Resistance to MTB infection: Host target(s) for therapy?
|
|
- Peter Wilkinson
- 6 years ago
- Views:
Transcription
1 Resistance to MTB infection: Host target(s) for therapy? W. Henry Boom, M.D. TB Research Unit Case Western Reserve University & Univ. Hospitals Case Med. Ctr. NIAID-DMID: -AI70022
2 Resistance to MTB infection? Anecdotes: TST- long-term HCW in TB sanatoria In TB endemic settings (high FOI) +/- 10% of adults remain TST- In TB endemic settings TST = IGRA: no cutaneous homing receptor def. Absolute vs. threshold resistance Genetics of TST- in families (E. Schurr et al. JEM 09)
3 TBRU s TB Household Contact Study Kampala, Uganda Adult (> 18yo) Pulm. TB (sputum culture +) Evaluate household contacts (HIV, TST/IGRA, TB disease) F/U TST q3-6 mo. for TST- at baseline Follow for 2 yrs. Follow for TB
4 Ugandan TB Household Contacts TB Index Cases = 975 Cult+, HIV+/HIV- Contacts (HHC) = 2757 HHC >= 15 years = 1280 (13% HIV+) HHC < 15 years = 1477 (3.4% HIV+) 1114 HIV- HHC Baseline TST+ = 74.6% Baseline TST- = 23% 1429 HIV- HHC Baseline TST+ = 60.1% Baseline TST- = 38.1%
5 Outcomes for TST- HHC
6 MTB infection vs. resistance among TST-, HIV- HHC by age Age group in yrs. N=517 Converters overall N=294 Converters 3 6 mo. N=259 PTST mo. N= (N=65) 53.8% 43.1% 66.2% 2 5 (N=99) 49.5% 42.2% 50.5% 5 15 (N=187) 48.7% 41.7% 51.3% 15+ (N=166) 71.7% 66.9% 28.3%
7 Risk score for MTB exposure Mandalakas et al (2012) Int J Tuberc Lung Dis Add risk factors to obtain a score >5 = High risk exposure (0 10) Age 15+ Score PTST/R LTBI STR Similar exposure risk (P=0.072) >75% RSTR with high exposure
8 CONCLUSIONS 5-10% (7% in our study) of adult TST- TB HHC remain MTB uninfected for up to 2 yrs. No epidemiologic explanation to distinguish adult resisters from those acquiring MTB infection (CONV/LTBI) Age a factor, i.e. cumulative experience matters Absolute ( Elite RSTR?) vs. relative resistance to MTB infection?
9 Biological evidence to distinguish MTB infection from resistance Two approaches: Follow-up of genome-wide scan that identified regions linked with TB and PTST- PTST-: chr 2 and 5* TB: chr 7 and 20 (chr 20 previously identified by (C. Stein, CWRU) mrna expression profiling of MTB infected macrophages from PTST- (T. Hawn, UW) *Cobat et al. 11p14, 5p15 Cape Town, JEM 2009
10 Approach Candidate gene study Genes in TNF, TLR/NLR, and IFN /IL12 pathways Haplotype tagging SNPs (any of 3 African HapMap) 546 SNPs Fine mapping of regions on chromosomes 2 and 5 linked to PTST- Evenly spaced markers (every 10 kb) Genotyped together with 10,000 single nucleotide polymorphism (SNP) panel using Illumina iselect
11 Genetic association with PTST- (at least 2 SNPs with p < 0.05) Gene Best p- value Gene Best p- value IL SLC6A IL12RB STAT NOD TIRAP 0.01 NOD TOLLIP 0.02 Genes with 1 SNP associated: IL6, SLC11A1, TLR2, TLR4
12 Transcriptome Project: Experimental Design RSTR 13 Archived PBMC CD14+ isolation Monocytes Infect live H37Rv (MOI 10:1) 6 hrs RNA Extraction QC LTBI 22 Microarray Analysis Phenotypes A. Resistant to infection (RSTR) (persistent TST negative x 2 yrs) B. Susceptible to infection (LTBI) Illumina Bead Array HT-12 48,000+ probes covering > 25,000 genes At least two probes per gene beads per probe 100,000+ probes per bead Dynamic Range:
13 Analyses 1. Single Gene & Clustering Analysis No significant difference between RSTR and LTBI However 2. Network Analysis A. Linear Neural Network B. GSEA
14 Procedure: 1. Construct stable set of probes that show differential expression between LTBI and RSTR samples Linear Neural Network 2. Train linear neural network to differentiate between the two classes based on expression data for set of probes 3. Apply trained neural network to new data or omit data for cross-validation
15 Leave one out cross-validation RSTR LTBI 1. 80% of LTBI samples are predicted to be LTBI 2. >80% of RSTR samples predicted to be RSTR 3. Correctly classify 22/28 samples in LOOCV
16 Linear Neural Network Analysis with Leave One Out Cross Validation LTBI RSTR 7 genes distinguish RSTR from LTBI Data: Ethan Thompson
17 Gene Set Enrichment Analysis: Pathways with Possible Drug Targets TST_POS: 24 gene sets significant at FDR < 0.25 Major theme: oxidative phosphorylation and mitochondrial function (11 overlapping gene sets) Includes PPAR TST_NEG: 70 gene sets significant at FDR < 0.25 Major themes T-cell signaling (8 overlapping gene sets) Macrophage function Top hit is imatinib
18 FDR = Top Hit for RSTR Gene Name GNS glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) LAMP1 lysosomal-associated membrane protein 1 CTSB cathepsin B ENG endoglin (Osler-Rendu-Weber syndrome 1) LILRB3 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1 CD163 CD163 molecule GBA glucosidase, beta; acid (includes glucosylceramidase) C5AR1 complement component 5a receptor 1 CTSD GUSB ACP5 CD68 FUCA1 cathepsin D (lysosomal aspartyl peptidase) glucuronidase, beta acid phosphatase 5, tartrate resistant CD68 molecule fucosidase, alpha-l- 1, tissue
19 Imatinib, ABL, & TB Napier & Kalman (Cell Host Microbe 2011) -Imatinib inhibits MTB entry & replication in vitro -Inhibits MTB replication in vivo Bruns & Stenger (J. Immunol 2012) -Increases expression of vacuolar ATPase -Lowers ph of phagolysosome Unc119 CRK PI3K Akt NF-kB & Cytokine Response TB ABL1 N-WASP ARP2/3 FcgR, Mannose Receptor, Complement Receptor, TLRs ABL2 Actin Polymerization Membrane Trafficking Phagosome- Lysosome Fusion Rac/CDC42
20 Summary: PTST-/RSTR vs. TST+/LTBI 1. Genetic studies suggest distinct regulation of resistance to MTB infection vs. development of TB 2. Transcriptomics of macrophages more promising 3. Linear Neural Network with LOOCV 1. Correctly classified 22/ probes identified in fixed probe analysis 4. GSEA 1. Several pathways specific to PTST- 2. Imatinib (ABL/Tyr Kinase) was a top hit (drug/pathway hypotheses) 5. Have not excluded role for innate (and even low levels of adaptive) T cell and other cellular responses
21 Studies of resistance to MTB infection may identify targets for host-directed therapy
22 Acknowledgements Makerere Univ. & Mulago Hosp. (Uganda): M Joloba, H Mayanja, E Mupere Univ. of Washington: T Hawn, C Seshadri CWRU: C Stein
23
24 Leading Edge Analysis (FDR 10%) PTST-
Immunology of TB and its relevance to TB Control
Immunology of TB and its relevance to TB Control W. Henry Boom, M.D. TB Research Unit Case Western Reserve University NIAID-DMID: -AI70022 Global TB Epidemiology 2009 < 10 10 to 24 25 to 49 50 to 99 100
More informationA TOLLIP DEFICIENCY ALLELE, RS , IS ASSOCIATED WITH LNCRNA TOLLIP-AS1 EXPRESSION, T-CELL MEMORY PHENOTYPE, AND INCREASED TB SUSCEPTIBILITY
A TOLLIP DEFICIENCY ALLELE, RS5743854, IS ASSOCIATED WITH LNCRNA TOLLIP-AS EXPRESSION, T-CELL MEMORY PHENOTYPE, AND INCREASED TB SUSCEPTIBILITY February 2, 208 5th Global Forum on TB Vaccines MULTIPLE
More informationOngoing Research on LTBI and Research priorities in India
Ongoing Research on LTBI and Research priorities in India Dr. C.Padmapriyadarsini, MD, MS ICMR-National Institute for Research in Tuberculosis Chennai, India Technical Consultation Meeting on Programmatic
More informationGenomic signatures of risk of TB disease Tom Scriba, University of Cape Town
Genomic signatures of risk of TB disease Tom Scriba, University of Cape Town 2nd Expert Workshop on the development of tests for progression of LTBI to active disease 1 July 2016 Possible consequences
More informationROLE OF CD8 IN PROGRESSION FROM LATENT TO ACTIVE TB
ROLE OF CD8 IN PROGRESSION FROM LATENT TO ACTIVE TB Disclosures David Lewinsohn: OHSU inventor, CD8 + T cell vaccines and diagnostics Viti Inc., CEO, current Spouse Deborah Lewinsohn: OHSU inventor, CD8
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationInnate Immunity. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples Chapter 3. Antimicrobial peptide psoriasin
Know Differences and Provide Examples Chapter * Innate Immunity * kin and Epithelial Barriers * Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive
More informationInnate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationHost-Pathogen Interactions in Tuberculosis
Host-Pathogen Interactions in Tuberculosis CNRS - Toulouse, France My presentation will focus on host-cell pathogen interactions in tuberculosis. However, I would first like offer a brief introduction
More informationAllergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
More informationHuman Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980
Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial
More informationGene transcript profiles to diagnose infectious diseases. ESCMID Conference on Diagnosing Infectious Diseases: Future and Innovation
Gene transcript profiles to diagnose infectious diseases ESCMID Conference on Diagnosing Infectious Diseases: Future and Innovation 24-26 October 2011, Venice, Italy Matthew Berry Consultant Respiratory
More informationSupplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2
Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China
More informationHOST-PARASITE INTERPLAY
HOST-PARASITE INTERPLAY Adriano Casulli EURLP, ISS (Rome, Italy) HOST-PARASITE INTERPLAY WP3 (parasite virulence vs human immunity) (Parasite) Task 3.1: Genotypic characterization Task 3.6: Transcriptome
More informationOverview of the immune system
Overview of the immune system Immune system Innate (nonspecific) 1 st line of defense Adaptive (specific) 2 nd line of defense Cellular components Humoral components Cellular components Humoral components
More informationGeneral aspects of this review - specific examples were addressed in class.
General aspects of this review - specific examples were addressed in class. 1 Exam 1 Lecture 2: Discussed intracellular killing mechanisms Important maturation steps Rapid development into a microbicidal
More informationHow should they be evaluated and what evidence is needed for WHO endorsement?
New predictive tests for the diagnosis of tuberculosis infection How should they be evaluated and what evidence is needed for WHO endorsement? Frank Cobelens KNCV Tuberculosis Foundation The Hague, Netherlands
More informationSystem Biology analysis of innate and adaptive immune responses during HIV infection
System Biology analysis of innate and adaptive immune responses during HIV infection Model of T cell memory persistence and exhaustion Naive Ag+APC Effector TEM (Pfp, Gr.B, FasL, TNF) Ag stim. IL-2, IL-7,
More informationPhagocytosis: An Evolutionarily Conserved Mechanism to Remove Apoptotic Bodies and Microbial Pathogens
Phagocytosis of IgG-coated Targets by s Phagocytosis: An Evolutionarily Conserved Mechanism to Remove Apoptotic Bodies and Microbial s 3 min 10 min Mast Cells Can Phagocytose Too! Extension of an F-actin-rich
More informationUpdate on TB Vaccines. Mark Hatherill South African TB Vaccine Initiative (SATVI) University of Cape Town
Update on TB Vaccines Mark Hatherill South African TB Vaccine Initiative (SATVI) University of Cape Town 1 Robert Koch s Therapeutic TB vaccine 1890: Purified Tuberculin Protein 1891: First negative reports
More informationChapter 3 The Induced Responses of Innate Immunity
Chapter 3 The Induced Responses of Innate Immunity Pattern recognition by cells of the innate immune system Pattern recognition by cells of the innate immune system 4 main pattern recognition receptors
More informationPredictive Value of interferon-gamma release assays for incident active TB disease: A systematic review
Predictive Value of interferon-gamma release assays for incident active TB disease: A systematic review Lele Rangaka University of Cape Town, South Africa mxrangaka@yahoo.co.uk 1 The 3 I s Isoniazid preventive
More informationYolanda González, Claudia Carranza, Marco Iñiguez, Martha Torres, Raul Quintana, Alvaro Osornio, Carol Gardner, Srijata Sarkar, and Stephan Schwander
Inhaled Air Pollution Particulate Matter in Alveolar Macrophages Alters local pro-inflammatory Cytokine and peripheral IFNγ Production in Response to Mycobacterium tuberculosis Yolanda González, Claudia
More informationSupplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
More informationAntigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS
1 Antigen Presentation and T Lymphocyte Activation Abul K. Abbas UCSF FOCiS 2 Lecture outline Dendritic cells and antigen presentation The role of the MHC T cell activation Costimulation, the B7:CD28 family
More informationInnate Immunity & Inflammation
Innate Immunity & Inflammation The innate immune system is an evolutionally conserved mechanism that provides an early and effective response against invading microbial pathogens. It relies on a limited
More informationIndependent Study Guide The Innate Immune Response (Chapter 15)
Independent Study Guide The Innate Immune Response (Chapter 15) I. General types of immunity (Chapter 15 introduction) a. Innate i. inborn ii. pattern recognition b. Adaptive i. "learned" through exposure
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationThe Royal Society. SATELLITE MEETING ON Human evolution plagues, pathogens and selection. Pulmonary & Critical Care Medicine
The Royal Society SATELLITE MEETING ON Human evolution plagues, pathogens and selection Recognition of the Mtb-infected Cell: What IGRAS Have Allowed Us To Understand About TB David Lewinsohn, MD, PhD
More informationT cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
More informationIdentifying TB co-infection : new approaches?
Identifying TB co-infection : new approaches? Charoen Chuchottaworn MD. Senior Medical Advisor, Central Chest Institute of Thailand, Department of Medical Services, MoPH Primary tuberculosis Natural history
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More information10th International Rotavirus Symposium Bangkok, Thailand
Rotavirus Host Range Restriction and Innate Immunity: Mechanisms of Vaccine Attenuation Harry Greenberg MD Stanford University 10th International Rotavirus Symposium Bangkok, Thailand 09/19/12 B dsrna
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationApproaches to LTBI Diagnosis
Approaches to LTBI Diagnosis Focus on LTBI October 8 th, 2018 Michelle Haas, M.D. Associate Director Denver Metro Tuberculosis Program Denver Public Health DISCLOSURES I have no disclosures or conflicts
More informationThe Genetic Epidemiology of Rheumatoid Arthritis. Lindsey A. Criswell AURA meeting, 2016
The Genetic Epidemiology of Rheumatoid Arthritis Lindsey A. Criswell AURA meeting, 2016 Overview Recent successes in gene identification genome wide association studies (GWAS) clues to etiologic pathways
More informationHost genotypes, inflammatory response and outcome of TBM Vietnam
Host genotypes, inflammatory response and outcome of TBM Vietnam Nguyen T.T. Thuong Oxford University Clinical Research Unit Ho Chi Minh City, Vietnam Tuberculous Meningitis (TBM) Diagnosis remains difficult
More informationTNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More informationDuring the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin,
ESM Methods Hyperinsulinemic-euglycemic clamp procedure During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin, Clayton, NC) was followed by a constant rate (60 mu m
More informationLecture on Innate Immunity and Inflammation
Lecture on Innate Immunity and Inflammation Evolutionary View Epithelial barriers to infection Four main types of innate recognition molecules:tlrs, CLRs, NLRs, RLRs NF-κB, the master transcriptional regulator
More informationLTBI-Tuberculin skin test. T-Spot.TB Technology. QuantiFERON -TB Gold In Tube T-SPOT.TB ELISA ELISA
LTBI-Tuberculin skin test QuantiFERON -TB Gold In Tube ELISA PPD ~200 antigens 3 ml blood ESAT-6 TB 7.7 16-24 hour incubation Nil Negative control PHA Positive control Andersen et al Lancet 2000;356:1099-1104
More informationInnate immunity. Abul K. Abbas University of California San Francisco. FOCiS
1 Innate immunity Abul K. Abbas University of California San Francisco FOCiS 2 Lecture outline Components of innate immunity Recognition of microbes and dead cells Toll Like Receptors NOD Like Receptors/Inflammasome
More informationBiomarkers for Tuberculosis. Robert S. Wallis, MD, FIDSA Senior Director, Pfizer
Biomarkers for Tuberculosis Robert S. Wallis, MD, FIDSA Senior Director, Pfizer TB Global Burden total cases WHO 2009 TB Global Burden case rates WHO 2009 HIV prevalence in TB cases WHO 2009 TB Trends
More informationSYSTEMS BIOLOGY APPROACHES TO IDENTIFY MECHANISMS OF IMMUNE MEDIATED PROTECTION TRANSLATING RESEARCH INTO HEALTH
SYSTEMS BIOLOGY APPROACHES TO IDENTIFY MECHANISMS OF IMMUNE MEDIATED PROTECTION TRANSLATING RESEARCH INTO HEALTH Novel assays to decipher protective immune responses Decoding the immune response to infectious
More informationCross-regulation of host STATs for the survival of Toxoplasma gondii
JITMM2010&IMC2010, 1-3 December 2010 Cross-regulation of host STATs for the survival of Toxoplasma gondii Ho-Woo Nam 1, Dong-Soo Kim 2, Sung-Jong Hong 3 Department of arasitology, College of Medicine,
More information16 Innate Immunity: M I C R O B I O L O G Y. Nonspecific Defenses of the Host. a n i n t r o d u c t i o n
ninth edition TORTORA FUNKE CASE M I C R O B I O L O G Y a n i n t r o d u c t i o n 16 Innate Immunity: Nonspecific Defenses of the Host PowerPoint Lecture Slide Presentation prepared by Christine L.
More informationIntroduction to the Genetics of Complex Disease
Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome
More informationPCxN: The pathway co-activity map: a resource for the unification of functional biology
PCxN: The pathway co-activity map: a resource for the unification of functional biology Sheffield Institute for Translational Neurosciences Center for Integrative Genome Translation GENOME INFORMATICS
More informationThe Major Histocompatibility Complex (MHC)
The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationPediatric TB Lisa Armitige, MD, PhD September 28, 2011
TB Nurse Case Management Davenport, Iowa September 27 28, 2011 Pediatric TB Lisa Armitige, MD, PhD September 28, 2011 Lisa Armitige, MD, PhD has the following disclosures to make: No conflict of interest.
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationOctober 26, Lecture Readings. Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell
October 26, 2006 Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell 1. Secretory pathway a. Formation of coated vesicles b. SNAREs and vesicle targeting 2. Membrane fusion a. SNAREs
More informationA rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France
A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is
More informationWhat makes the transmitted HIV-1 in newly infected patients unique from the donor inoculum?
What makes the transmitted HIV-1 in newly infected patients unique from the donor inoculum? What happens during primary infection? Los Alamos National Laboratories Evidence of the genetic bottleneck at
More informationLecture on Innate Immunity and Inflammation. Innate Immunity: An Evolutionary View
Lecture on Innate Immunity and Inflammation Evolutionary View Epithelial barriers to infection Four main types of innate recognition molecules:tlrs, CLRs, NLRs, RLRs NF-κB, the master transcriptional regulator
More information9 Juin Jean-Paul Mira. Réanimation Médicale & Dept.. de Biologie Cellulaire Hôpital Cochin & Institut Cochin, Paris, F
Génétique et Sepsis 9 Juin 2005 Jean-Paul Mira Réanimation Médicale & Dept.. de Biologie Cellulaire Hôpital Cochin & Institut Cochin, Paris, F «If it were not for the great variability among individuals
More informationThe role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia
The role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia Adrian Zordan, Meaghan Wall, Ruth MacKinnon, Pina D Achille & Lynda Campbell Victorian Cancer Cytogenetics Service (VCCS)
More informationDuskova et al. BMC Infectious Diseases 2013, 13:250
Duskova et al. BMC Infectious Diseases 2013, 13:250 RESEARCH ARTICLE Open Access MicroRNA regulation and its effects on cellular transcriptome in Human Immunodeficiency Virus-1 (HIV-1) infected individuals
More informationGenetics of extreme body size evolution in mice from Gough Island
Genetics of extreme body size evolution in mice from Gough Island Karl Broman Biostatistics & Medical Informatics, UW Madison kbroman.org github.com/kbroman @kwbroman bit.ly/apstats2017 This is a collaboration
More informationPerspective in novel TB vaccine development Mohamed Ridha BARBOUCHE M.D., Ph.D. Department of Immunology Institut Pasteur de Tunis
Perspective in novel TB vaccine development Mohamed Ridha BARBOUCHE M.D., Ph.D. Department of Immunology Institut Pasteur de Tunis Existing TB Vaccine is not effective for global TB epidemic control BCG
More informationEvaluation of mycobacterium terberculosis antigenspecific CD8+T cell responses
Oregon Health & Science University OHSU Digital Commons Scholar Archive June 2012 Evaluation of mycobacterium terberculosis antigenspecific CD8+T cell responses Matthew D. Iles-Shih Follow this and additional
More informationBig Data Training for Translational Omics Research. Session 1, Day 3, Liu. Case Study #2. PLOS Genetics DOI: /journal.pgen.
Session 1, Day 3, Liu Case Study #2 PLOS Genetics DOI:10.1371/journal.pgen.1005910 Enantiomer Mirror image Methadone Methadone Kreek, 1973, 1976 Methadone Maintenance Therapy Long-term use of Methadone
More informationSupplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
More informationTB Contact Investigation
Ann Raftery, RN, PHN, MS Curry International TB Center Overview Contact investigation as a core TB control and elimination activity Components of TB Contact Investigation TB Control Priority Strategies.
More informationTuberculosis and Diabetes Mellitus. Lana Kay Tyer, RN MSN WA State Department of Health TB Nurse Consultant
Tuberculosis and Diabetes Mellitus Lana Kay Tyer, RN MSN WA State Department of Health TB Nurse Consultant Learning Objectives Understand the impact of uncontrolled diabetes mellitus (DM) on TB infection
More informationUsing Ozone to Validate a. Toxicity Testing
Using Ozone to Validate a Systems Biology Approach to Toxicity Testing Robert Devlin Environmental Public Health Division US EPA Systems Biology Informed Risk Assessment Meeting NationalAcademy of Sciences
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12864 Supplementary Table 1 1 2 3 4 5 6 7 Peak Gene code Screen Function or Read analysis AMP reads camp annotation reads minor Tb927.2.1810 AMP ISWI Confirmed
More informationSupplementary figure 1
Supplementary figure 1 Nature Medicine: doi:1.138/nm.275 CLUSTER BY SELF-ORGANIZING MAPS SELECTED PATHWAY ANALISYS TERMS Cluster : up-regulated genes in acute patients Cell cycle/dna repair Fatty acid
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationAn integrated transcriptomic and functional genomic approach identifies a. type I interferon signature as a host defense mechanism against Candida
Supplementary information for: An integrated transcriptomic and functional genomic approach identifies a type I interferon signature as a host defense mechanism against Candida albicans in humans Sanne
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationSUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish
SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,
More informationPreventing TB Transmission in Health Care Facilities. Webinar October 20, Curry International Tuberculosis Center
Staying Safe: Preventing TB Transmission in Health Care Facilities Kevin P. Fennelly, MD, MPH 20 October 2014 Associate Professor of Medicine Department of Medicine University of Florida, Gainesville,
More informationThe epigenetic landscape of T cell subsets in SLE identifies known and potential novel drivers of the autoimmune response
Abstract # 319030 Poster # F.9 The epigenetic landscape of T cell subsets in SLE identifies known and potential novel drivers of the autoimmune response Jozsef Karman, Brian Johnston, Sofija Miljovska,
More informationIndex. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305
Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6
More informationPirna Sequence Variants Associated With Prostate Cancer In African Americans And Caucasians
Yale University EliScholar A Digital Platform for Scholarly Publishing at Yale Public Health Theses School of Public Health January 2015 Pirna Sequence Variants Associated With Prostate Cancer In African
More informationUniversity of Groningen. Hidradenitis suppurativa Dickinson-Blok, Janine Louise
University of Groningen Hidradenitis suppurativa Dickinson-Blok, Janine Louise IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More information7.012 Quiz 3 Answers
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84
More informationMICR2209. Innate Immunity. Dr Allison Imrie
MICR2209 Innate Immunity Dr Allison Imrie allison.imrie@uwa.edu.au Synopsis: In this lecture we will review the different mechanisms which consbtute the innate immune response, and examine the major cells
More informationChapter 19: The Genetics of Viruses and Bacteria
Chapter 19: The Genetics of Viruses and Bacteria What is Microbiology? Microbiology is the science that studies microorganisms = living things that are too small to be seen with the naked eye Microorganisms
More informationChapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
More informationLarge-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017
Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2
More informationTrim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
More informationGenetics and the Path Towards Targeted Therapies in Systemic Lupus
Genetics and the Path Towards Targeted Therapies in Systemic Lupus Emily Baechler Gillespie, Ph.D. University of Minnesota Department of Medicine Division of Rheumatic and Autoimmune Diseases Disclosures
More informationEtiology of Chronic Diseases. Complex Diseases Genes and Environment Initiative
Etiology of Chronic Diseases Complex Diseases Genes and Environment Initiative Top 10 Causes of Mortality in 2003 Death Rate per 100,000 Heart disease...232 Cancer...190 Cerebrovascular disease....54 Chronic
More informationBasic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction
Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.
More informationInnate immune regulation of T-helper (Th) cell homeostasis in the intestine
Innate immune regulation of T-helper (Th) cell homeostasis in the intestine Masayuki Fukata, MD, Ph.D. Research Scientist II Division of Gastroenterology, Department of Medicine, F. Widjaja Foundation,
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationGenetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder)
Genetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder) September 14, 2012 Chun Xu M.D, M.Sc, Ph.D. Assistant professor Texas Tech University Health Sciences Center Paul
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationAnti-infectious Immunity
Anti-infectious Immunity innate immunity barrier structures Secretory molecules Phagocytes NK cells Anatomical barriers 1. Skin and mucosa barrier 2.hemo-Spinal Fluid barrier 3. placental barrier Phagocytic
More informationLTBI monitoring and evaluation in the Netherlands
LTBI monitoring and evaluation in the Netherlands 17 th Wolfheze Workshops 2015, Den Haag Connie Erkens MD MPH Senior TB consultant Content presentation Epidemiology Target groups for programmatic LTBI
More informationTime course of immune response
Time course of immune response Route of entry Route of entry (cont.) Steps in infection Barriers to infection Mf receptors Facilitate engulfment Glucan, mannose Scavenger CD11b/CD18 Allows immediate response
More informationTB Intensive Houston, Texas. Childhood Tuberculosis Kim Connelly Smith. November 12, 2009
TB Intensive Houston, Texas November 10-12, 12 2009 Childhood Tuberculosis Kim Connelly Smith MD, MPH November 12, 2009 Childhood Tuberculosis Kim Connelly Smith MD, MPH November 12, 2009 1 OUTLINE Stages
More informationESCMID Online Lecture Library. by author
Tuberculosis prevention in immunodepressed patients M. Carmen Fariñas Álvarez Infectious Diseases.H.U.Marqués de Valdecilla University of Cantabria, Spain DISCLOSURES I have no potential conflicts with
More informationIdentification of Microbes
Identification of Microbes Recognition by PRR (pattern recognition receptors) Recognize conserved molecular patterns on microbes called pathogen associated molecular patterns (PAMPs) which are not present
More information