Single Particle Tracking of Human Immunodeficiency Virus Type 1 Productive Entry into Human Primary Macrophages

Transcription

1 Single Particle Tracking of Human Immunodeficiency Virus Type 1 Productive Entry into Human Primary Macrophages Qin Li 1, 2,, Wei Li 2,, Wen Yin 2, Jia Guo 4, Zhi-Ping Zhang 2, Dejun Zeng 2, Xiaowei Zhang 2, Yuntao Wu 4,*, Xian-En Zhang 3,*, Zongqiang Cui 2,* 1 College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, P.R.China; 2 State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, P.R.China; 3 National Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, P.R.China; 4 National Center for Biodefense and Infectious Diseases, Department of Molecular and Microbiology, George Mason University, Manassas, VA, USA These authors contributed equally to this work Affiliated institutions 1 and 2 contributed equally to this paper 1

2 Figure S1. Construction and characterization of HIV-1-QDs. (A-D) BirA and Vpr proteins expressed in 293T cells were analyzed by western blotting. (A) The expression of BirA, which was tested 48 hours after pcdna3.1(+)-bira was transfected into 293T cells. (B) The expression of Vpr-AP-His protein, was assessed by anti-his tag antibody. (C) The biotinylation of the Vpr protein in the HIV-1-QD-producing 293T system. (D) Concentration optimization of biotin in the Vpr protein biotinylation. To optimize the amount of biotinylated Vpr-AP proteins, the concentration of biotin added into cell culture media was analyzed from 0 to 400 μm. (E) Cytoplasmic uptake of lipofected QDs in virus-producing 293T cells. (F) Photostability comparison between HIV-1-QD and HIV-1-EGFP viral particles. To acquire the bleaching curves, single particles of HIV-1-EGFP or HIV-1-QD in the cell discontinuously illuminated with 488-nm (for HIV-1-EGFP) or 561-nm (for 2

3 HIV-1-QD) lasers for 200-ms exposure at 10-sec intervals for over 1 hours. The fluorescent signal was recorded by EM-CCD, and analyzed by Volocity software. (Inset) Shown is an enlargement view of the boxed region. (G) Fluorescence imaging of membrane stripped HIV-1-QD-DiO viral particles. The particles showed only QD fluorescence signal but no DiO fluorescence. (H) 293T cells producing HIV-1-QDs were harvested at 48 hours post-transfection, prepared, and analyzed by ultrathin section electron microscopy. Right panel is an enlargement view of the rectangular region. Arrowheads indicate HIV-1-QD virus particles. Scale bar: 200 nm. 3

4 Figure S2. Evidences of HIV-1-QDs endocytic entry into macrophages. (A) Statistical analysis of the virus particles endocytic entry into the macrophages or TZM-bl cells in 2 hours post-infection (left). (Right) Statistical analysis of viral particles endocytic entry at various times in 2 hours post-infection. (B) Dynamic colocalization analysis of HIV-1-QD (red) and transferrin-alexa-488 (green) in macrophages. (C) Trajectories of the colocalization of a HIV-1-QD particle (red) with 4

5 transferrin-alexa-488 (green) and their separation were analyzed in macrophages. Scale bar: 0.5 μm. (D) The mean velocity of HIV-1-QD before and after separation from transferrin-alexa-488. (E) The internalization of HIV-1 virus was tested in cells treated with clathrin-related inhibitors. TZM-bl cells were pretreated with 10 μg ml -1 of CPZ, 0.45 M hyperosmotic sucrose, or 80 μm Dynasore for 1 hour, infected with HIV-1 and further cultured for 3 hours. The virus internalization was measured by a p24 ELISA. Histograms display averages ± SEM; n = 3; *p < 0.05; **p < (F) The time distribution of HIV-1-QD viral particles colocalized with EGFP-Rab5A-marked endosomes. Average data were (mean ± SD): ± 11.6 sec (n = 20). (G) Statistical analysis of the colocalization of HIV-1-QD or HIV-1(KFS) labeled with mcherry with EGFP-Clathrin and EGFP-Rab5A. (H) Phototoxicity assay of irradiated cells. Histograms display averages ± SEM; n = 3; ns, no significant difference. 5

6 Figure S3. Real-time imaging of the viral core release of HIV-1-QD into the cytosol. (A) Single particle tracking of a HIV-1-QD-DiO particle (rectangular region) shows the vanish (green 6

7 rectangular box) of QD signal (red) and retain of DiO-envelope signal, which indicates the QDs-labeled core was released into cytosol. Scale bar: 10 μm. Normalized fluorescence intensities of the QD signal and DiO signal are shown in (B) and (C), respectively. (D) A dual-labeled HIV-1-QD-DiO particle in TZM-bl cells (shown in the rectangular region) was tracked. Scale bar: 10 μm. (E) Sequential snapshots are shown for the separation of QD-Vpr and the DiO-labeled membrane of the viral particle that is shown in rectangular region of (D) in the TZM-bl cells. Arrowhead indicates the separation of QD and DiO signals. (F) Trajectories of HIV-1-QD (red) and DiO-labeled membrane (green) for the viral particle that is shown in (D). Scale bar: 0.2 μm. 7

8 Figure S4. Cell viability assays of inhibitor-treated cells. (A) The cells (top: Macrophages, middle: TZM-bl cells, bottom: Rev-CEM cells) were treated with different inhibitors (T20, CPZ, 8

9 Sucrose, or Dynasore) for 4 hours, and the cell toxicity was analyzed by LIVE/DEAD Viability/Cytotoxicity Kit (live cells: green, dead cells: red). Scale bars: 50 μm. Statistical analyses of the viability of inhibitor-treated macrophages (B), TZM-bl cells (C), which are expressed as a percentage of untreated control cells. Histograms display averages ± SEM; n = 3 5; ns, no significant difference; **p<0.01. The cytotoxicities of these inhibitors were compared with that of cells in the positive cytotoxic group, which were pretreated with 10 μm H 2 O 2. (D) Macrophages was treated with increasing concentrations of Dynasore (0.8, 8, 80 μm) for 30 min, the cell viability was determined using MultiTox-Glo Multiplex Cytotoxicity Assay Kit. Histograms represent averages ± SEM; n = 3. (E) Macrophages was treated with increasing concentrations of T20 (0.1, 1, 10 μg ml -1 ) for 1 hour, the cell viability was determined using MultiTox-Glo Multiplex Cytotoxicity Assay Kit. Histograms represent averages ± SEM; n = 3. (F) Statistical analyses of the viability of inhibitor-treated Rev-CEM cells, which is expressed as a percentage of untreated control cells. Histograms display averages ± SEM; n = 3 5; ns, no significant difference; **p<

10 Figure S5. The role of inhibitors on HIV-1 internalization and productive infection. (A) The effect of Dynasore on HIV-1 NL(KFS)-YU2 infection. Macrophages was pretreated with increasing concentrations of Dynasore (0.8, 8, 80 μm) for 30 min, and then infected with HIV-1 NL(KFS)-YU2 in the presence of drug for 2 hours. Viral production was measured for 7 days by p24 release. (B) The effect of T20 on HIV-1 NL(KFS)-YU2 infection. Macrophages was pretreated with increasing concentrations of T20 (0.1, 1, 10 μg ml -1 ) for 1 hour, and then infected by a single-round infectious HIV-1 NL(KFS)-YU2 in the presence of the drug for 2 hours. This single-round viral infection was measured for 7 days by p24 release. (C) The effect of T20 on HIV-1 internalization by macrophages, TZM-bl cells, and Rev-CEM cells. Histograms display averages ± SEM; n = 3 5; ns, no significant difference; ***p < (D) The effect of endosome fusion inhibitors, Wortmannin (100 nm), LY (10 μm) on HIV-1 replication. Curves display averages ± SEM; n = 3,** p <

11 Figure S6. Evaluation of the role of actin in HIV-1-QD entry into macrophages. (A) 2D (top panels) and 3D (bottom panels) images of HIV-1-QD particles in macrophages whose actin was 11

12 stained with Alexa Fluor 488-phalloidin. Arrowheads indicate colocalization. Scale bars: 10 μm. (B) Macrophages and TZM-bl cells were treated with different inhibitors (Stau, Lat A, or CytoD) for 4 hours, cell toxicity was analyzed by LIVE/DEAD Viability/Cytotoxicity Kit (live cells: green, dead cells: red, upper panels). Scale bars: 50 μm. The statistical analyses of the viability of inhibitor-treated macrophages and TZM-bl cells were shown in bottom panels, which are expressed as a percentage of untreated control cells. Histograms display averages ± SEM; n = 3 5; ns, no significant difference; **p< Cells pretreated with 10 μm H 2 O 2 were used as a positive cytotoxic group. (C) The effects of actin related inhibitors on HIV-1 internalization were measured by p24 assays at 3 hours post-infection. Histograms display averages ± SEM; n = 3; **p< 0.01; ***p< (D) Cell viability assays of Jas-treated macrophages. Macrophages was treated with 40 nm Jas for 1 hour, the cell viability was determined using MultiTox-Glo Multiplex Cytotoxicity Assay Kit. 12

13 Movie S1. Real-time imaging of HIV-1-QD-DiO particles endocytic entry into TZM-bl cells. TZM-bl cells were infected with HIV-1-QD-DiO. Fluorescence was imaged with an UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.). Sequential images were taken at 10-sec intervals for 60 min, and the video frame rate is 15 Hertz. Trajectories of particles a and b are shown in the video. The virus a was confined to the cellular membrane for about 30 min, and then, was rapidly transported into the cytosol at a high velocity. In contrast, virus b attached to the cell membrane, neither membrane fusion nor endocytosis was observed during real-time imaging. Movie S2. Real-time imaging of HIV-1-QD-DiO particle endocytic entry into macrophages. Macrophages were infected with HIV-1-QD-DiO. Fluorescence was imaged with an UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.). Sequential images were taken at 10-sec intervals for 44 min, and the video frame rate is 15 Hertz. The trajectory of a HIV-1-QD-DiO particle on a primary macrophage is shown in the video. This particle moved slowly at the beginning, and then was rapidly transported into the cytoplasm. Movie S3. Dynamic colocalization of HIV-1-QD and EGFP-Clathrin in macrophages. Cells were transiently transfected with an EGFP-Clathrin (green) expression vector, infected with HIV-1-QDs (red). Fluorescence was imaged with an UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.). Sequential images were taken at 10-sec intervals for 10 min, and the video frame rate is 15 Hertz. The HIV-1-QD particle was recruited into an EGFP-labeled clathrin-coated pit for about 4 min, and then separated from the clathrin-coated pit and internalized into the cytoplasm. 13

14 Movie S4. Real time imaging of the HIV-1-QD viral core release from the envelope membrane in macrophages. Macrophages were infected with HIV-1-QD-DiO. Fluorescence was imaged with an UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.). Sequential images were taken at 10-sec intervals for 3 min, and the video frame rate is 2 Hertz. The dual labeled yellow virus particle with QD and DiO colocalization signal was tracked in the macrophage cytoplasm. During the dynamic movement of the virus particle in the cytoplasm, we observed a separation of the QD signal (red) from the DiO signal (green). Movie S5. Real time imaging of the HIV-1-QD viral core release from the envelope membrane in TZM-bl cells. TZM-bl cells were infected with HIV-1-QD-DiO. Fluorescence was imaged with an UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.). Sequential images were taken at 10-sec intervals for 4 min, and the video frame rate is 2 Hertz. The dual labeled yellow virus particle with QD and DiO colocalization signal was tracked. A separation of the QD fluorescence signal from the DiO fluorescence signal during the dynamic movement of the virus particle in the cytoplasm was observed. Movie S6. Real time imaging of the HIV-1-QD viral core release from the ECFP-Rab5A-marked endosome in macrophages. Cells were transiently transfected with an ECFP-Rab5A (cyan) expression vector, infected with HIV-1-QD (red). Fluorescence was imaged with an UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.). Sequential images were taken at 10-sec intervals for 20 min, and the video frame rate is 15 Hertz. The colocalization of the three colors, viral envelope DiO (green), viral core QD (red), and cellular ECFP-Rab5A (cyan) shows that the dual-labeled HIV-1 particles, HIV-1-QD-DiO, were internalized 14

15 into Rab5A-positive endosomes in macrophages. During the tracking of these particles, the QD signal (red) separated from the DiO signal (green), suggesting the release of the viral core from the envelope. At the same time, the QD signal was also separated from the ECFP signal (cyan), but during this process, the signals from the envelope DiO and the ECFP-Rab5A remained together. This dynamic separation process shows that the virus envelope fuses with Rab5A-marked endosome membrane, and the viral capsid core is released from the endosome into the cytosol. Movie S7. Dynamic colocalization of HIV-1-QD and EGFP-Lifeact labeled actin in live primary macrophages. Cells were transiently transfected with an EGFP-Lifeact (green) expression vector, infected with HIV-1-QD (red). Fluorescence was imaged with an UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.). Sequential images were taken at 10-sec intervals for 10 min, and the video frame rate is 10 Hertz. A HIV-1-QD particle was observed to be dynamically co-localized with EGFP-Lifeact labeled actin at the edge of a macrophage. This particle moved slowly in an actin-rich region at the beginning, and then was rapidly transported into the cytoplasm. Movie S8. Actin tail is involved in the transport of HIV-1-QD in macrophages. Cells were transiently transfected with an EGFP-Lifeact (green) expression vector, infected with HIV-1-QDs (red). Fluorescence was imaged with an UltraView Vox spinning disk confocal laser scanning system (PerkinElmer, Co.). Sequential images were taken at 10-sec intervals for 7 min, and the video frame rate is 10 Hertz. Actin tail moves toward and become co-localized with the HIV-1-QD particle, showing that actin tail participate in the intracellular transport of HIV-1 virus particles. 15

16 SUPPORTING EXPERIMENTAL PROCEDURES Construction of the pcdna3.1(+)-vpr-ap expression vector. To construct pcdna3.1(+)-vpr-linker-ap, the coding sequence of Vpr was amplified from the HIV-1 proviral plasmid pad8 (R5-tropic subtype B) by PCR using specific primers and cloned into the pcdna3.1(+) vector (Invitrogen). The forward primer was 5'-GCTAAGCTTGCCGCCACCATGGAACAAGCCCCAGAAGATC-3' and the reverse primer was 5'-GTAGGATCCTTATTCGTGCCATTCGATTTTCTGAGCTTCGAAGATATCGTTCAGACCTCCG CCTCCGCCGGATCTACTGGCTCCAT-3'. Primers were designed to include the restriction sites Hind III and BamH I (underlined). The AP tag 1, 2 was introduced in the reverse primer, shown in italics at the 3ʹ end of the Vpr gene, and a linker of four glycines was included. 3 The Kozak consensus sequence for optimal translation initiation in forward primer is shown in bold. To construct the pcdna3.1(+)-bira, the full-length coding sequence of Escherichia coli biotin ligase BirA was amplified (from pbira) by PCR using specific primers and cloned into the pcdna3.1(+) vector. The forward primer was 5'-ATTAGGATCCGCCGCCACCATGAAGGATAACACCGTGCC-3' and the reverse primer was 5'-GCCGGAATTCTTATTTTTCTGCACTACGCAGGGAT-3'. These primers were designed to include the restriction sites BamH I and EcoR I (underlined). The Kozak consensus sequence for optimal translation initiation in forward primer is shown in bold. Construction of the pcdna3.1(+)-vpr-ap-his expression vector. The plasmid pcdna3.1(+)-vpr-ap was constructed to express the Vpr-AP chimeric protein in 293T cells. To further verify the correct expression of the Vpr-AP chimeric protein, we constructed the 16

17 pcdna3.1(+)-vpr-ap-his expression vector by fusing a His tag to the C terminal of the Vpr-AP chimeric protein. The full-length coding sequence of Vpr-AP (from pcdna3.1(+)-vpr-ap) was amplified by PCR using specific primers and cloned into pcdna3.1(+) vectors (Invitrogen). The forward primer was 5'-GCTAAGCTTGCCGCCACCATGGAACAAGCCCCAGAAGATC-3' and the reverse primer was 5'-CGCGGATCCTTAATGATGATGATGATGATGTTCGTGCCATTCGATTTTCT-3'. The primers were designed to include the restriction sites Hind III and BamH I (underlined). The Kozak consensus sequence for optimal translation initiation in forward primer is shown in bold. The His tag sequence in the reverse primer is also shown in bold. Construction of the pcdna3.1(+)-bira expression vector. To construct pcdna3.1(+)-bira, the full-length coding sequence of E. coli biotin ligase BirA was amplified (from pbira) by PCR using specific primers and cloned into the pcdna3.1(+) vector. The forward primer was 5'-ATTAGGATCCGCCGCCACCATGAAGGATAACACCGTGCC-3' and the reverse primer was 5'-GCCGGAATTCTTATTTTTCTGCACTACGCAGGGAT-3'. They were designed to include the restriction sites BamH I and EcoR I (underlined). The Kozak consensus sequence for optimal translation initiation in forward primer is shown in bold. Western blot assay to detect Vpr-AP chimeric protein and BirA expression. Western blot assays were performed to determine if the Vpr-AP chimeric protein was appropriately expressed. The pcdna3.1(+)-vpr-ap-his expression vector was transfected into 293T cells. Then, the 293T cells were lysed on ice for 20 min in cell lysis buffer for western blot (Beyotime), 1 mm PMSF, and complete mini-protease inhibitor cocktail (Roche). The lysate was cleared by centrifugation at 17

18 10,000 g for 10 min, mixed with 5 SDS sample buffer (Beyotime), heated at 95 o C for 5 min, resolved by 12 % SDS-PAGE, and transferred onto a PVDF membrane. After blocking overnight at 4 o C in PBS supplemented with 5.0% skim milk, the PVDF membrane was incubated with rabbit polyclonal anti-his antibodies conjugated to HRP (1:1,000 dilution; Cell signaling Technology) in PBS supplemented with 1.0% skim milk at 37 o C for 2 hours. After three washes (PBS containing 0.1% Tween-20), the membrane was developed with a chemiluminescent detection system (BioRad). To confirm the appropriate expression of BirA, the expression of BirA was subjected to western blot analysis. pcdna3.1(+)-bira was transfected into 293T cells. The western blot procedures used were the same as those described in the Vpr-AP-His detection. The membrane was incubated with chicken polyclonal anti-bira antibodies in PBS supplemented with 1% skim milk (1:1,000 dilution) at 37 o C for 2 hours. After three washes, the membrane was incubated with HRP-conjugated anti-chicken IgG (Cell signaling Technology) in PBS supplemented with 1% skim milk (1:1,000 dilution) at 37 o C for 2 hours. After three washes, the membrane was developed with a chemiluminescent detection system. To verify the specific biotinylation of the target protein and choose an appropriate concentration of biotin to add in the labeling system, the QD-Vpr-producing cells were subjected to a western blot analysis as above. After blocking the membrane overnight at 4 o C in PBS supplemented with 5.0% BSA, the membrane was incubated with streptavidin-conjugated rabbit polyclonal antibodies in PBS supplemented with 1% BSA (1:1,000 dilution) at 37 o C for 2 hours. The membrane was developed with a chemiluminescent detection system. 18

19 Production of AD8, NL4-3, NL(KFS)-YU2, HIV-1(KFS) and HIV-1-EGFP virus. The plasmid transfections and virus experiments were performed in BSL-2 or BSL-3 laboratories. Wild type HIV-1 AD8 and NL4-3 were generated by transfecting 11.0 μg of pad8 in 60-mm dishes with Lipofectamine 2000 Reagent. NL(KFS)-YU2 was generated by transfecting 10 μg of pnl4-3-kfs, 10 μg of pyu-2 in 10-mm dishes with Lipofectamine 2000 Reagent. HIV-1(KFS) were generated by co-transfecting 22.5 μg of pnl4-3-kfs, 2.5 μg of pmcherry-vpr in 100-mm dishes with Lipofectamine 2000 Reagent. HIV-1-EGFP virus was obtained transiently co-transfecting 293T cells with 20.0 μg pad8 and 2.0 μg pegfp-vpr in 100-mm dishes with Lipofectamine 2000 Reagent. Viruses were collected 48 hours post-transfection; cellular debris was cleared by low-speed centrifugation and the supernatant was filtered through a 0.45-μm spin filter. Fluorescent colocalization assay of labeled virus. The HIV-1-QD virus and HIV-1-QD-DiO dual-labeled virus were plated onto 30-mm glass coverslips for immunofluorescence analysis or direct observation. For immunofluorescence analysis of HIV-1 particles, the virus were washed with PBS (ph 7.4), fixed with 4.0% freshly prepared paraformaldehyde at room temperature for 15 min, and permeabilized for 15 min with 0.1% Triton X-100. Then, virions were washed with PBS, incubated in 10% FBS to prevent nonspecific staining, and incubated with mouse monoclonal antibody against HIV-1 p24 (Abcam) followed by Alexa Fluor 488 rabbit anti-mouse IgG (Cell Signaling Technology). Fluorescent colocalization was quantitatively analyzed by Volocity software. Photostability comparison between HIV-1-QD and HIV-1-EGFP viral particles. To acquire the bleaching curves, single particles of HIV-1-EGFP or HIV-1-QD in the cell were discontinuously illuminated with 488-nm (for HIV-1-EGFP) or 561-nm (for HIV-1-QD) lasers for 200-ms exposures 19

20 at 10-sec intervals for over 1 hours. The fluorescent signal was recorded by EM-CCD and analyzed by Volocity software. Virus infectivity assay TZM-bl cells (HeLa-derived indicator TZM-bl cells expressing CD4, CXCR4, and CCR5) were cultured on 96-well plates 24 hours before infection, and infected with virus containing 100 ng p24 in the presence of 15 μg ml -1 DEAE dextran. The amount of p24 was quantified using an ELISA kit (Livzon Diagnostics Co.) according to the manufacturer s instructions. The HIV-1 titers were measured with an end-point dilution of a luciferase activity assay, measured 48 hours after infection using the luciferase enzyme assay system with reporter lysis buffer (Beyotime) according to the manufacturer s instructions. TCID 50 were calculated by the Reed-muench method. A cut-off value of 2.5-times the background RLU (relative luciferase unit) was used to quantify positive samples. 5-7 Transmission electron microscopy analysis. The collected viruses, QDs and viral cores were absorbed onto carbon-coated copper grids, negatively stained with 2.0% phosphotungstic acid (PTA, ph 7.0), and observed using a 200 kv HITACHI-7000FA transmission electron microscope. Meanwhile, 293T cells producing HIV-1-QDs were harvested at 48 hours post-transfection, prepared, and analyzed by ultrathin section electron microscopy. In brief, 293T cells used to generate HIV-1-QD virus were fixed overnight with 2.5% glutaraldehyde in 0.1 M PBS that contained 250 mm sucrose to maintain proper osmotic conditions. Cells were then washed with PBS containing 250 mm sucrose and post-fixed in 1.0% osmium tetroxide in 0.1 M PBS for 1 hour. The specimens were then dehydrated in a series of graded alcohol solutions, embedded in araldite, and polymerized 20

21 for 24 hours. Ultrathin sections (approximately 100 nm) were cut with an ultramicrotome, picked up on copper grids, and observed via TEM. Macrophage differentiation /well PBMC were seeded onto 30-mm glass coverslips, left to adhere to the surface, and stimulated with 10 ng ml -1 human macrophage colony-stimulating factor (hm-csf, Cell Signaling Technology) to differentiate into primary macrophage over 7 days. These cells were cultured in RPMI 1640 medium (Gibco) supplemented with 10% heat-inactivated FBS in a 5% CO 2 environment at 37 o C. Phototoxicity assay. Macrophages and TZM-bl cells were infected with HIV-1-QD-DiO. QDs were excited with 561-nm lasers and detected with a 615-nm (W70) emission wheel, and DiO were excited with 488-nm lasers and detected with a 525-nm (W50) emission wheel. Imaging was carried out by spinning disk confocal microscope using a 60, 1.4 NA oil immersion objective lens at 6-sec intervals for 60 min. After irradiation, the culture medium was changed against fresh medium and cultured 24 hours in a 5% CO 2 environment at 37 o C. The cell viability was measured by CCK-8 assay compared with untreated control. The results (Figure S4C) show there is no difference between irradiated cells and untreated cells.. 21

22 SUPPORTING REFERENCES 1. Chen, I.; Howarth, M.; Lin, W. Y; Ting, A. Y. Site-specific Labeling of Cell Surface Proteins with Biophysical Probes Using Biotin Ligase. Nat. Med. 2005, 2, Sung, K. J; Maloney, M. T. Yang, J. K, Wu, C. B. A Novel Method for Producing Mono-biotinylated, Biologically Active Neurotrophic Factors: An Essential Reagent for Single Molecule Study of Axonal Transport. J. Neurosci Meth. 2011, 200, Aguiar, R. S.; Lovsin, N.; Tanuri, A.; Peterlin, B. M. Vpr. A3A Chimera Inhibits HIV Replication. J. Biol Chem. 2008, 283, Campbell, E. M.; Perez, O.; Anderson, J. L.; Hope, T. J. Visualization of a Proteasome-Independent Intermediate during Restriction of HIV-1 by Rhesus TRIM5α. J. Cell Biol. 2008, 180, Todd, C. A.; Greene, K. M.; Yu, X. S; Ozaki, D. A; Gao, H. M; Huang, Y. D; Wang, M.; Li, G.; Brown, R.; Wood, B.; D Souza, M. P.; Gilbert, P.; Montefiori, D. C.; Sarzotti-Kelsoe, M. Development and Implementation of an International Proficiency Testing Program for a Neutralizing Antibody Assay for HIV-1 in TZM-bl cells. J. Immunol. Meth. 2012,375, Wei, X. P; Decker, J. M.; Wang, S. Y; Hui, H. L; Kappes, J. C.; Wu, X. Y; Salazargonzalez, J. F.; Salazar, M. G.; Kilby, J. M.; Saag, M. S.; Komarova, N. L.; Nowak, M. A.; Hahn, B. H.; Kwong, P. D.; Shaw, G. M. Antibody Neutralization and Escape by HIV-1. Nature 2003, 422, Montefiori, D. C. Measuring HIV Neutralization in a Luciferase Reporter Gene Assay. Meth. Mol. Biol. 2009, 485,