. Walsh, MPhil, and
More informationA rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France
A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is
More informationA Genome-wide Association Study in Han Chinese Identifies Multiple. Susceptibility loci for IgA Nephropathy. Supplementary Material
A Genome-wide Association Study in Han Chinese Identifies Multiple Susceptibility loci for IgA Nephropathy Supplementary Material Xue-Qing Yu 1,13, Ming Li 1,13, Hong Zhang 2,13, Hui-Qi Low 3, Xin Wei
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationAssociation mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
More informationSelf reported ethnicity
Self reported ethnicity Supplementary Figure 1 Ancestry stratifies patterns of human genetic variations. PCA plots (1 st, 2 nd and 3 rd components) estimated from human genotypes. Individuals are coloured
More informationClinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues
Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing
More informationAssociating Copy Number and SNP Variation with Human Disease. Autism Segmental duplication Neurobehavioral, includes social disability
Technical Note Associating Copy Number and SNP Variation with Human Disease Abstract The Genome-Wide Human SNP Array 6.0 is an affordable tool to examine the role of copy number variation in disease by
More informationHuman Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980
Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial
More informationThe Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician
The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician Part VII Recent Advances in the Genetics of Autism Spectrum Disorders Abha R. Gupta, MD, PhD Jointly
More informationGenetics of extreme body size evolution in mice from Gough Island
Genetics of extreme body size evolution in mice from Gough Island Karl Broman Biostatistics & Medical Informatics, UW Madison kbroman.org github.com/kbroman @kwbroman bit.ly/apstats2017 This is a collaboration
More information2) Cases and controls were genotyped on different platforms. The comparability of the platforms should be discussed.
Reviewers' Comments: Reviewer #1 (Remarks to the Author) The manuscript titled 'Association of variations in HLA-class II and other loci with susceptibility to lung adenocarcinoma with EGFR mutation' evaluated
More informationIndex. Child Adolesc Psychiatric Clin N Am 16 (2007) Note: Page numbers of article titles are in boldface type.
Child Adolesc Psychiatric Clin N Am 16 (2007) 745 749 Index Note: Page numbers of article titles are in boldface type. A Adolescent(s), velocardiofacial syndrome in, psychiatric disorders associated with,
More informationMosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer
Supplementary Information Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Lars A. Forsberg, Chiara Rasi, Niklas Malmqvist, Hanna Davies, Saichand
More informationNew Enhancements: GWAS Workflows with SVS
New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences
More informationTable S2. Baseline characteristics of the Rotterdam Study for interaction analysis
Supplementary data Table S1. List of the primers for the cloning of precursor mir-4707 Table S2. Baseline characteristics of the Rotterdam Study for interaction analysis Table S3. List of the primers for
More informationGenome-wide Association Analysis Applied to Asthma-Susceptibility Gene. McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S.
Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S. December 17, 2014 1 Introduction Asthma is a chronic respiratory disease affecting
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationIntroduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
More informationDevelopments in Laboratory Genetics
Developments in Laboratory Genetics Rachel Butler rachel.butler@wales.nhs.uk The Impact of Genomics on Public Health Where are we now? Single gene disorders Core disorders Newborn screening (CF, MCAD)
More informationNature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
More informationApproach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD
Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Illustration of the working of network-based SVM to confidently predict a new (and now confirmed) ASD gene. Gene CTNND2 s brain network neighborhood that enabled its prediction by
More informationA genome-wide association study identifies vitiligo
A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples
More informationChromosomal inheritance & linkage. Exceptions to Mendel s Rules
Overhead If a cell is 2n = 6, then how many different chromosomal arrangements at Metaphase I (not including mirror images) could it have? 2. 2 3. 3 4. 4 show 5. 5 Probability What is the probability that
More informationVariation in linkage disequilibrium patterns between populations of different production types VERONIKA KUKUČKOVÁ, NINA MORAVČÍKOVÁ, RADOVAN KASARDA
Variation in linkage disequilibrium patterns between populations of different production types VERONIKA KUKUČKOVÁ, NINA MORAVČÍKOVÁ, RADOVAN KASARDA AIM OF THE STUDY THE COMPARISONS INCLUDED DIFFERENCES
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationUpdate on the Genetics of Autism and Rett syndrome
Update on the Genetics of Autism and Rett syndrome Mark E. S. Bailey Lecturer in Molecular Genetics Molecular Genetics, FBLS University of Glasgow M.Bailey@bio.gla.ac.uk 0141 330 5994 Research interests
More informationDuring the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin,
ESM Methods Hyperinsulinemic-euglycemic clamp procedure During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin, Clayton, NC) was followed by a constant rate (60 mu m
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationWhat#are#the#different#types#of#mutations#&#phenotypic#effects?#Give#an#example#of#a#disease#for#each.#
Mutation#Classifications:# a. Location# #understand#the#differences#and#consequences.# # o Germinal* *gametes,*inherited* o Somatic* *other*cells,*not*generally*inherited* o Autosomal* *within*genes*on*autosomes*
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationAssociation of genetic polymorphisms with chronic obstructive pulmonary disease in the Chinese Han population: a case control study
Guo et al. BMC Medical Genomics 2012, 5:64 RESEARCH ARTICLE Open Access Association of genetic polymorphisms with chronic obstructive pulmonary disease in the Chinese Han population: a case control study
More informationR.C.P.U. NEWSLETTER. Hunting for Genes - It isn=t as easy as it looks! Angelman syndrome:
R.C.P.U. NEWSLETTER Editor: Heather J. Stalker, M.Sc. Director: Roberto T. Zori, M.D. R.C. Philips Research and Education Unit Vol. XII No. 1 A statewide commitment to the problems of mental retardation
More informationThe common colorectal cancer predisposition SNP rs at chromosome 8q24 confers potential to enhanced Wnt signaling
SUPPLEMENTARY INFORMATION The common colorectal cancer predisposition SNP rs6983267 at chromosome 8q24 confers potential to enhanced Wnt signaling Sari Tuupanen 1, Mikko Turunen 2, Rainer Lehtonen 1, Outi
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationExample HLA-B and abacavir. Roujeau 2014
Example HLA-B and abacavir Roujeau 2014 FDA requires testing for abacavir Treatment with abacavir is generally well tolerated, but 5% of the patients experience hypersensitivity reactions that can be life
More informationSupplementary Materials
1 Supplementary Materials Rotger et al. Table S1A: Demographic characteristics of study participants. VNP RP EC CP (n=6) (n=66) (n=9) (n=5) Male gender, n(%) 5 (83) 54 (82) 5 (56) 3 (60) White ethnicity,
More informationNOTES: Exceptions to Mendelian Genetics!
NOTES: 11.3 Exceptions to Mendelian Genetics! Beyond Dominant and Recessive Alleles Some alleles are neither dominant nor recessive, and many traits are controlled by multiple alleles OR multiple genes.
More informationSupplementary Figure 1. A - MSH6 p.val282thrfs*10: Endome. Endome. Colon
Supplementary Figure 1 - MSH6 p.val282hrfs*10: 1780 1785 C C C C C 1 B - MSH6 p.phe1088leufs*5: 1820 1810 Rectal Rectal Gastric C C C C C C Rectal C 2 C - MSH6 p.rg1172lysfs*5: 1745 1740 Ovarian 3 D -
More informationUniversity of Groningen. Metabolic risk in people with psychotic disorders Bruins, Jojanneke
University of Groningen Metabolic risk in people with psychotic disorders Bruins, Jojanneke IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra54/dc1 Supplementary Materials for Clonal status of actionable driver events and the timing of mutational processes in cancer evolution
More informationWKH$F02( (R539T( 957( 005( 24# 17# 32# 26# 30# 21# 21# 9# 14# 18# 9# 13# 21# 14# 14# 2# 42# 17#
20 KH$C(( WT( WKH$F02( (R539T( WKH$F04( (Y493H( WKH$F03( C580Y( 18 027( 004( 010( 967( 005( 0.94 957( 0.96 887( 818$2( 0.98 829( 1.00 1.02 1.04 16 14 12 10 8 6 4 2 0 n 113 142 170 140 158 143 244 217 78
More informationSupplementary Figure 1. Nature Genetics: doi: /ng.3736
Supplementary Figure 1 Genetic correlations of five personality traits between 23andMe discovery and GPC samples. (a) The values in the colored squares are genetic correlations (r g ); (b) P values of
More informationTable S1. Trait summary for Northern Leaf Blight resistance in the maize nested association mapping (NAM) population and individual NAM families
SUPPLEMENTAL MATERIAL Supplemental Tables: Table S1. Trait summary for Northern Leaf Blight resistance in the maize nested association mapping (NAM) population and individual NAM families "#$%&' (')*'%$+,-'
More informationWhat s the Human Genome Project Got to Do with Developmental Disabilities?
What s the Human Genome Project Got to Do with Developmental Disabilities? Disclosures Neither speaker has anything to disclose. Phase Two: Interpretation Officially started in October 1990 Goals of the
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationNIH Public Access Author Manuscript Obesity (Silver Spring). Author manuscript; available in PMC 2013 December 01.
NIH Public Access Author Manuscript Published in final edited form as: Obesity (Silver Spring). 2013 June ; 21(6): 1256 1260. doi:10.1002/oby.20319. Obesity-susceptibility loci and the tails of the pediatric
More informationSupplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
More informationSupplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles
Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles (green) of (A) HLA-A, HLA-B, (C) HLA-C, (D) HLA-DQA1,
More informationADVANCED PGT SERVICES
Genomic Prediction ADVANCED PGT SERVICES with PGT-A using SEQ is a cost-effective, rigorously validated, unambiguous, and streamlined test for aneuploidy in blastocyst biopsies, and uses state of the art
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More information