Table S1. Quantitative RT-PCR primers
|
|
|
- Austin Reeves
- 5 years ago
- Views:
Transcription
1 Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg gccagagctccgagagagaa Human ARPp0 gtccaactacttccttaagatcatcca acatgcggatctgctgcat Human ELOVL5 cccttccatgcgtccata gattgtcagcacaaactgaagc Human StARD3 acctcacacagtgccaagc ccgacttgagcacgatgaa Human LPGAT1 attcttccggctcctctga tggactccgtcctgtctttc Human MBOAT1 gtttccacagcttgccaga aggtgatgcccaacttgtgt Human NFYC actcaagttgtgcagggac gtgacttgctggatctggtag Human DICER gacctaaccaatctcaaccagc actttcccatttggctttcc 18s rrna agtccctgccctttgtacaca gatccgaggtcactaaac Mouse ApoB tccatattccagacaacctcttc gtttattttgttcctgttcattgtgt Mouse MTP gaccaccctggatctccata agcgtggtgaaagggcttat Mouse ApoA1 ggccgtggctctggtctt ggttcatcttgctgccatacc Mouse ELOVL5 gtcctccatcccgtccat tgattgtcagcacaaactgga Mouse StARD3 ggtggtggatcagatcttgg acacagtgtccccatactcgt Mouse LPGAT1 ttgtagcacggcaggaaaat ggcctcttgatttgcattct Mouse MBOAT1 tcctaactggagtccctgtca ggaagagaggaagtggtgtctg Mouse ABCA1 ttggcgctcaacttttacgaa gagcgaatgtccttcccca Mouse ABCG1 acaacttcacagaggcccag tttcccagagatccctttca sidicer sigl2 simboat1 sistard3 sielovl5 silpgat1 sirna Oligomers sense: auuuagcugauuuccuugg anti-sense: gccaaggaaaucagcuaaa sense: cguacgcggaauacuucgatt anti-sense: cgaaguauuccgcguacg sense: cuuguaacaauuucaaggacutt anti-sense: aguccuugaaauuguuacaag sense: gaccagaucuuggcccaggaatt anti-sense: uuccugggccaagaucugguc sense: uuauauaaguagggauaagautt anti-sense: aucuuaucccuacuuauauaa sense: gauggaauggggagaagauautt anti-sense: auaucuucuccccauuccauc Scr mir-30c AntimiR-30c mir Sequences ucacaaccuccuagaaagaguaga uguaaacauccuacacucucagc gcugagaguguaggauguuuaca 1
2 Fig S1: Identification of putative mirs that could interact with MTP mrna: (a) TargetScan was used to search for mirs that could interact with the 3 -untranslated region (UTR) of human MTP mrna and the conservation of the binding sites in various mammals. This analysis identified several mirs that could interact with hmtp, but they were poorly conserved through evolution. However, the program also identified conserved sites for mirna families that are conserved among vertebrates. Note that several members of mir-30 family are identified (Arrow). (b) This figure shows putative binding sites for mir-30 family members in different vertebrate MTP mrna. Pairing site for mir-30 in the 3 -UTR of various mammalian MTP sequences are highlighted in white. This analysis showed that mir-30 family binding site is conserved in MTP mrna among vertebrates. 2
3 Supplementary Seed Fig S2: Base pairing between different mirs and MTP mrna: Sequences of different mir-30 family members and their base pairing is shown with MTP mrna sequence. CAAAUG represents the seed sequence of mir-30 family. Supplementary pairing sites are present in mir-30c and mir-30b. The alignment was performed using TargetScan. Based on crystallographic data, it is believed that the first 5 residue of mir interacts with Argonaute and is not available for interaction with the target mrna 1, 2. 3
4 Fig S3: mir-30c is present in the intron of NFY-C and is conserved in vertebrates: Top line shows schematic representation of different introns and exons in the human NFY-C gene. mir-30c resides in intron 5 of the gene. In humans, NFY-C gene is on chromosome 1, whereas it is on chromosome 4 in mouse. Intronic sequences from different species were aligned using CLUSTALW to show the conservation of mir-30c. The red box highlights mir-30c sequence. 4
5 Fig S4: Effect of lentivirus mediated expression of mir-30c on mir-30s, apob mrna, MTP activity, and lipids in different tissues: Male C57Bl/6J mice (5/group) were injected with different viruses and started on a Western diet. After 3 weeks different tissues were collected for analyses. (a) mir-30c, mir-30b and mir-30e levels were measured in the heart, jejunum and kidney. MTP activity (b) and mrna (c) were measured in the heart, jejunum and kidney. (d) ApoB mrna was measured in the heart, jejunum, kidney and liver. (e) ApoA1 mrna was measured in liver and jejunum. ABCA1 mrna (f) and ABCG1 mrna (g) were measured in the liver. Weekly plasma samples were used to measure AST (h) and ALT (i). 5
6 Fig S5: Lipid biosynthesis is targeted by mir-30c: (a) Predicted target genes of mir-30c from TargetScan were used to identify pathways affected using Gene Ontology. This program identified several lipid biosynthetic processes targeted by mir-30c. (b) Different genes targeted by mir-30c in various pathways are listed 3. Figure S6. Effect of lentivirus mediated expression of mir-30c in male liver-specific MTP knockout mice. L-MTP -/- mice (4/group; 8 weeks old) were injected with different lentiviruses and started on a Western diet for 5 weeks. (a) During this time, plasma triglyceride and cholesterol were measured weekly. (b) At the end of the 5 weeks, plasma samples were used to precipitate apoblipoproteins to measure triglyceride and cholesterol in total and HDL fractions. Non-HDL fraction is the difference of total and HDL plasma lipids. (c) Triglyceride and cholesterol in the livers of these mice were measured at the end of the experiment. Levels of hepatic glycerol were subtracted from total triglyceride to obtain liver triglycerides. Representative data of 2 independent experiments. 6
7 Fig S7: Effect of lentivirus mediated expression of mir-30c in male MTTP fl/fl mice. Mice (5/group; 8 weeks old) were injected with different lentiviruses and started on a Western diet. After 3 weeks, liver samples were used to measure mir-30c, mir-30b, and mir-30e (a) and hepatic cholesterol and triglyceride (c). (b) During the 3 week experiment, plasma triglyceride and cholesterol were measured weekly. Fatty acid oxidation (d), and fatty acid, triglyceride and phospholipid synthesis (e) were measured in liver slices at the end of the experiment. Data from 1 experiment. 7
8 Fig S8: Effect of mir-30c and antimir-30c on plasma lipids and atherosclerosis: Female Apoe -/- mice (7/group) were injected with lentiviruses expressing mir-30c or Scr mir and started on a Western diet. (a) Plasma cholesterol, triglyceride, AST and ALT were measured weekly. # p<0.05; ## p<0.01, ### p<.001, #### p<0.0001; significance calculated by two-way ANOVA. (b-f) Aortic arches were exposed and photographed (b). Sections from the cardiac/aortic junctions were stained with H & E (c). Junctions were also stained for macrophages (d).whole aortas were stained with Oil Red O (e). The lipid stains in the whole aortas were quantified using Image J (f). Representative data of 2 independent experiments. 8
9 Fig S9: Regulation of lipid synthesis and lipoprotein secretion by mir-30c: mir-30c is hypothesized to reduce expression of different genes to lower lipid synthesis and lipoprotein secretion. Reductions in lipid synthesis might avoid steatosis whereas reductions in lipoprotein secretion might lower atherosclerosis. 9
10 Reference List 1. Ma,J.B. et al. Structural basis for 5'-end-specific recognition of guide RNA by the A. fulgidus Piwi protein. Nature 434, (2005). 2. Bartel,D.P. MicroRNAs: target recognition and regulatory functions. Cell 136, (2009). 3. Huang,d.W., Sherman,B.T., & Lempicki,R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, (2009). 10
Supplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
MicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM
MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
High density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Summary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Circular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Nature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
Atherosclerosis is the underlying cause of cardiovascular
RP5-833A20.1/miR-382-5p/NFIA Dependent Signal Transduction Pathway Contributes to the Regulation of Cholesterol Homeostasis and Inflammatory Reaction Yan-Wei Hu, Jia-Yi Zhao, Shu-Fen Li, Jin-Lan Huang,
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Strathprints Institutional Repository
Strathprints Institutional Repository Tate, Rothwelle and Rotondo, Dino and Davidson, Jillian (2015) Regulation of lipid metabolism by micrornas. Current Opinion in Lipidology, 26 (3). pp. 243-244. ISSN
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
MicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5
Bi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016
Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Glossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
Lipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
Supplementary Figure 1
Supplementary Figure 1 a Location of GUUUCA motif relative to RNA position 4e+05 3e+05 Reads 2e+05 1e+05 0e+00 35 40 45 50 55 60 65 Distance upstream b 1: Egg 2: L3 3: Adult 4: HES 4e+05 3e+05 2e+05 start
MicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Juxtapid. Juxtapid (lomitapide) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
Apolipoprotein B-containing lipoprotein assembly in microsomal triglyceride transfer protein-deficient McA-RH7777 cells
Apolipoprotein B-containing lipoprotein assembly in microsomal triglyceride transfer protein-deficient McA-RH7777 cells Yanwen Liu, 1, * Medha Manchekar, 1, * Zhihuan Sun, * Paul E. Richardson, and Nassrin
Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR
Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA
Lipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
Kynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: December 2, 2016 Kynamro Description Kynamro (mipomersen)
Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University
Atherosclerosis Development and the Inflammatory Response of Hepatocytes to Sesame Oil Supplementation Taylor Yohe Project Advisor: Dr. Martha A. Belury Department of Human Nutrition at the Ohio State
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
Very low-density lipoproteins (VLDLs) are triacylglyceride-rich
Molecular Medicine Control of Very Low-Density Lipoprotein Secretion by N-Ethylmaleimide-Sensitive Factor and mir-33 Ryan M. Allen, Tyler J. Marquart, Jordan J. Jesse, Ángel Baldán Rationale: Several reports
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
Lipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Nature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
Central role of apociii
University of Copenhagen & Copenhagen University Hospital Central role of apociii Anne Tybjærg-Hansen MD DMSc Copenhagen University Hospital and Faculty of Health and Medical Sciences, University of Copenhagen,
Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
Kynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro
Familial Hypercholesterolemia
Familial Hypercholesterolemia Dr.Ramzi Al-Mohammadi Assistant Professor of Medicine Interventional Cardiologist, Advanced HF and Transplant Consultant Classification of Hyperlipedemia Primary hyperlipedemia:
Glossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
doi: /nature14508 Rappsilber et al.
SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa
Supplementary information
Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,
Cross species analysis of genomics data. Computational Prediction of mirnas and their targets
02-716 Cross species analysis of genomics data Computational Prediction of mirnas and their targets Outline Introduction Brief history mirna Biogenesis Why Computational Methods? Computational Methods
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics
Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein
Marta Puerto Plasencia. microrna sponges
Marta Puerto Plasencia microrna sponges Introduction microrna CircularRNA Publications Conclusions The most well-studied regions in the human genome belong to proteincoding genes. Coding exons are 1.5%
Utility of Circulating micrornas in Cardiovascular Disease
Utility of Circulating micrornas in Cardiovascular Disease Pil-Ki Min, MD, PhD Cardiology Division, Gangnam Severance Hospital, Yonsei University College of Medicine Introduction Biology of micrornas Circulating
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
Hepatic ABC transporters and triglyceride metabolism
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Nutrition and Health Sciences -- Faculty Publications Nutrition and Health Sciences, Department of 2012 Hepatic ABC transporters
Pathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
Stacey Melquist #AHA16
Targeting apolipoprotein(a) with a novel RNAi delivery platform as a prophylactic treatment to reduce risk of cardiovascular events in individuals with elevated lipoprotein(a) Monday, November 14, 2016
Chapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez
NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION Ana M. Martinez Switching from Repression to Activation: MicroRNAs can Up-Regulate Translation. Shoba Vasudevan, Yingchun Tong, Joan A. Steitz AU-rich
Metabolic programming. Role of micrornas. M Elizabeth Tejero, PhD Laboratory of Nutrigenetics and Nutrigenomics INMEGEN Mexico City
Metabolic programming. Role of micrornas M Elizabeth Tejero, PhD Laboratory of Nutrigenetics and Nutrigenomics INMEGEN Mexico City Outline Overview on micrornas (mirnas) Role of mirnas in metabolic programming
AAOCS 10 th Biennial Conference Barossa Valley, September Presenter: Petter-Arnt Hals MSc PhD Co-authors: Nils Hoem, Xiaoli Wang, Yong-Fu Xiao
Effects of a purified, omega-3 rich krill oil phospholipid on cardiovascular disease risk factors and fatty acid composition of erythrocyte membranes in non-human primates AAOCS 10 th Biennial Conference
Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microrna
ORIGINAL ARTICLE Cell Research (2012) 22:107-126. 2012 IBCB, SIBS, CAS All rights reserved 1001-0602/12 $ 32.00 www.nature.com/cr npg Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence
Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
Supplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Research Article Base Composition Characteristics of Mammalian mirnas
Journal of Nucleic Acids Volume 2013, Article ID 951570, 6 pages http://dx.doi.org/10.1155/2013/951570 Research Article Base Composition Characteristics of Mammalian mirnas Bin Wang Department of Chemistry,
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Journal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32.
Journal of the American College of Cardiology Vol. 50, No. 24, 2007 2007 by the American College of Cardiology Foundation ISSN 0735-1097/07/$32.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2007.07.081
Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Regulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
Control 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with