RNA - protein interactions in mrna decay A case study on TTP and HuR in AMD

Size: px
Start display at page:

Download "RNA - protein interactions in mrna decay A case study on TTP and HuR in AMD"

Transcription

1 RNA - protein interactions in mrna decay A case study on TTP and HuR in AMD Jörg Fallmann Institute for Theoretical Biochemistry University of Vienna Research Platform Decoding mrna decay in inflammation Interdisciplinary project funded by the University of Vienna

2 ARE Mediated Decay (AMD) AU-rich element 5' UTR CDS 3' UTR poly-a tail J. Fallmann,TBI RNA - protein interactions in RNA decay 1/ 13

3 Open Questions How do ABPs choose their target(s)? Do RNA elements dictate function in AMD? What makes the difference (sequence and/or structure)? Different binding site == different decay rate? Do ABPs compete for RNA motifs? Exact mechanisms of AMD and ARE-ABP interaction remain unclear J. Fallmann,TBI RNA - protein interactions in RNA decay 2/ 13

4 Biological system Primary mouse macrophages LPS induces inflammatory response No overexpression needed TTP +/+ (WT) and TTP / (KO) mouse PAR-iCLIP based dataset RNA-Seq without crosslink (Vitaly Sedlyarov, Kovarik Lab) J. Fallmann,TBI RNA - protein interactions in RNA decay 3/ 13

5 Binding preferences TTP TTP binds predominantly to 3 UTR exons Surprisingly high read counts in CDS introns Function of intronic binding unclear (sponge?) HuR HuR binds predominantly to 3 UTR exons independently of TTPs presence J. Fallmann,TBI RNA - protein interactions in RNA decay 4/ 13

6 MEME J. Fallmann,TBI RNA - protein interactions in RNA decay 5/ 13

7 TTP/HuR 3 UTR target genes J. Fallmann,TBI RNA - protein interactions in RNA decay 6/ 13

8 Overlap sequence motif 2 bits 1 1U U 2A 3U AU C G 4 AU MEME (no SSC) :5 5 6AUU A 7 J. Fallmann,TBI RNA - protein interactions in RNA decay 7/ 13

9 Modeling binding cooperativity by constraint folding Calculation of cooperativity free energy via constraint folding A pair of binding sites is used as constraint ( G 1 = G 1 G c1 RT ln G 2 12 = G 12 G 2 RT ln K D,1 ( c1 K D,1 ) ) G = G 1 G 2 12 = G 1 +G 2 G 12 G Lin et al. 215, RNA structure generates natural cooperativity between single-stranded RNA binding proteins targeting 5 and 3 UTRs J. Fallmann,TBI RNA - protein interactions in RNA decay 8/ 13

10 Procedure Non-overlapping pairs of binding sites with minimal distance of 1nt Folding of 3 UTR with/without these bs as constraints Additionally Ago-CLIP derived mirna bs as constraints Lu et al. 214, ELAVL1 Modulates Transcriptome-wide mirna Binding in Murine Macrophages J. Fallmann,TBI RNA - protein interactions in RNA decay 9/ 13

11 Un/Cooperative binding HuR_KO_miRNA HuR_WT_miRNA count mirna TTP_miRNA 1 Sample HuR_KO_miRNA HuR_WT_miRNA mirna TTP_miRNA ddg J. Fallmann,TBI RNA - protein interactions in RNA decay 1/ 13

12 Un/Cooperative binding HuR_TTP_KO HuR_TTP_WT count TTP TTP_miRNA 4 Sample HuR_TTP_KO HuR_TTP_WT TTP TTP_miRNA ddg J. Fallmann,TBI RNA - protein interactions in RNA decay 11/ 13

13 Summary In general we see only a small effect ABPs bind ssrna, so this is not completely surprising Top targets among cooperative list TTP itself is one of the RNAs where mirna-27 binding has negative effect J. Fallmann,TBI RNA - protein interactions in RNA decay 12/ 13

14 Acknowledgments TBI Ivo Andrea Xtof Colleagues MFPL Pavel Kovarik Vitaly Sedlyarov Leipzig Peter Stadler Steve Hoffmann Christian Otto Stefan Bernhart Freiburg Rolf Backofen Daniel Maticzka Steffen Heyne Fabrizio Costa Research Platform Decoding mrna decay in inflammation Interdisciplinary project funded by the University of Vienna J. Fallmann,TBI RNA - protein interactions in RNA decay 13/ 13

Long non-coding RNAs

Long non-coding RNAs Long non-coding RNAs Dominic Rose Bioinformatics Group, University of Freiburg Bled, Feb. 2011 Outline De novo prediction of long non-coding RNAs (lncrnas) Genome-wide RNA gene-finding Intrinsic properties

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination

Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination Yoon et al, page Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination Je-Hyun Yoon,, Kotb Abdelmohsen, Jiyoung Kim, Xiaoling Yang, Jennifer L. Martindale, Kumiko Tominaga-Yamanaka,

More information

Interaktionen von RNAs und Proteinen

Interaktionen von RNAs und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig May 5, 2017 RNA-protein binding vs. DNA-protein binding Is binding of proteins to RNA the same as binding of proteins to DNA? Will the same rules

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus. Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown

More information

iclip Predicts the Dual Splicing Effects of TIA-RNA Interactions

iclip Predicts the Dual Splicing Effects of TIA-RNA Interactions iclip Predicts the Dual Splicing Effects of TIA-RNA Interactions Zhen Wang 1., Melis Kayikci 1., Michael Briese 1, Kathi Zarnack 2, Nicholas M. Luscombe 2,3, Gregor Rot 4, Blaž Zupan 4, Tomaž Curk 4, Jernej

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.

Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15. Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical

More information

Small RNAs and how to analyze them using sequencing

Small RNAs and how to analyze them using sequencing Small RNAs and how to analyze them using sequencing RNA-seq Course November 8th 2017 Marc Friedländer ComputaAonal RNA Biology Group SciLifeLab / Stockholm University Special thanks to Jakub Westholm for

More information

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes

More information

Small RNA-Seq and profiling

Small RNA-Seq and profiling Small RNA-Seq and profiling Y. Hoogstrate 1,2 1 Department of Bioinformatics & Department of Urology ErasmusMC, Rotterdam 2 CTMM Translational Research IT (TraIT) BioSB: 5th RNA-seq data analysis course,

More information

Minor point: In Table S1 there seems to be a typo - multiplicity of the data for the Sm3+ structure 134.8?

Minor point: In Table S1 there seems to be a typo - multiplicity of the data for the Sm3+ structure 134.8? PEER REVIEW FILE Reviewers' comments: Reviewer #1 (Remarks to the Author): Finogenova and colleagues investigated aspects of the structural organization of the Nuclear Exosome Targeting (NEXT) complex,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1. RNA-binding proteins (RBPs) regulating alternative splicing in developmental or differentiation contexts RBP Context where RBP regulates alternative splicing Binding motif from CLIP-sequencing

More information

micrornas (mirna) and Biomarkers

micrornas (mirna) and Biomarkers micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human

More information

Marta Puerto Plasencia. microrna sponges

Marta Puerto Plasencia. microrna sponges Marta Puerto Plasencia microrna sponges Introduction microrna CircularRNA Publications Conclusions The most well-studied regions in the human genome belong to proteincoding genes. Coding exons are 1.5%

More information

Small RNAs and how to analyze them using sequencing

Small RNAs and how to analyze them using sequencing Small RNAs and how to analyze them using sequencing Jakub Orzechowski Westholm (1) Long- term bioinforma=cs support, Science For Life Laboratory Stockholm (2) Department of Biophysics and Biochemistry,

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Prediction of micrornas and their targets

Prediction of micrornas and their targets Prediction of micrornas and their targets Introduction Brief history mirna Biogenesis Computational Methods Mature and precursor mirna prediction mirna target gene prediction Summary micrornas? RNA can

More information

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data

More information

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

More information

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit 15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional

More information

Role of Cnot6l in maternal mrna turnover

Role of Cnot6l in maternal mrna turnover Published Online: 16 July, 2018 Supp Info: http://doi.org/10.26508/lsa.201800084 Downloaded from life-science-alliance.org on 21 April, 2019 Role of Cnot6l in maternal mrna turnover Filip Horvat, Helena

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

Transcriptional regulation in Ebola Virus. The role of VP30

Transcriptional regulation in Ebola Virus. The role of VP30 Transcriptional regulation in Ebola Virus The role of VP30 Ebola virus www.ibtimes.com/updated-ebola-outbreak-map-virus-spreads-out-africa-death-toll-tops-4000-1703162 (2018/01/26) First symptoms 2 days

More information

REGULATED AND NONCANONICAL SPLICING

REGULATED AND NONCANONICAL SPLICING REGULATED AND NONCANONICAL SPLICING RNA Processing Lecture 3, Biological Regulatory Mechanisms, Hiten Madhani Dept. of Biochemistry and Biophysics MAJOR MESSAGES Splice site consensus sequences do have

More information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

MicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM

MicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer

More information

Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first

Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase

More information

Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR)

Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR) Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR) O. Solomon, S. Oren, M. Safran, N. Deshet-Unger, P. Akiva, J. Jacob-Hirsch, K. Cesarkas, R. Kabesa, N. Amariglio, R.

More information

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin

More information

Mature microrna identification via the use of a Naive Bayes classifier

Mature microrna identification via the use of a Naive Bayes classifier Mature microrna identification via the use of a Naive Bayes classifier Master Thesis Gkirtzou Katerina Computer Science Department University of Crete 13/03/2009 Gkirtzou K. (CSD UOC) Mature microrna identification

More information

Chapter 10 - Post-transcriptional Gene Control

Chapter 10 - Post-transcriptional Gene Control Chapter 10 - Post-transcriptional Gene Control Chapter 10 - Post-transcriptional Gene Control 10.1 Processing of Eukaryotic Pre-mRNA 10.2 Regulation of Pre-mRNA Processing 10.3 Transport of mrna Across

More information

Inferring condition-specific mirna activity from matched mirna and mrna expression data

Inferring condition-specific mirna activity from matched mirna and mrna expression data Inferring condition-specific mirna activity from matched mirna and mrna expression data Junpeng Zhang 1, Thuc Duy Le 2, Lin Liu 2, Bing Liu 3, Jianfeng He 4, Gregory J Goodall 5 and Jiuyong Li 2,* 1 Faculty

More information

Mechanisms of alternative splicing regulation

Mechanisms of alternative splicing regulation Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.

More information

MicroRNA in Cancer Karen Dybkær 2013

MicroRNA in Cancer Karen Dybkær 2013 MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

DNA codes for RNA, which guides protein synthesis.

DNA codes for RNA, which guides protein synthesis. Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription

More information

Cross species analysis of genomics data. Computational Prediction of mirnas and their targets

Cross species analysis of genomics data. Computational Prediction of mirnas and their targets 02-716 Cross species analysis of genomics data Computational Prediction of mirnas and their targets Outline Introduction Brief history mirna Biogenesis Why Computational Methods? Computational Methods

More information

Analyse de données de séquençage haut débit

Analyse de données de séquençage haut débit Analyse de données de séquençage haut débit Vincent Lacroix Laboratoire de Biométrie et Biologie Évolutive INRIA ERABLE 9ème journée ITS 21 & 22 novembre 2017 Lyon https://its.aviesan.fr Sequencing is

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

10/31/2017. micrornas and cancer. From the one gene-one enzyme hypothesis to. microrna DNA RNA. Transcription factors.

10/31/2017. micrornas and cancer. From the one gene-one enzyme hypothesis to. microrna DNA RNA. Transcription factors. micrornas and cancer Cellular and Molecular Biology of Cancer (PATH G4500-001) November 1 st, 2017 -Katia Basso- Columbia University Katia Basso, PhD Office: ICRC RM506 E-mail: kb451@cumc.columbia.edu

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

Processing of RNA II Biochemistry 302. February 14, 2005 Bob Kelm

Processing of RNA II Biochemistry 302. February 14, 2005 Bob Kelm Processing of RNA II Biochemistry 302 February 14, 2005 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation (non proteincoding sequence) Discovered by P. Sharp

More information

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary. presence of the. (c) mrna expression. Error. in naive or Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

More information

RECAP (1)! In eukaryotes, large primary transcripts are processed to smaller, mature mrnas.! What was first evidence for this precursorproduct

RECAP (1)! In eukaryotes, large primary transcripts are processed to smaller, mature mrnas.! What was first evidence for this precursorproduct RECAP (1) In eukaryotes, large primary transcripts are processed to smaller, mature mrnas. What was first evidence for this precursorproduct relationship? DNA Observation: Nuclear RNA pool consists of

More information

MODULE 3: TRANSCRIPTION PART II

MODULE 3: TRANSCRIPTION PART II MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain

More information

The RNA-binding protein tristetraprolin schedules apoptosis of pathogen-engaged neutrophils during bacterial infection

The RNA-binding protein tristetraprolin schedules apoptosis of pathogen-engaged neutrophils during bacterial infection The RNA-binding protein tristetraprolin schedules apoptosis of pathogen-engaged neutrophils during bacterial infection Florian Ebner,, Michael Sixt, Pavel Kovarik J Clin Invest. 2017;127(6):2051-2065.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression II TRANSLATION RIBOSOMES: protein synthesizing machines Translation takes place on defined

More information

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm

More information

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.

More information

Processing of RNA II Biochemistry 302. February 13, 2006

Processing of RNA II Biochemistry 302. February 13, 2006 Processing of RNA II Biochemistry 302 February 13, 2006 Precursor mrna: introns and exons Intron: Transcribed RNA sequence removed from precursor RNA during the process of maturation (for class II genes:

More information

Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes

Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes Question No. 1 of 10 1. Which of the following statements about gene expression control in eukaryotes is correct? Question #1 (A)

More information

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

More information

Signatures (of Response) to Environmental Exposures

Signatures (of Response) to Environmental Exposures Gene-expression Profiles as Signatures (of Response) to Environmental Exposures Smoking and the airway field of injury as a novel paradigm for the exposome Avrum Spira, M.D., M.Sc. Section of Computational

More information

Table S1. Quantitative RT-PCR primers

Table S1. Quantitative RT-PCR primers Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project

Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene

More information

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal

More information

Doctor of Philosophy

Doctor of Philosophy Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of

More information

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To

More information

1. Investigate the structure of the trna Synthase in complex with a trna molecule. (pdb ID 1ASY).

1. Investigate the structure of the trna Synthase in complex with a trna molecule. (pdb ID 1ASY). Problem Set 11 (Due Nov 25 th ) 1. Investigate the structure of the trna Synthase in complex with a trna molecule. (pdb ID 1ASY). a. Why don t trna molecules contain a 5 triphosphate like other RNA molecules

More information

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,

More information

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal

More information

TRANSCRIPTION. DNA à mrna

TRANSCRIPTION. DNA à mrna TRANSCRIPTION DNA à mrna Central Dogma Animation DNA: The Secret of Life (from PBS) http://www.youtube.com/watch? v=41_ne5ms2ls&list=pl2b2bd56e908da696&index=3 Transcription http://highered.mcgraw-hill.com/sites/0072507470/student_view0/

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.

Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt

More information

Post-transcriptional regulation of an intronic microrna

Post-transcriptional regulation of an intronic microrna Post-transcriptional regulation of an intronic microrna Carl Novina Dana-Farber Cancer Institute Harvard Medical School Broad Institute of Harvard and MIT Qiagen Webinar 05-17-11 Outline 1. The biology

More information

Molecular Biology (BIOL 4320) Exam #2 May 3, 2004

Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good

More information

Transcriptome profiling of the developing male germ line identifies the mir-29 family as a global regulator during meiosis

Transcriptome profiling of the developing male germ line identifies the mir-29 family as a global regulator during meiosis RNA BIOLOGY 2017, VOL. 14, NO. 2, 219 235 http://dx.doi.org/10.1080/15476286.2016.1270002 RESEARCH PAPER Transcriptome profiling of the developing male germ line identifies the mir-29 family as a global

More information

NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez

NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION Ana M. Martinez Switching from Repression to Activation: MicroRNAs can Up-Regulate Translation. Shoba Vasudevan, Yingchun Tong, Joan A. Steitz AU-rich

More information

Processing of RNA II Biochemistry 302. February 18, 2004 Bob Kelm

Processing of RNA II Biochemistry 302. February 18, 2004 Bob Kelm Processing of RNA II Biochemistry 302 February 18, 2004 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation Discovered by P. Sharp and R. Roberts in late 1970s

More information

Reviewers' Comments: Reviewer #1 (Remarks to the Author)

Reviewers' Comments: Reviewer #1 (Remarks to the Author) Reviewers' Comments: Reviewer #1 (Remarks to the Author) The manuscript "MicroRNAs shape gene co-regulation within cells and transcriptional heterogeneity across cells" by Gennaro Gambardella et al performed

More information

ncrna Targeting CSF-1 and CSF1R Expression in Breast and Ovarian Cancer Cells

ncrna Targeting CSF-1 and CSF1R Expression in Breast and Ovarian Cancer Cells ncrna Targeting CSF-1 and CSF1R Expression in Breast and Ovarian Cancer Cells Item Type text; Electronic Thesis Authors Patel, Arpan Ajit Publisher The University of Arizona. Rights Copyright is held by

More information

Piastrine: genoma e trascrittoma. Paolo Gresele Department of Medicine Section of Internal and Cardiovascular Medicine University of Perugia

Piastrine: genoma e trascrittoma. Paolo Gresele Department of Medicine Section of Internal and Cardiovascular Medicine University of Perugia Piastrine: genoma e trascrittoma Paolo Gresele Department of Medicine Section of Internal and Cardiovascular Medicine University of Perugia Workshop post-isth: novità dal meeting di Toronto 2015 Bergamo,

More information

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford Lecture 8 Understanding Transcription RNA-seq analysis Foundations of Computational Systems Biology David K. Gifford 1 Lecture 8 RNA-seq Analysis RNA-seq principles How can we characterize mrna isoform

More information

Additional file: Cell cycle, oncogenic and tumor suppressor pathways regulate numerous long and macro non-protein coding RNAs

Additional file: Cell cycle, oncogenic and tumor suppressor pathways regulate numerous long and macro non-protein coding RNAs Additional file: Cell cycle, oncogenic and tumor suppressor pathways regulate numerous long and macro non-protein coding RNAs February 6, 2014 Jö rg Hackermü ller 1,2,,, Kristin Reiche 1,2,,, Christian

More information

Bi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016

Bi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016 Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need

More information

MicroRNA and Male Infertility: A Potential for Diagnosis

MicroRNA and Male Infertility: A Potential for Diagnosis Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Location of GUUUCA motif relative to RNA position 4e+05 3e+05 Reads 2e+05 1e+05 0e+00 35 40 45 50 55 60 65 Distance upstream b 1: Egg 2: L3 3: Adult 4: HES 4e+05 3e+05 2e+05 start

More information

Molecular Biology (BIOL 4320) Exam #2 April 22, 2002

Molecular Biology (BIOL 4320) Exam #2 April 22, 2002 Molecular Biology (BIOL 4320) Exam #2 April 22, 2002 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good

More information

Mining for disease- causing genes in the other 98% of the human genome Daniel Gautheret

Mining for disease- causing genes in the other 98% of the human genome Daniel Gautheret Mining for disease- causing genes in the other 98% of the human genome Daniel Gautheret Ins:tut de Géné:que et Microbiologie, Orsay Plateforme Bioinforma:que ebio Orsay et Gustave Roussy 1 Gene expression

More information

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) Thursday 5 November EU-India PARTNERING EVENT Theme: Health RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) CNRS, INSERM,

More information

Supplementary information

Supplementary information Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,

More information

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science

More information

Tutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures

Tutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures : RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures March 15, 2013 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com

More information

GW182 proteins cause PABP dissociation from silenced mirna targets in the absence of deadenylation

GW182 proteins cause PABP dissociation from silenced mirna targets in the absence of deadenylation Manuscript EMBO-2012-83275 GW182 proteins cause PABP dissociation from silenced mirna targets in the absence of deadenylation Latifa Zekri, Duygu Kuzuoğlu-Öztürk and Elisa Izaurralde Corresponding author:

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information