Disclaimers. Molecular pathology of brain tumors. Some aspects only. Some details are inevitably personal opinions

Transcription

1 Molecular pathology of brain tumors Disclaimers Some aspects only H.K. Ng The Chinese University of Hong Kong Some details are inevitably personal opinions Free ppt : Why is molecular pathology so important in neurooncology? A pre meeting for the panel Members for the WHO classification INTEGRATED DIAGNOSIS OF BRAIN TUMORS Louis DN et al. Brain Pathology 2014 Infiltrative nature of gliomas Median recurrence 7 months Median survival with treatment Glioblastoma 18 m to 2 yrs Anaplastic astrocytoma : 2 yrs Diffuse astrocytoma : 2 4 yrs

2 WHO Classification of CNS Tumors But there are 107 entities in WHO 2016! Louis DN & Ellison DW et al., 2016 Genes, what genes? Have the WHO Created a dinosaur? A beginning not an end

3 Aims of providing molecular information in clinical practice But your molecular pathology Is critical towards management Classification/Diagnosis Prognostication Prediction to treatment Reifenberger G, et al Nature Reviews Clinical Oncology 2016 Refenberger G, et al. Nature Review Clinical Oncology 2016

4 Inter observer variability in histology Especially in adult gliomas Histology review of a major EORTC trial on anaplastic oligodendrolgial tumour (Kros JNEN 2007) 114 tumours reviewed by 9 international experts Five out of 9 pathologists agree with the consensus diagnosis (6 out of 9) less than 60% of times Is IDH better than Pathologists grading? Hartmann C et al. Acta Neuropathologica 2010 Isocitrate dehydrogenase (IDH)1 Median survival : 31 months for mutated GBM (IDH1 or 2), 15 months for wild-type 65 months for anaplastic astrocytomas mutated, 20 months for wild-type Also Parsons et al. Science 2008 I A ATRX+IDH1 I CF : ATRX/1p19q/CIC/FUBP1 (either Jiao et al Yan et al. NEJM 2009 Gupta et al. 2011

5 1)Tissue from tumour area 2)Proteinase K Procedure of IDH1 Sequencing DNA Polymerase DNTP MgCl2 Cell lysate F& RPrimer IDH1 gel electrophoresis Prepare cell lysate PCR amplification Denaturation: 95 c,20sec Annealing: 60 c,20sec Extension: 72 c,30sec 500bp > 100bp > IDH1 PCR Product size 122bp DNA Sequencing Perform gel electrophoresis Control Sequencing reaction IDH1 F: 5' CGGTCTTCAGAGAAGCCATT 3' IDH1 R: 5' CACATTATTGCCAACATGAC 3' IDH1 Chromatogram Wild type R132H R132L A G G T C A T A G G T C T T Andreas Von Deimling Mutation Arginine >Histidine (>90%) Mutation Arginine >Leucine (rare) IDH1 IHC

6 Glioblastoma 2016 Glioblastoma, IDH wild type Giant cell glioblastoma Gliosarcoma Epitheloid rhabdoid glioblastoma Glioblastoma, IDH mutant Glioblastoma, NOS Prediction of response To RT Chemo, II and III (retrospective) Yao, Yan, Ng Oncotarget 2015

7 Diffuse gliomas De novo pathway Glial progenitor cells Progressive pathway Glial progenitor cells IDH mutation EGFR amplification (~35%) p53 mutation (~30%) PTEN mutation (~25%) NF1 alteration (~20%) 10p LOH (~70%) 10q LOH (~70%) TERT promoter mutation (~70%) p53 mutation ATRX mutation Anaplastic Astrocytoma Common precursor cells Diffuse Astrocytoma 1p/19q codeletion CIC mutation FUBP1 mutation TERT promoter mutation Oligodendroglioma Anaplastic Oligodendroglioma Grade II Grade III 10q LOH Primary GBM (~90%) Secondary GBM (~10%) Grade IV Secondary glioblastoma IDH mutant glioblastoma Diffuse astrocytoma Diffuse astrocytoma, IDH mutant Gemistocytic astrocytoma, IDH mutant Diffuse astrocytoma IDH wild type Diffuse astrocytoma, NOS

8 Low Grade Astrocytoma (WHO grade II) Oligodendroglioma median survival 7 10 years Sensitive chemotherapy PCV or Temozolamide 1p/19q as prognostic indicator of Grade III oligodendroglioma RTOG results Giannini, Burger. Brain Pathology 2008

9 FISH procedure DNA + Fluorophore conjugated nucleotides 1p/19q codeleted group 1p/19q codeleted group Protease digestion Denaturation Labeling Fluorophore tagged probes Hybridization Tissue section Double stranded DNA Single stranded DNA Hybrids Post hybridization wash Mounting with counterstain Signal scoring 1p/19q noncodeleted group 1p/19q noncodeleted group Imaging Green/red = Target and reference probes Blue = DAPI stained nucleus/chromosomes Fluorescence microscope Cairncross et al van den Bent et al Procedure of analysis 1p/19q Dewax Treated with Sodium Thiocyanate (NaSCN ) Pepsin digestion and check permeability Incubate and hybridize with FISH probe and seal coverslip with rubber cement Red = 1p Green = 1q Red = 19q Green = 19p Counterstain with C DAPI FISH is very much a FFPE test Assess under fluorescent Microscope

10 Oligodendroglial tumors 2016 Oligodendroglioma, IDH mutant and 1p19q codeleted Oligodendroglioma, NOS Anaplastic oligodendroglioma, IDH mutant and 1p19q codeleted Anaplastic oligodendroglioma, NOS Oligoastrocytoma, NOS Anaplastic oligoastrocytoma, NOS WHO classification 2016 Does 1p19q non deleted oligodendrogliomas exist? Does oligoastrocytoma exist anymore? WHO 2007 Li YX, Shi ZF, Ng HK. Oncotarget 2016

11 Molecular genetics of Oligoastrocytomas Dong & Ng Human Pathology 2002 Tong & Ng Histopathology 1999 Personal view mostly correct try not to make this an easy diagnosis Astrocytoma Oligo with IDH1 Oligodendroglioma

12 p53 1p+/19q+ Aldape Burger Perry

13 p53 1p-/19q- Aldape Burger Perry Aldape Burger Perry Grading in histology remains descriptive WHO 2016 Grade II III astrocytoma With increased mitotic activity, usually accompanied by distinct nuclear atypia and high cellularity Ependymoma Anaplastic Ependymoma..most are subjective.. There have been few studies of prognostic significance. Grading is hardly ever used for therapeutic stratification 1087 diffuse gliomas (Mayo, UCSF, TCGA) >600 grades II and III 289 grades II and III diffuse gliomas Methylation Expression acgh mirna What are the truly low grade gliomas? Eckel-Passow JE & Jenkins RB et al., 2015 IDH and 1p19q codeletion TCGA, 2015

14 Lower grade gliomas TCGA Group 1 IDH mut, 1p19q codeleted > 15 yr survival Group 2 IDH mut, 1p19q non deleted 8 12 year survival Group 3 IDH wt, 1p19q non deleted survival 2 3 yrs Promoter 1,295,250 1,295, C250T 124 C228T 58 TSS 1 ATG TERT C250T CCCCTTCCGGG C228T CCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGG CCCTTCCGGG - ETS (E-twenty-six) transcription factors binding site C228T C250T Mutated TERT promoter C228 C250 Wild type TERT promoter Killela et al. 2013

15 Prognostic significance of TERT in LGG Among Low Grade Gliomas which are IDH, 1p19q non deleted, TERT (n=80) IDH wild type lower grade gliomas (n=74) IDH wild type astrocytomas (n=65) p=0.001 p=0.001 p=0.007 p=0.008 Survival (%) TERT wt (n=58) Survival (%) TERT wt (n=58) Survival (%) TERT wt (n=49) Survival (%) TERT wt (n=49) TERT mut (n=16) TERT mut (n=16) TERT mut (n=16) TERT mut (n=16) PFS (months) OS (months) PFS (months) OS (months) Chan and Ng, Modern Pathology 2015 Chan, Mao, Ng. New England Journal of Medicine 2016 Also, Killela P, Yan H, Bigner DD. Oncotarget, 2015 Diffuse astrocytoma Diffuse astrocytoma, IDH mutant Gemistocytic astrocytoma, IDH mutant Diffuse astrocytoma IDH wild type Diffuse astrocytoma, NOS

16 IDH wt astrocytoma Can be further stratified Aibaidula, Ng. Neuro oncology 2017 All IDH wild type lower grade gliomas Pediatric brain tumors Molecular high grade TERT or H3F3A or EGFR Survival % Molecularly lower grade (n=68) Molecularly high grade (n=51) p <0.001 OS (years) Brain cancer is the most important group of childhood solid cancer Often urgent operations Great demand for neuro oncology greater clinical demands What is known about adults is generally not true for pediatrics Relatively good survival compared with GBM Chromatin modulating genes H3F3A Diffuse mid line H3K27M glioma (Diffuse infantile pontine glioma /DIPG) Fontebasso & Jabado Brain Pathology 2013

17 H3K27M glioma WHO years old female Thalamic GBM K27M-H3.3 mutations (AAG ATG, lysine methionine)?? Pediatric Infiltrative astrocytoma Grade II

18 Pilocytic astrocytoma Pilocytic astrocytoma of cerebellum pilocytic V600E V600 BRAF sequencing with FFPE around 10% of pilocytic astrocytoma

19 Lassaletta Ng,..Tarbori Journal of Clinical Oncology 2017 Also Capper D et al. Acta Neuropathol 2012 Many melanomas and papillary thyroid cancers 60-70% PXA 50-60% Langerhan cell histiocytosis 20% Ganglioglioma 5-10% Pilocytic astrocytoma, mostly supratentorial High concordance between IHC and sequencing Schindler, von Deimling Acta Neuropathol 2011 Dias-Santagata, Louis, Santagata PLoS1 2011

20 PXA reticulin BRAF V600E PXA PXA Ida, Giannin Brain Pathology 2015 Classic medulloblastoma

21 Nodular medulloblastoma medulloblastoma Desmoplastic / nodular medulloblastoma

22 Anaplastic medulloblastoma Anaplastic medulloblastoma McManamay Brain Pathology 2007; similar finding by Giangaspero et al Acta Neuropathol 2006 David Ellison Taylor, Acta Neuropathologica 2012

23 Principle of ncounter Technology (NanoString) Step 3: Probes are aligned and read by imaging system Example of raw data generated by the nanostring ncounter Technologies -Contains positive & negative controls, 22 subgroupspecific genes, and 3 housekeeping genes. Also depends on a good R script Positive hybridization controls Negative hybridization controls 22 subgroup-specific genes 3 housekeeping genes Using David Ellison s protocol Acta Neuropathologica 2011 Li and Ng 2013

24 Anaplastic medulloblastoma C myc N myc ATRT Rhabdoid features ATRT

25 ATRT INI 1

26 The Times They Are A Changin Nobel Laureate 2016 Dylan As the present now Will later be past You better start swimming or You ll sink like a stone The times they are a changin

27 Peter Burger F Stephen Vogel Robin O Barnard