Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic
|
|
- Clifton Bryant
- 5 years ago
- Views:
Transcription
1 Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic Scott V. Edwards Department of Organismic and Evolutionary Biology Harvard University Cambridge, MA USA
2 House Finches and Mycoplasma: a strong host-parasite interaction Mycoplasma gallisepticum escaped chickens and invaded House Finches in the eastern U. S., ~ years later, finches are more resistant and recent bacterial strains are attenuated Natural selection (?) on House Finches by disease Higher survival rates found in: Females versus males Smaller versus larger males Bright males versus dull males Can we identify the genes contributing to survival or susceptibility?
3 Multi-pronged approach to a recently established host-parasite interaction 1. Genetic structure of pre-epizootic house finch populations (AFLPs) 2. Large-scale screen for parasite-induced gene expression in house finches 3. Shifts in allele frequency between pre- and post-epizootic house finches 4. Molecular evolution and host range expansion of the Mycoplasma parasite
4 Recent history of House Finch populations historic range ~1870 bottleneck? 1940 ~200 birds
5 Mycoplasma are obligate parasites and have some of the smallest genomes of any non-virus sequenced
6 Mycoplasma-House Finch History -Mycoplasma gallisepticum escaped chickens and invaded House Finches in the eastern U. S., ~ years later, finches are more resistant to the bacterium and recent strains are attenuated -Have finches evolved resistance? Courtesy Cornell Lab of Ornithology
7 Population and phenotypic consequences of 1994 epidemic Males decline after epidemic Increased redness in males and decreased size after epidemic Sex ratio (M/F) Percent change Pre post epidemic July 1995 August 1996 October Redness Wing chord (mm) Bill (mm) Tarsus (mm) Males Tail Lengt h(mm) Weight (g) Wing chord (mm) Bill (mm) Tarsus (mm) Females Weigh t (g) From Nolan, P. M., G.E. Hill and A. M. Stoehr Proc. R. Soc. Lond. B.265:
8 AFLPs: House Finch are moderately structured with little evidence for genetic bottlenecks 163 individuals, 16 populations, 3 primer combinations, 166 polymorphic bands, 61% polymorphic bands Distribution of variation (AMOVA) Among individuals w/in pops. 70.7% 8.1% 21.2% Nucleotide diversity (estimated number of substitutions per 1000 sites) Nucleotide diversity original range introduced range CA CA TX AR CO WAMex. HI MI ME NY OH MD PA AL Can. Among pops. w/in subspecies (native range) Among subspecies (native range) Wang, Z., Hill, G. E., Baker, A. J. & Edwards, S. V. (2003) Evolution 57,
9 Tripartite structure of House Finch populations suggested by assignment test of AFLP data (program STRUCTURE: J. Pritchard et al Genetics 155: ) Western U.S. Hawaii Eastern U. S. Wang, Z., Hill, G. E., Baker, A. J. & Edwards, S. V. (2003) Evolution 57,
10 Suppression subtractive hybridization Experimental cdna, split into two pools A PCR method for differentially amplifying transcripts that differ in expression in two cell populations Often used in plant studies; a useful alternative to microarrays cdnas differentially expressed cdnas cdnas shared between control and tester normalization driver tester 1 tester 2 (control) ligate primers ( ) to two cdna pools hybridization 1 hybridization 2 fill in ends selectively amplify
11 Example macroarray results Probe identical filters with RNA from infected and uninfected birds Distinct hybridizations - differentially expressed genes Common hybridizations -- noise C A identical filters (A + B, C + D) B Reciprocally subtracted probes (A vs. B, C vs. D) D
12 Sequencing suggests change in expression for heat shock and immune system genes Additional upregulated genes Number of sequenced clones Granzyme A Additional downregulated genes Mhc class II Wang et al. (2006) Mol. Ecol. 15,
13 Preliminary network of genes induced by infection infection Mycoplasma Healthy Finch infected finch HSP90 TIM1 Granzyme A Mhc class II, invariant chain chaperone with diverse substrates apoptosis elongation factor 1α mitochondrial degredation COI, COIII, NADH4 Host modulation or parasite subversion of immune response? Wang et al. (2006) Mol. Ecol. 15,
14 Museum specimens permit temporal comparison of genetic diversity pre- and post-epidemic House Finch populations Recently exposed California? Michigan Exposed 1990s present control comparison Unexposed Alabama diachronic comparison late 1980s Royal Ontario Museum (A. J. Baker) Unexposed
15 Mhc class I crystal structure α1 domain [ peptide binding region (PBR) peptide α2 domain β2 microglobulin
16 Both increases and decreases in diversity are predicted by evolution of resistance in house finches Finch with conjunctivitis Mhc class II molecules Healthy Finch homozygote heterozygote Foreign pathogen
17 Little evidence for change in heterozygosity (θ) at an Mhc class II locus between pre- and post-epidemic samples θ Michigan late 1980s Michigan 2000 Alabama 1994 Alabama 2000 California late 1980s California 1999 Hess, C. M., Wang, Z. & Edwards, S. V. (2007) Genetica 129,
18 However, rapid shifts in frequency observed at some peptide-binding codons * MHC class II peptide binding codon Hess, C. M., Wang, Z. & Edwards, S. V. (2007) Genetica 129,
19 The Mycoplasma gallisepticum genome: ~0.99 Mb Papazisi, L., et al. (2003) Microbiology 149,
20 Variation in genome size among House Finch (HF) and Turkey (TK) isolates of Mycoplasma SmaI EagI HF GA 1995 TK GA 1973 HF GA 1995 TK GA kb kb kb kb * 48.5 kb 23.1 kb Courtesy Wendy Smith, unpubl. data
21 Recent host shift of Mycoplasma gallisepticum to house finches (HF) - but how recent? 99% 100% 89% 95% 100% HF-TK clade 64% 0.05 substitutions/site TK GA 1973 CK SC 2000 CK GA 1974 CK GA 1964 CK Vaccine TK NC 1995 HF GA 1995 HF GA 1995 HF AL 2001 TK IN 2000 HF VA 1994 TK IN 2000 TK VA 1996 M. penetrans M. genitalium M. synoviae M. hypopneumoniae Bacillus subtilis TK = turkey CK = chicken HF = House Finch Mycoplasma gallisepticum Maximum likelihood tree, ~5200 bp RpoB and fusa genes Courtesy Wendy Smith, unpubl. data
22 Empirical conclusions Pre-epizootic House Finch structure AFLPs suggest significant but mild population differentiation Parasite - induced gene expression House Finches show up- and down-regulation of key immune system genes upon experimental infection Diachronic allele frequency shifts in house finch populations Little evidence for reductions in diversity but some evidence for allele frequency shifts at key immune system genes Parasite evolution DNA sequence information provides a detailed view of Mycoplasma history
23 Conservation implications A double invasion Range expansions in both hosts and parasites results in novel evolutionary pressures Microbial host range expansion Adaptation of Mycoplasma gallisepticum to a novel host could result in yet further increases in host range in wild birds Implications for infectious disease biology Pathogens can spread across the country in a matter of years A number of unresolved issues in the role of genetic diversity in regulating parasite expansion
24 Acknowledgments MHC evolution Christopher Hess, U. Washington AFLPs, macroarray analysis Zhenshan Wang, U. Washington Kristy Farmer, Geoff Hill, Auburn U. Funding NSF Mycoplasma evolution Wendy Smith & Colin Dale, U. Utah and Auburn U.
Investigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains
Investigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains Name: Claire Ostertag-Hill Mentor: Dr. Ling Jin Bovine herpesvirus Bovine herpesvirus-1 (BHV-1) Pathogen
More informationPrevention of infection 2 : immunisation. How infection influences the host : viruses. Peter
Prevention of infection 2 : immunisation How infection influences the host : viruses Peter Balfe, p.balfe@bham.ac.uk @pbalfeuk Let s have some LO s just for fun 1. Define the Immune response to viruses,
More informationEvolution of influenza
Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal
More informationViral Genetics. BIT 220 Chapter 16
Viral Genetics BIT 220 Chapter 16 Details of the Virus Classified According to a. DNA or RNA b. Enveloped or Non-Enveloped c. Single-stranded or double-stranded Viruses contain only a few genes Reverse
More informationCulex pipiens complex (Diptera:Culicidae) host feeding patterns in Sacramento and Yolo Counties. Matthew Montgomery LTJG MSC USN 2010
Culex pipiens complex (Diptera:Culicidae) host feeding patterns in Sacramento and Yolo Counties Matthew Montgomery LTJG MSC USN 2010 Introduction Significance Background West Nile Virus Cx. pipiens complex
More informationEVOLUTION. Reading. Research in my Lab. Who am I? The Unifying Concept in Biology. Professor Carol Lee. On your Notecards please write the following:
Evolution 410 9/5/18 On your Notecards please write the following: EVOLUTION (1) Name (2) Year (3) Major (4) Courses taken in Biology (4) Career goals (5) Email address (6) Why am I taking this class?
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationOverview: Chapter 19 Viruses: A Borrowed Life
Overview: Chapter 19 Viruses: A Borrowed Life Viruses called bacteriophages can infect and set in motion a genetic takeover of bacteria, such as Escherichia coli Viruses lead a kind of borrowed life between
More informationBasic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction
Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.
More informationUltrastructural Studies on Plasmodium vivax
Characterization of Human Malaria Parasites Ultrastructural Studies on Plasmodium vivax For the first time a detailed ultrastructural study was carried out on P. vivax. Fine structural analysis of growth
More informationthe HLA complex Hanna Mustaniemi,
the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important
More informationIsolation and identification of Mycoplasma gallisepticum in chickensbn from industrial farms in Kerman province
Available online at http://www.ijabbr.com International journal of Advanced Biological and Biomedical Research Volume 2, Issue 1, 2014: 100-104 Isolation and identification of Mycoplasma gallisepticum
More informationMajor Histocompatibility Complex (MHC) and T Cell Receptors
Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC
More informationChapter 19: The Genetics of Viruses and Bacteria
Chapter 19: The Genetics of Viruses and Bacteria What is Microbiology? Microbiology is the science that studies microorganisms = living things that are too small to be seen with the naked eye Microorganisms
More informationMolecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat
Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat Ihab Habib Ghent University Department of Public Health and Food Safety. Contents: Molecular
More informationNew genomic typing method MLST
New genomic typing method MLST Bon KIMURA fingerprinting PFGE DNA multilocus sequence typingmlst alleles PFGE MLST 1990 PCR 1 PCR DNA PFGE 1 PFGE RAPDrandomly amplified polymorphic DNA 3 AFLPAmplified
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationLecture 11. Immunology and disease: parasite antigenic diversity
Lecture 11 Immunology and disease: parasite antigenic diversity RNAi interference video and tutorial (you are responsible for this material, so check it out.) http://www.pbs.org/wgbh/nova/sciencenow/3210/02.html
More informationAvian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences
Avian Influenza Virus H7N9 Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus RNA virus, Orthomyxoviruses Influenza A virus Eight Gene segments
More informationAn Evolutionary Story about HIV
An Evolutionary Story about HIV Charles Goodnight University of Vermont Based on Freeman and Herron Evolutionary Analysis The Aids Epidemic HIV has infected 60 million people. 1/3 have died so far Worst
More informationBio 1M: Evolutionary processes
Bio 1M: Evolutionary processes Evolution by natural selection Is something missing from the story I told last chapter? Heritable variation in traits Selection (i.e., differential reproductive success)
More informationName: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise!
Name: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise! 1. What process brought 2 divergent chlorophylls into the ancestor of the cyanobacteria,
More information7.012 Quiz 3 Answers
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84
More informationMutants and HBV vaccination. Dr. Ulus Salih Akarca Ege University, Izmir, Turkey
Mutants and HBV vaccination Dr. Ulus Salih Akarca Ege University, Izmir, Turkey Geographic Distribution of Chronic HBV Infection 400 million people are carrier of HBV Leading cause of cirrhosis and HCC
More informationTopic 7 - Commonality
II. Organism Topic 7 - Commonality From Viruses to Bacteria to Genetic Engineering Prebiotic Period Refers to before life Early Earth contained little O 2 O 2 prevents complex molecules Complex organic
More information2000 and Beyond: Confronting the Microbe Menace 1999 Holiday Lectures on Science Chapter List
2000 and Beyond: Confronting the Microbe Menace 1999 Holiday Lectures on Science Chapter List Lecture One Microbe Hunters: Tracking Infectious Agents Donald E. Ganem, M.D. 1. Start of Lecture One 2. Introduction
More informationAcute respiratory illness This is a disease that typically affects the airways in the nose and throat (the upper respiratory tract).
Influenza glossary Adapted from the Centers for Disease Control and Prevention, US https://www.cdc.gov/flu/glossary/index.htm and the World Health Organization http://www.wpro.who.int/emerging_diseases/glossary_rev_sept28.pdf?ua=1
More informationCoevolution. Coevolution
Coevolution Fitness is a genotype-by-environment interaction. The environment for one species includes other species For species that interact, they form part of each other s environment As one species
More informationHOST-PARASITE INTERPLAY
HOST-PARASITE INTERPLAY Adriano Casulli EURLP, ISS (Rome, Italy) HOST-PARASITE INTERPLAY WP3 (parasite virulence vs human immunity) (Parasite) Task 3.1: Genotypic characterization Task 3.6: Transcriptome
More informationAP Biology. Viral diseases Polio. Chapter 18. Smallpox. Influenza: 1918 epidemic. Emerging viruses. A sense of size
Hepatitis Viral diseases Polio Chapter 18. Measles Viral Genetics Influenza: 1918 epidemic 30-40 million deaths world-wide Chicken pox Smallpox Eradicated in 1976 vaccinations ceased in 1980 at risk population?
More informationSignificance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationAntigen Presentation to T lymphocytes
Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationSex is determined by genes on sex chromosomes
BREVIA Temperature Sex Reversal Implies Sex Gene Dosage in a Reptile Alexander E. Quinn, 1 * Arthur Georges, 1 Stephen D. Sarre, 1 Fiorenzo Guarino, 1 Tariq Ezaz, 2 Jennifer A. Marshall Graves 2 Sex is
More informationDetermination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection
Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell
More informationPhase of immune response
Antigen and antigen recognition by lymphocytes Antigen presentation to T lymphocytes Sanipa Suradhat Department of Veterinary Microbiology Faculty of Veterinary Science Phase of immune response 1 Phase
More informationAntigen Recognition by T cells
Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells
More informationWhat is influenza virus? 13,000 base RNA genome: 1/ the size of the human genome
What is influenza virus? 13,000 base RNA genome: 1/246153 the size of the human genome CDC Principles of Virology, 4e Neumann et al. Nature. 2009. Influenza virus is one of the most deadly viral pathogens
More informationAnalyzing Evolvability To Anticipate New Pathogens
Analyzing Evolvability To Anticipate New Pathogens Fusing the study of microbial pathogens with evolutionary biology potentially provides a means for predicting emergent pathogens Meghan A. May Scientists
More informationSupplementary Material
Supplementary Material 2 4 6 Single-locus gene screening methods We screened for single nucleotide polymorphisms (SNPs) at 16 candidate immune genes (Table S1) by initially sequencing three captive-bred
More informationNEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar
NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY S. Van Borm, I. Monne, D. King and T. Rosseel 16th International WAVLD symposium, 10th OIE Seminar 07.06.2013 Viral livestock
More informationTwo hierarchies. Genes Chromosomes Organisms Demes Populations Species Clades
Evolution cont d Two hierarchies Genes Chromosomes Organisms Demes Populations Species Clades Molecules Cells Organisms Populations Communities Ecosystems Regional Biotas At its simplest level Evolution
More informationAgricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA
Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA David L. Suarez Southeast Poultry Research Laboratory, Exotic and Emerging Avian Viral Diseases Research
More informationChapter 6- An Introduction to Viruses*
Chapter 6- An Introduction to Viruses* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. 6.1 Overview of Viruses
More information7.014 Problem Set 7 Solutions
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 7.014 Problem Set 7 Solutions Question 1 Part A Antigen binding site Antigen binding site Variable region Light chain Light chain Variable
More informationMina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia
Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia AIDSvaccine conference, 14 th September 2011 IMGT HLA database July 2011 >5000 class
More informationHybridization and Genetic Extinction. Can and do we preserve the genetic integrity of species, and if so, how?
Hybridization and Genetic Extinction Can and do we preserve the genetic integrity of species, and if so, how? Hybridization Hybridization: mating between different species or two genetically distinct populations
More informationRapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea
Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea Third Global Conference of OIE Reference Centres Incheon(Seoul),
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationChapter 18. Viral Genetics. AP Biology
Chapter 18. Viral Genetics 2003-2004 1 A sense of size Comparing eukaryote bacterium virus 2 What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron
More informationRandom Sample. Pages for Preview USF&WS. Mallard with duck plague exhibiting prolapsed penis
Random Sample Mallard with duck plague exhibiting prolapsed penis USF&WS Random Sample Duck plague: Intestinal tract with hemorrhagic annular bands Cornell Duck Lab. Random Sample Digestive tract from
More informationGlobal Catastrophic Biological Risks
Global Catastrophic Biological Risks Working Definition of Global Catastrophic Biological Risks (GCBRs) Events in which biological agents whether naturally emerging or reemerging, deliberately created
More informationPopGen4: Assortative mating
opgen4: Assortative mating Introduction Although random mating is the most important system of mating in many natural populations, non-random mating can also be an important mating system in some populations.
More informationotherwise known as Cytotoxic T lymphocytes (CTLs)
MIT Biology Department 7.012: Introductory Biology - Fall 200 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 5 FRIDAY October 29, 2004
More informationStructure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
More informationMicroevolution: The Forces of Evolutionary Change Part 2. Lecture 23
Microevolution: The Forces of Evolutionary Change Part 2 Lecture 23 Outline Conditions that cause evolutionary change Natural vs artificial selection Nonrandom mating and sexual selection The role of chance
More informationDiagnostic Methods of HBV and HDV infections
Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection
More information7.013 Spring 2005 Problem Set 7
MI Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor yler Jacks, Dr. Claudette Gardel 7.013 Spring 2005 Problem Set 7 FRIDAY May 6th, 2005 Question
More informationDiagnosis of drug resistant TB
Diagnosis of drug resistant TB Megan Murray, MD, ScD Harvard School of Public Health Brigham and Women s Hospital Harvard Medical School Broad Institute Global burden of TB 9 million new cases year 2 million
More informationSequencing-Based Identification of a Novel Coronavirus in Ferrets with Epizootic Catarrhal Enteritis and Development of Molecular Diagnostic Tests
Sequencing-Based Identification of a Novel Coronavirus in Ferrets with Epizootic Catarrhal Enteritis and Development of Molecular Diagnostic Tests A. Wise, Matti Kiupel,, C. Isenhour, R. Maes Coronaviruses
More informationDiagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens
LA PREPARAZIONE E LA RISPOSTA ALLE EMERGENZE INFETTIVE Padova, 20 settembre 2012 Laboratory advanced technologies in the support of Public Health interventions in infectious disease emergencies Prof. Giorgio
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationGeneral information. Cell mediated immunity. 455 LSA, Tuesday 11 to noon. Anytime after class.
General information Cell mediated immunity 455 LSA, Tuesday 11 to noon Anytime after class T-cell precursors Thymus Naive T-cells (CD8 or CD4) email: lcoscoy@berkeley.edu edu Use MCB150 as subject line
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationAvian Disease & Oncology Lab (ADOL) Research Update. John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang USDA-ARS-USPNRC
Avian Disease & Oncology Lab (ADOL) Research Update John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang USDA-ARS-USPNRC Research Programs at ADOL 1) Genomics (Cheng, Zhang, Vacant SY) Title: Employing
More informationWhat can pathogen phylogenetics tell us about cross-species transmission?
The Boyd Orr Centre for Population and Ecosystem Health What can pathogen phylogenetics tell us about cross-species transmission? Roman Biek! Bovine TB workshop 3 Sep 2015 Talk outline Genetic tracking
More information6/7/17. Immune cells. Co-evolution of innate and adaptive immunity. Importance of NK cells. Cells of innate(?) immune response
Immune cells Co-evolution of innate and adaptive immunity 1 2 Importance of NK cells Cells of innate(?) immune response Patients with NK cell deficiency may lead to fatal infections and have an increased
More informationعلم األحياء الدقيقة Microbiology Introduction to Virology & Immunology
علم األحياء الدقيقة Microbiology Introduction to Virology & Immunology What is a virus? Viruses may be defined as acellular organisms whose genomes consist of nucleic acid (DNA or RNA), and which obligatory
More informationCharacterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
More informationThe roadmap. Why do we need mathematical models in infectious diseases. Impact of vaccination: direct and indirect effects
Mathematical Models in Infectious Diseases Epidemiology and Semi-Algebraic Methods Why do we need mathematical models in infectious diseases Why do we need mathematical models in infectious diseases Why
More informationGenetic diversity in the fungal pathogen Dothistroma septosporum. Angie Dale Masters of Science, NRES Supervisor: Kathy Lewis
Genetic diversity in the fungal pathogen Dothistroma septosporum Angie Dale Masters of Science, NRES Supervisor: Kathy Lewis 1 Outline Introduction Research Questions Methods Results to date Implications
More informationSignificance of the MHC
CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationLESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic
DEFINITIONS OF TERMS Gene a particular sequence of DNA or RNA that contains information for the synthesis of a protien or RNA molecule. For a complete list of defined terms, see the Glossary. LESSON 4.5
More informationExploring the Importance of Single Nucleotide Polymorphisms of HSPA9 in DNA of Sarcoma Patients
University of New Hampshire University of New Hampshire Scholars' Repository Honors Theses and Capstones Student Scholarship Summer 2013 Exploring the Importance of Single Nucleotide Polymorphisms of HSPA9
More information2018 Perinatal Hepatitis B Summit. Eva Hansson, RN, MSN Perinatal Hepatitis B Prevention Coordinator
2018 Perinatal Hepatitis B Summit Eva Hansson, RN, MSN Perinatal Hepatitis B Prevention Coordinator Overview of Summit Summary of perinatal Hepatitis B in the US & Texas ACIP Hepatitis B Prevention recommendations
More informationCh. 23 The Evolution of Populations
Ch. 23 The Evolution of Populations 1 Essential question: Do populations evolve? 2 Mutation and Sexual reproduction produce genetic variation that makes evolution possible What is the smallest unit of
More informationIMMUNOLOGY. Elementary Knowledge of Major Histocompatibility Complex and HLA Typing
IMMUNOLOGY Elementary Knowledge of Major Histocompatibility Complex and HLA Typing Tapasya Srivastava and Subrata Sinha Department of Biochemistry All India Institute of Medical Sciences New Delhi - 110029
More informationResearch Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD)
Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD) John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang, Taejoong Kim, Stephen Spatz, Qingzhong Yu USDA-ARS-USPNRC
More informationThe Distribution of Human Differences. If all this genetic variation is so recent and continuous, why do we think of it in categorical terms?
Expansion Routes of Homo sapiens ~40-25,000 b.p. The Distribution of Human Differences ~120-100,000 b.p. ~50-40,000 b.p. ~20-15,000 b.p. - - - Coastal Route Circa 10-3,500 b.p. If all this genetic variation
More informationFunky Leaf Spot, Viruses, and Xylella Update Winter Phillip M. Brannen University of Georgia Plant Pathology Department
Funky Leaf Spot, Viruses, and Xylella Update Winter 2011 Phillip M. Brannen University of Georgia Plant Pathology Department Background: Systemic Blueberry Diseases At least nine species of plant viruses
More informationProf. Ibtesam Kamel Afifi Professor of Medical Microbiology & Immunology
By Prof. Ibtesam Kamel Afifi Professor of Medical Microbiology & Immunology Lecture objectives: At the end of the lecture you should be able to: Enumerate features that characterize acquired immune response
More informationLecture 19 Evolution and human health
Lecture 19 Evolution and human health The evolution of flu viruses The evolution of flu viruses Google Flu Trends data US data Check out: http://www.google.org/flutrends/ The evolution of flu viruses the
More informationChapter 6. Antigen Presentation to T lymphocytes
Chapter 6 Antigen Presentation to T lymphocytes Generation of T-cell Receptor Ligands T cells only recognize Ags displayed on cell surfaces These Ags may be derived from pathogens that replicate within
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationT cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
More informationLecture 2: Virology. I. Background
Lecture 2: Virology I. Background A. Properties 1. Simple biological systems a. Aggregates of nucleic acids and protein 2. Non-living a. Cannot reproduce or carry out metabolic activities outside of a
More informationHLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.
www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website
More informationNeutrophils Macrophages CD4+ T-cells CD8+ T-cells B-cells None
Question 3 a) Cells present antigens on MHC I and MHC II molecules. The following table lists several different antigen types, and two different cell types that will present the antigen. For each box,
More informationOutline. How archaics shaped the modern immune system. The immune system. Innate immune system. Adaptive immune system
Outline How archaics shaped the modern immune system Alan R. Rogers February 14, 2018 Why the immune system is sensitive to archaic introgression. Archaic MHC alleles The OAS1 innate immunity locus 1 /
More informationRobert B. Colvin, M.D. Department of Pathology Massachusetts General Hospital Harvard Medical School
Harvard-MIT Division of Health Sciences and Technology HST.035: Principle and Practice of Human Pathology Dr. Robert B. Colvin Transplantation: Friendly organs in a hostile environment Robert B. Colvin,
More informationc) Macrophages and B cells present antigens to helper T_-cells. (Fill in blanks.) 2 points
Question 1 You are an immunologist who wants to make the big bucks. You decide to leave the world of science and get a job as a script-consultant on a new medical drama (ER-like) show. You test the writers
More informationSupplementary Figure 1 Weight and body temperature of ferrets inoculated with
Supplementary Figure 1 Weight and body temperature of ferrets inoculated with A/Anhui/1/2013 (H7N9) influenza virus. (a) Body temperature and (b) weight change of ferrets after intranasal inoculation with
More informationCristina Cassetti, Ph.D.
NIAID Extramural Research Update: Recombinant Influenza Viruses and Biosafety Cristina Cassetti, Ph.D. Influenza Program Officer Division of Microbiology and Infectious Diseases NIAID Influenza virus DMID
More informationDeterminants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco
Determinants of Immunogenicity and Tolerance Abul K. Abbas, MD Department of Pathology University of California San Francisco EIP Symposium Feb 2016 Why do some people respond to therapeutic proteins?
More informationRichard Malik Centre for Veterinary Education The University of Sydney
Richard Malik Centre for Veterinary Education The University of Sydney 1 Pathology Update 3/8/2019 Pathology Update 3/8/2019 2 Pathology Update 3/8/2019 3 Pathology Update 3/8/2019 4 Pathology Update 3/8/2019
More informationSuggestions to prevent / control Respiratory Disease Complex in poultry
Suggestions to prevent / control Respiratory Disease Complex in poultry Dr. J. L. Vegad Adviser Phoenix Group 201/15, Gorakhpur, Jabalpur - 482001 Introduction Today, respiratory disease complex has emerged
More informationThe Distribution of Human Differences. If all this genetic variation is so recent and continuous, why do we think of it in categorical terms?
Expansion Routes of Homo sapiens ~40-25,000 b.p. The Distribution of Human Differences ~120-100,000 b.p. ~50-40,000 b.p. ~20-15,000 b.p. - - - Coastal Route Circa 10-3,500 b.p. If all this genetic variation
More informationTolerance vs. Resistance of infectious diseases. Lea Mösch& Hanna Schiff
Tolerance vs. Resistance of infectious diseases Lea Mösch& Hanna Schiff Introduction Definitions: Tolerance: the ability to limit the disease severity induced by a given parasite burden Resistance: the
More informationFluid movement in capillaries. Not all fluid is reclaimed at the venous end of the capillaries; that is the job of the lymphatic system
Capillary exchange Fluid movement in capillaries Not all fluid is reclaimed at the venous end of the capillaries; that is the job of the lymphatic system Lymphatic vessels Lymphatic capillaries permeate
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More information