B-cell expansion and lymphomagenesis induced by chronic CD40-signaling is
|
|
- Rachel Fowler
- 5 years ago
- Views:
Transcription
1 -cell expansion and lymphomagenesis induced by chronic CD4-signaling is strictly dependent on CD19 Caroline Hojer 1*, Samantha Frankenberger 1*, Lothar J. Strobl 1, Samantha Feicht 1, Kristina Djermanovic 1, Franziska Jagdhuber 1, Cornelia Hömig-Hölzel 1, Uta Ferch 2, Jürgen Ruland 2, Klaus Rajewsky 3, Ursula Zimber-Strobl 1,4 Supplementary Figures Suppl. Figure 1. M cell development is comparable in LMP1/CD4//CD19 +/- and LMP1/CD4//CD19 -/- mice. Suppl. Figure 2. CD4 employs CD19 to mediate survival signals. Suppl. Figure 3. Loss of CD19 abrogates lymphoma development in LMP1/CD4 mice. Suppl. Figure 4. Stimulation of cells with αigm in the presence of Dasatinib. Suppl. Figure 4. Titration of the PI3K inhibitor LY2944 Suppl. Figure 5. Sorafenib does not affect Erk phosphorylation in LMP1/CD4 + cells. Suppl. Figure 5. CD19 expression on different DLCL and HL cell lines. Suppl. Figure 6. CD4 expression in different DLCL cell lines. Suppl. Figure 6. CD19 phosphorylation after stimulation with a CD4 ligand.
2 * 5 cells M CD19+/- CD19-/- LMP1/CD4// CD19+/- LMP1/CD4// CD19-/- 14±7 13±6 4±2 4±2 46±8 5±4 42±7 6±5 33±4 5±5 33±6 6± CD43 IgM 2±4 19±5 2±3 17±3 17±8 21±8 6±3 2±1 CD19+/- CD19-/- LMP1/CD4// CD19+/- LMP1/CD4// CD19-/- IgD Suppl. Figure 1. M cell development is comparable in LMP1/CD4//CD19 +/- and LMP1/CD4//CD19 -/- mice. () In the bone marrow (M) the total cell numbers were slightly decreased in LMP1/CD4 mice independent of the absence and presence of CD19 in comparison to the controls. Total cell numbers in the different genotypes: cell numbers were calculated by offsetting the total cell number of the bone marrow that was determined by cell counting against the percentage of TO-PRO-3 - cells gated on lymphocytes and 22. Symbols represent data from individual mice and horizontal bars mark the mean values. The numbers indicate the mean value of each data set. () nalysis of the different cell subsets in the bone marrow revealed that mainly the mature recirculating cells (IgM + /IgD + ) and not the developing cells were decreased in LMP1/CD4 mice, whereupon the reduction was stronger in LMP1/CD4//CD19 -/- than in LMP1/CD4//CD19 +/- mice. one marrow preparations were analyzed by flow cytometry for the expression of 22 and CD43 to determine the percentages of pro/early pre- (22 pos CD43 pos ), late pre/immature (22 pos CD43 neg/low ) as well as recirculating cells (CD43 neg, 22 high ). To determine the percentage of recirculating cells (22 high, IgM med, IgD pos ) more precisely an IgM and IgD analysis was performed. Numbers indicate mean percentages and SDs of lymphocyte-gated populations and were calculated from at least five independent experiments.
3 (%) cells viable 8 7 * 6 * * * days CD19 +/- - CD19 /- LMP1/CD4//CD19 +/- -/- LMP1/CD4//CD19 nnexin-pe CD19 +/+ CD19 +/- CD19 -/-.8 nnexin-pe nnexin-pe D D D Suppl. Figure 2. CD4 employs CD19 to mediate survival signals. () Splenic cells were cultured for five days. Each day the percentages of viable cells were determined by FCS after staining with TO-PRO-3. sterisks indicate significant differences between the CD19-proficient and - deficient LMP1/CD4-expressing cells. () Splenic cells of the indicated genotypes were cultured for four days and percentages of 7-D +, nnexin + cells were determined by using an nnexin staining Kit purchased from D iosciences for FCS analysis.
4 LMP1CD4//CD19 +/- LMP1CD4//CD19 -/- #492 #684 #848 #445 #685 #384 #494 #687 #49 #738 #626 #794 #795 #942 #627 #943 * Suppl. Figure 3. Loss of CD19 abrogates lymphoma development in LMP1/CD4 mice. nimals were kept under observation and palpated regularly to detect lymphoma development. Lymphomas were scored by investigating mono-/ oligoclonality by Southern-lot analysis using an IgH specific probe spanning the J H3 and J H4 region. Genomic DN was prepared and digested with EcoRI from splenic cells of LMP1/CD4//CD19 +/- mice that developed neoplasias and of LMP1/CD4//CD19 -/- mice that, if they did not get sick, were analysed with an age of 19 month. The band corresponding to the unrearranged Ig locus (indicated by an asterisk) is detected in each sample since DN was prepared from total splenic cells. dditional bands are indicative for lymphoma development. In the Southern-lot some representative examples of samples displaying lymphoma development are shown. Samples with a mono- or oligoclonal cell population are indicated with an (+).
5 6 kda 6 kda 44 kda 42 kda 44 kda 42 kda 53/56 kda 56 kda 36 kda nm αigm nm nm nm 5 nm nm 2 nm Dasatinib pkt kt perk1/2 Erk1/2 plyn Lyn GPDH Suppl. Figure 4. Stimulation of cells with a IgM in the presence of Dasatinib. CD19 +/- cells were stimulated for 2min with αigm (15μg/ml; Jackson ImmunoResearch) in the presence of different concentrations of Dasatinib as indicated. s controls unstimulated cells in the absence (nm) and presence of Dasatinib (nm) were used. Phosphorylation of Erk, kt and Lyn in the absence and presence of different inhibitor concentrations was investigated by Western-blotting. GPDH served as loading control. 9 % To-Pro-3 negative days L/C L/C DMSO CD19 +/- L/C LY 5μM L/C LY μm L/C LY 2μM Suppl. Figure 4. Titration of the PI3K inhibitor LY2944 () Splenic cells from LMP1/CD4 (L/C) mice were cultured for up to five days with different concentrations of the PI3K inhibitor LY2942 (5-2μM). s control, cells from LMP1/CD4 and control mice (CD19 +/- ) were used. dditionally, LMP1/CD4 + cells were cultured in the presence of DMSO, which was used to solve the PI3K inhibitor. Percentages of living cells (TO-PRO-3 - ) were determined by flow cytometry at day, 1, 3 and 5.
6 ctrl LMP1/CD4 42/44 kda 42/44 kda DMSO LY2942 UO126 Sorafenib 3 μm Sorafenib μm perk1/2 Erk1/2 55 kda Tubulin Suppl. Figure 5. Sorafenib does not affect Erk phosphorylation in LMP1/CD4 + cells. Protein extracts of cells from control (ctrl) and LMP1/CD4/CD19 +/- mice (LMP1/CD4) were prepared after incubation with the depicted inhibitors in concentrations as described in Materials and Methods 1h prior to extract preparation. Western-lots were performed and stained with antibodies against Erk and perk. Tubulin was used as loading control.
7 5 SU-DHL-6 SU-DHL-4 J U % of max 5 HL TMD RIV Oci-Ly Oci-Ly KM-H2 L CD19-PC Suppl. Figure 5. CD19 expression on different DLCL and HL cell lines. Histograms showing an overlay of the CD19 expression on the surface of different DLCL cell lines in comparison to an isotype control. The plots are gated on living cells. Description of the cell lines: SU-DHL-6, SU-DHL-4, J: DLCL of the GC subtype. U2932, HL1, TMD8, RIV, Oci-Ly3, Oci-Ly: DLCL cell lines of the C subtype KM-H2 and L428: Hodgkin-Lymphoma cell lines. Origin and confirmation of the cell lines: The cell lines SU-DHL-4 and SU-DHL-6, J, U2932, HL1 were kindly provided by Dr. Gerhard Laux. The identity of these cell lines has been confirmed by DSMZ (raunschweig) in the year 28 by DN-Fingerprinting. fter confirmation of the identity, cell lines were frozen in several vials. One original vial was thawed for the experiment. Cell lines were cultured not longer than 5 months. The cell lines TMD8, RIV Oci-Ly3 and Oci-Ly were kindly provided by Dr. Daniel Krappmann. These cell lines are from the same batch as recently used in the publications by Kloo et al., PNS, 211 and Nagel et al., Cancer Cell, 212. The cell lines are routinely checked by gene expression analysis. ll DLCL were cultured as described by Kloo et al., PNS, 211. The HL cell lines KM- H2 and L428 were purchased from DSMZ in the year 213, expanded, and frozen in several vials. One of these vials was thawed for the experiments.
8 5 SU-DHL-6 SU-DHL-4 J U % of max 5 HL TMD RIV Oci-Ly Oci-Ly KM-H2 L CD4 ligand h.5 h 1 h 24 h 48 h CD4-PE Suppl. Figure 6. CD4 expression in different DLCL cell lines. Histograms show an overlay of the CD4 expression on the surface of different DLCL cell lines in comparison to an isotype control. The plots are gated on living cells. pcd19 plyn pkt kt perk1/2 Erk1/2 Suppl. Figure 6. CD19 phosphorylation after stimulation with a CD4 ligand. Protein extracts derived from J cells that were stimulated for the indicated time points in the presence of a CD4 ligand (.2μg/ml; Cell Signaling) were investigated by Western-lot and probed with the indicated antibodies. GPDH was used as loading control. GPDH
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationSupporting Information
Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationpro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationSupplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
More informationLPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)
A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin
More informationa surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
More informationSupplementary Figure S1
Supplementary Figure S1 12 1 8 6 4 2 1-3 1-2 1-1 1 1 1 1 2 1 3 PF-364422 (µm) U87 (EC 5 = 52.2 ± 8.8 µm) 12 1 8 6 4 2 1-4 1-3 1-2 1-1 1 1 1 1 2 CMPD1 (µm) Primary GM (EC 5 = 1.55 ±.3 µm) U138 (EC 5 = 1.7
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationFigure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel
More informationProlonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More informationNature Medicine: doi: /nm.2109
HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael
More informationSupplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c)
1 Supplementary Figure 1 Protease allergens induce IgE and IgG1 production. (a-c) Serum IgG1 (a), IgM (b) and IgG2 (c) concentrations in response to papain immediately before primary immunization (day
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationPearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More information0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell. Tumor type
Fig S1 A B Tumors per mouse 1.2 1.0 0.8 0.6 0.4 0.2 0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell Tumor type -/- (n = 46) Q/- (n = 76) Q/Q (n = 31) Tumors per mouse 1.2 1.0 0.8 0.6 0.4 0.2 0.0
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationInfect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
More informationSupplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
More informationD CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
More informationa 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationSUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationCD25-PE (BD Biosciences) and labeled with anti-pe-microbeads (Miltenyi Biotec) for depletion of CD25 +
Supplements Supplemental Materials and Methods Depletion of CD25 + T-cells from PBMC. Fresh or HD precultured PBMC were stained with the conjugate CD25-PE (BD Biosciences) and labeled with anti-pe-microbeads
More informationSupplemental Information. Commensal Microbes Induce Serum IgA. Responses that Protect against Polymicrobial Sepsis
Cell Host & Microbe, Volume 23 Supplemental Information Commensal Microbes Induce Serum Ig Responses that Protect against Polymicrobial Sepsis Joel R. Wilmore, rian T. Gaudette, Daniela Gomez tria, Tina
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
More informationFigure S1. Gating strategy used in NK cells and γδ T lymphocytes coculture An example of flow cytometry analysis shows the gating of NK cells and γδ
Figure S1. Gating strategy used in NK cells and γδ T lymphocytes coculture An example of flow cytometry analysis shows the gating of NK cells and γδ T lymphocytes used in all NK activation and cytotoxicity
More informationSupplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
More informationSupplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationSupplementary Figure 1: Normal vs. Tumor expression of PIM kinases mrna across 17 tissue types
Supplementary Figure 1: Normal vs. Tumor expression of PIM kinases mrna across 17 tissue types Supplementary Figure 1 Legend: PIM1, PIM2 and PIM3 mrna expression Expression levels in cancer tissues derived
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Surface thiol groups and reduction of activated T cells. (a) Activated CD8 + T-cells have high expression levels of free thiol groups on cell surface proteins.
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More informationSupplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationSUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
More informationMuse Assays for Cell Analysis
Muse Assays for Cell Analysis Multiple Assay Outputs for Cell Analysis Cell Health Cell Signalling Immunology Muse Count & Viability Kit Muse Cell Cycle Kit Muse Annexin V & Dead Cell Kit Muse Caspase
More informationNature Immunology doi: /ni.2771
Supplementary Figure 1. Lymphadenopathy, mitogen response, effector cells, and serum Ig assessment. (a) Computerized Tomography (CT) images demonstrating lymphadenopathy (arrows) in patient F.II.1 and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationSupplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
More informationSupplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
More informationDevelopment of a Human Cell-Free Expression System to Generate Stable-Isotope-Labeled Protein Standards for Quantitative Mass Spectrometry
Development of a Human Cell-Free Expression System to Generate Stable-Isotope-Labeled Protein Standards for Quantitative Mass Spectrometry Ryan D. omgarden 1, Derek aerenwald 2, Eric Hommema 1, Scott Peterman
More informationGENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute
GENETIC MARKERS IN LYMPHOMA a practical overview P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute B and T cell monoclonalities Rearrangement of immunoglobin and TCR genes may help
More informationSupplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
More informationSupplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationPathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
More informationSupplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
More informationAppendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
More informationPBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
More informationSDC (Supplemental Digital Content) Figure S1. Percentages of Granzyme B expressing CD8 + T lymphocytes
Figure S1. Percentages of Granzyme expressing D8 + T lymphocytes 13.5% 1.4%.6% 77% 21% 24% 76% 8 8 Granzyme + (%) 6 4 2 Granzyme + (%) 6 4 2 D8 + Tnaive Tcm Tem Temra D8 + D8 + D28 + D8 + D28 null We analyzed
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationData Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535
Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive
More informationSupplementary Figure 1. Example of gating strategy
Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte
More informationwere isolated from the freshly drawn blood of healthy donors and ACS patients using the
Supplemental Figure 1. Quality control of CD4 + T-cell purification. CD4 + T cells were isolated from the freshly drawn blood of healthy donors and ACS patients using the RosetteSep CD4 + T Cell Enrichment
More informationDefective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2 SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1:
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationData Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535
Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationAkt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells
Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,
More informationSupplementary Figure 1: Equilibrium binding analyses of the interaction of efgartigimod with human FcRn
SULEMENTARY DATA Supplementary Figure 1: Equilibrium binding analyses of the interaction of with human FcRn using SR. The coupling density of was 275 RU. Human FcRn was injected over the flow cells at
More informationNK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
More informationGenomic complexity and AKT-dependence in serous ovarian cancer
Genomic complexity and KT-dependence in serous ovarian cancer Hanrahan et al.- Supplementary Text and Figures Corresponding uthor: David B. Solit, Memorial Sloan-Kettering Cancer Center, Human Oncology
More informationSupplementary Information. A vital role for IL-2 trans-presentation in DC-mediated T cell activation in humans as revealed by daclizumab therapy
Supplementary Information A vital role for IL-2 trans-presentation in DC-mediated T cell activation in humans as revealed by daclizumab therapy Simone C. Wuest 1, Jehad Edwan 1, Jayne F. Martin 1, Sungpil
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationInterleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma
Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationBCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid
Supplementary Results BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid leukemia Oliver Hantschel*, Wolfgang Warsch*, Eva Eckelhart*, Ines Kaupe, Florian Grebien, Kay-Uwe Wagner, Giulio
More informationSupplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood
Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More information