Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans
|
|
- Ruth Avis Craig
- 6 years ago
- Views:
Transcription
1 Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Emilie Viennois 1*, Yuan Zhao 1, 2, Moon Kwon Han 1, Bo Xiao 1, 3, Mingzhen Zhang 1, Meena Prasad 4, 5, Lixin Wang 1, 4, Didier Merlin 1, 4. 1 Institute for Biomedical Sciences, Center for Diagnostics and Therapeutics, Georgia State University, Atlanta, GA 333, USA. 2 Department of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai, China. 3 Institute for Clean Energy and Advanced Materials, Faculty for Materials and Energy, Southwest University, Chongqing, 4715, China. 4 Veterans Affairs Medical Center, Decatur, GA, USA. 5 Emory University, Department of Medicine, Atlanta, GA, USA *Author for correspondence Tel.: +1 (44) Fax: +1 (44) eviennois@gsu.edu
2 Fig. S1: Spontaneous development of colitis in IL1 -/- mice. A, WT and IL-1 -/- 135-day-old mice were subjected to H & E staining of colon samples. Arrowheads indicate lymphocyte infiltration. B, Lcn-2, which is used as a marker of intestinal inflammation, was monitored from day 4 to day 127 by ELISA (n=6-7). Fig. S2: Heat map and unsupervised hierarchical clustering on the 5 mirnas with highest standard deviations. Total RNAs from serum collected from 3 animals was used for mirna profiling. Clustering was performed on all 3 samples, using the top 5 mirnas with highest standard deviations. The normalized (dcp) values were analyzed. Fig. S3: Number of detected samples and quality control of the high throughput approach. A, Number of mirnas detected per sample (count) and their average amplification threshold (Cp) values in each sample. B, Raw Cp values obtained from the two controls, UniSp6 and UniSp3, which were used to test the assay performance for each sample. C, Hemolysis was assessed using the ratio of mir-451a to mir-23a-3p. Possible erythrocyte microrna contaminations were indicated by a Delta Cq (mir-23a-3p - mir-451a) 5 (orange area). Delta Cq 7 8 or more indicated a high risk of hemolysis (red area). Fig. S4: Assessment of inflammation in various mouse models. The degree of inflammation was assessed in arthritic mice (A), DSS-treated mice (B) and TLR5 -/- mice (C). A, The levels of Lcn-2 were measured in the sera obtained from CAIA mice at D12 (after induction of arthritis) and in the same mice at D2 (before induction of arthritis). Histological scores were displayed (A). B, The levels of Lcn-2 were measured in the feces of WT mice after 7 days (D7) of
3 exposure to 3% DSS in the drinking water, and compared to the levels obtained from the same mice at D. C, The levels of Lcn-2 were measured in the sera of TLR5 -/- mice and corresponding WT controls. Significance was determined using either an unpaired t-test or Mann Whitney test if the concentration values did not follow a normal distribution (B) (*, p<.5; and **, p<.1) and compared to the corresponding non-inflamed control. D, Hemolysis was assessed using the ratio of mir-451a to mir-23a-3p expression levels in sera arthritic and its controls (D12 and D-2 respectively), DSS-treated and water-control (WT-DSS-D7 and WT-D respectively) and TLR5- /- and its corresponding WT controls mice. Possible erythrocyte microrna contaminations were indicated by a Delta Cq (mir-23a-3p - mir-451a) 5 (orange area). Fig. S5: Lcn-2 levels in the sera of various mouse model of inflammation. Lcn-2 levels were measured in the sera of WT, D7 DSS, TLR5 -/-, D28 IL1 -/-, D98 IL1 -/- and arthritic mice. Data were presented as the means +/- S.E.M. (n=5-18). Significance was determined using Kruskal- Wallis followed by a Dunn s multiple comparison post-test (*, p<.5; and **, p<.1). Fig. S6: mirna signature in the context of cage effect and genetic background. PCoA of the euclidean distance matrix of the expression of the nine signature mirnas in sera of WT mice hosted in four different cages (A) or representing two different genetic backgrounds, Bab/C or C57/Bl5 (cage A or cage B) (B). Fig. S7: Effect of Anti-TNFα treatment on IL1-/- mice. A, Colon section were stained by H&E, scale bar=1µm. B, Hemolysis was assessed using the ratio of mir-451a to mir-23a-3p expression levels in sera of D28 IL1-/-, D98 IL1 -/- PBS-treated and day 98 IL1 -/- anti-tnfα-
4 treated mice. Possible erythrocyte microrna contaminations were indicated by a Delta Cq (mir-23a-3p - mir-451a) 5 (orange area). The serum expression levels of let-7d-3p (C) and mmu-mir-21a-5p (D) were compared between D28 IL1 -/- mice, D98 IL1 -/- PBS-treated and day 98 IL1 -/- anti-tnfα-treated mice and expressed as Fold change over Day 28 control. Significance was tested using Kruskal-Wallis followed by a Dunn s multiple comparison posttest. Fig. S8: mirna signature in IBD patients. The expression levels of the 9 deregulated mirnas pertaining to the signature identified in mice were quantified by qpcr in sera of patients with ulcerative colitis (UC) and controls. A, Overall misclassification error rate using from 1 (right) to 9 (left) mirnas of the signature panel. B-C, CRP (B) and Lcn-2 (C) levels were measured by ELISA in the sera of control and ulcerative colitis patients. Data were presented as the means +/- S.E.M. (n=11). Significance was evaluated using either an unpaired t-test (B) or Mann Whitney test when the concentration values did not follow a normal distribution (C).
5 A WT IL1 -/- B Lcn-2 [ng/g feces] IL1-/- WT Age (days) Fig. S1
6 Fig. S2
7 A Number of mirna detected per sample (count) Count Average (detected in all, Cp) average amplification threshold (Cp) B 24 UniSp3 UniSp Raw Cp C dcq (mir-23a - mir-451) Fig. S3
8 A Lcn-2 (ng/ml) ** Clinical score D-2 D12 D-2 D12 B Lcn-2 [ng/g feces] ** Lcn-2 (ng/ml) C * 1 D D7 WT TLR5-/- D 6 dcq (mir-23a - mir-451) Fig. S4
9 Lcn-2 (ng/ml) *** NS ** Fig. S5
10 A PC3 (16%) Cage 1 Cage 3 Cage 2 Cage 4 PC3 (4.7%) PC1 (75%) B PC2 (9.6%) C57/Bl6 (cage A) Balb/C C57/Bl6 (Cage B) PC3 (2%) PC1 (87%) Fig. S6
11 A Anti-TNFα PBS B dcq (mir-23a - mir-451) C Fold change over Day D28 control let-7d-3p D98-PBS D98- Anti-TNFα Fold change over Day 28 D D28 control mir-21a-5p D98-PBS D98- Anti-TNFα Fig. S7
12 A Number of mirna Misclassification error Value of threshold B C CRP (ng/ml) Lcn-2 (ng/ml) Control Ulcerative colitis Control Ulcerative colitis Fig. S8
13 Table S1: Differentially expressed mirnas mirna name p-value Day 3 Day 58 Day 86 Day 144 Day 128 mmu-mir-29b-3p E mmu-mir-122-5p E mmu-mir-335-5p E mmu-mir-148a-3p E mmu-mir-15-5p 1.541E mmu-mir-192-5p E mmu-mir-152-3p E mmu-mir-14-3p E mmu-mir-194-5p E mmu-mir-331-3p E mmu-mir-195a-5p E mmu-mir-14-3p E mmu-mir-146a-5p E mmu-mir-375-3p E mmu-mir-199a-3p E mmu-mir-142-5p E mmu-mir-29a-3p E mmu-mir-125b-5p E mmu-mir-154-5p E mmu-mir-22-5p E mmu-mir-378a-5p E mmu-mir-29c-3p E mmu-mir-99a-5p 8.944E mmu-mir-342-3p E mmu-mir-3d-5p mmu-mir-29a-5p mmu-mir-132-3p mmu-mir-143-3p mmu-mir-423-3p mmu-mir-99b-5p mmu-mir-365-3p mmu-mir-328-3p Table S1
14 Table S2: mirna sequences mirna name mirna sequence 5-3 mmu-mir-29b-3p mmu-mir-122-5p mmu-mir-335-5p mmu-mir-148a-3p mmu-mir-15-5p mmu-mir-192-5p mmu-mir-14-5p mmu-mir-194-5p mmu-mir-195a-5p mmu-mir-14-3p mmu-mir-146a-5p mmu-mir-375-3p mmu-mir-199a-3p mmu-let-7d-3p mmu-mir-21a-5p mmu-mir-23a-3p mmu-mir-451a TAGCACCATTTGAAATCAGTGTT TGGAGTGTGACAATGGTGTTTG TCAAGAGCAATAACGAAAAATGT TCAGTGCACTACAGAACTTTGT TCTCCCAACCCTTGTACCAGTG CTGACCTATGAATTGACAGCC CAGTGGTTTTACCCTATGGTAG TGTAACAGCAACTCCATGTGGA TAGCAGCACAGAAATATTGGC TACCACAGGGTAGAACCACGG TGAGAACTGAATTCCATGGGTT TTTGTTCGTTCGGCTCGCGTGA ACAGTAGTCTGCACATTGGTTA CTATACGACCTGCTGCCTTTCT TAGCTTATCAGACTGATGTTGA ATCACATTGCCAGGGATTTCC AAACCGTTACCATTACTGAGTT Table S2
PepT1 Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential. Expression of mirnas along the Crypt-Villus Axis
PepT Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential Expression of mirnas along the Crypt-Villus Axis Yuchen Zhang,*, Emilie Viennois, Mingzhen Zhang, Bo Xiao, 3, Moon Kwon
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationPaternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
More informationSupplementary Figure 1: Experimental design. DISCOVERY PHASE VALIDATION PHASE (N = 88) (N = 20) Healthy = 20. Healthy = 6. Endometriosis = 33
DISCOVERY PHASE (N = 20) Healthy = 6 Endometriosis = 7 EAOC = 7 Quantitative PCR (mirnas = 1113) a Quantitative PCR Verification of Candidate mirnas (N = 24) VALIDATION PHASE (N = 88) Healthy = 20 Endometriosis
More informationa b c Esophageal eosinophilia
TSLP-elicited basophil responses can mediate the pathogenesis of eosinophilic esophagitis. Mario Noti, Elia D. Tait Wojno, Brian S. Kim, Mark C. Siracusa, Paul R. Giacomin, Meera G. Nair, Alain J. Benitez,
More informationFigure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three
More informationBootstrapped Integrative Hypothesis Test, COPD-Lung Cancer Differentiation, and Joint mirnas Biomarkers
Bootstrapped Integrative Hypothesis Test, COPD-Lung Cancer Differentiation, and Joint mirnas Biomarkers Kai-Ming Jiang 1,2, Bao-Liang Lu 1,2, and Lei Xu 1,2,3(&) 1 Department of Computer Science and Engineering,
More informationIL-12 family members in experimental colitis. Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany
IL-12 family members in experimental colitis Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany IBD - Pathogenesis Genetic Predisposition Bacterial Antigens Activation of
More informationConnective Tissue Response in IBD
Connective Tissue Response in IBD Dr I C Lawrance MB BS, PhD FRACP School of Medicine and Pharmacology, University of Western Australia, Fremantle Hospital Intestinal response to Chronic Inflammation Control
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationA263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
More informationInnate immunity as a therapeutic target in IBD. Elke Cario Division of Gastroenterology & Hepatology University Hospital of Essen Essen, Germany
Innate immunity as a therapeutic target in IBD Elke Cario Division of Gastroenterology & Hepatology University Hospital of Essen Essen, Germany The intestinal mucosa must rapidly recognize luminal pathogens
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationMATERIALS AND METHODS
PHYTOTHERAPY RESEARCH Phytother. Res. (2013) Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/ptr.4989 SHORT COMMUNICATION A Mineral Extract from red Algae Ameliorates Chronic
More informationAn unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration
An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration Sabrina M. Lehmann, Christina Krüger, Boyoun Park, Katja Derkow, Karen Rosenberger, Jan Baumgart, Thorsten
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
More informationRole of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More informationGPR84, a novel target for the development of therapies for IBD
GPR84, a novel target for the development of therapies for IBD Sonia Dupont 1, Frédéric Labéguère 1, Roland Blanqué 1, Steve de Vos 2, Philippe Clément- Lacroix 1, Isabelle Parent 1, Corinne Saccomani
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The manuscript by Sun et al., provide data showing that short-chain fatty acids produced by intestinal microbiota act through GPR43 to induced
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation
More informationTRPM8 in the negative regulation of TNFα expression during cold stress
in the negative regulation of TNFα expression during cold stress Xin-Pei Wang 1, Xuan Yu 1, Xiao-Jin Yan 1, Fan Lei 2, Yu-Shuang Chai 1, Jing-Fei Jiang 1, Zhi- Yi Yuan 1, Dong-Ming Xing 1, Li-Jun Du 1*
More informationankylosing spondylitis Department of Clinical Immunology, Xijing Hospital, The Fourth Military
Functional defects in CD4 + CD25 high FoxP3 + regulatory cells in ankylosing spondylitis Huifang Guo 1, 2, 3, Ming Zheng 1, 2, 3, Kui Zhang 1, 3, Fengfan Yang 1, 3, Xin Zhang 1, 3, Qing Han 1, 3, Zhi-Nan
More informationand follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
More informationIdentification of mirna differentially expressed in macrophages exposed to Porphyromonas gingivalis infection
Boston University OpenBU http://open.bu.edu Graduate Research Symposium Graduate Research Symposium 216 216-4-1 Identification of mirna differentially expressed in macrophages exposed to Porphyromonas
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationMicro-RNAs as regulators and possible diagnostic bio-markers in inflammatory bowel disease
Journal of Crohn's and Colitis (2011) 5, 520 524 available at www.sciencedirect.com REVIEW ARTICLE Micro-RNAs as regulators and possible diagnostic bio-markers in inflammatory bowel disease Paraskevi Archanioti
More informationIMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, psoriasis
IMO-8400, a novel TLR7, TLR8 and TLR9 antagonist, inhibits disease development in mouse models of psoriasis Weiwen e Ja Jiang, Fu-Gang Zhu, Dong Yu, Ekambar R. Kandimalla, a a, Nicola La Monica, and Sudhir
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationSipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the
Supplementary information, Data S1 Materials and Methods Mice, Ad vectors and reagents Female C57BL/6 mice, 8-10 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co. (Shanghai,
More informationM2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination
Supplemental Information Title: M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Authors: Veronique E. Miron, Amanda Boyd, Jing-Wei Zhao, Tracy J. Yuen, Julia M.
More informationSupplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationDietary Zinc Alters the Microbiota and Decreases Resistance to Clostridium difficile Infection
1 Dietary Zinc Alters the Microbiota and Decreases Resistance to Clostridium difficile Infection 2 3 4 5 Joseph P. Zackular 1, Jessica L. Moore 2,3, Ashley T. Jordan 1, Lillian J. Juttukonda 1, Michael
More informationWhat Have We Learned About the Microbiome in Pediatric IBD?
What Have We Learned About the Microbiome in Pediatric IBD? Ted Denson, MD Cincinnati Children s Hospital Medical Center and the University of Cincinnati College of Medicine Disclosures: NIH, CCF, AbbVie
More informationSupplemental Data. Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in. Hermansky-Pudlak Syndrome
Page 1 Supplemental Data Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in Hermansky-Pudlak Syndrome Lisa R. Young, Peter M. Gulleman, Chelsi W. Short, Harikrishna Tanjore,
More informationNKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies Saul Kivimäe Senior Scientist, Research Biology Nektar Therapeutics NK Cell-Based Cancer Immunotherapy, September 26-27,
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationCOPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationSupplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs.
Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. (a) CNA analysis of expression microarray data obtained from 15 tumors in the SV40Tag
More informationAggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationSupplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
More informationCombined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer
Supplementary Information Combined Rho-kinase inhibition and immunogenic cell death triggers and propagates immunity against cancer Gi-Hoon Nam, Eun-Jung Lee, Yoon Kyoung Kim, Yeonsun Hong, Yoonjeong Choi,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationTumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages
Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.
More informationSUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Clinical perspective It was recently discovered that small RNAs, called micrornas, circulate freely and stably in human plasma. This finding has sparked interest in the potential
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationSUPPLEMENTARY APPENDIX
SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature
More informationBiodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
More informationA two-microrna signature in urinary exosomes for diagnosis of prostate cancer
Poster # B4 A two-microrna signature in urinary exosomes for diagnosis of prostate cancer Anne Karin Ildor Rasmussen 1, Peter Mouritzen 1, Karina Dalsgaard Sørensen 3, Thorarinn Blondal 1, Jörg Krummheuer
More informationClinical Study Correlation of Plasma MMP-1 and TIMP-1 Levels and the Colonic Mucosa Expressions in Patients with Ulcerative Colitis
Mediators of Inflammation Volume 2009, Article ID 275072, 5 pages doi:10.1155/2009/275072 Clinical Study Correlation of Plasma MMP-1 and TIMP-1 Levels and the Colonic Mucosa Expressions in Patients with
More informationHistological and immunological characteristics of colitis associated with anti-ctla 4 antibody therapy
Histological and immunological characteristics of colitis associated with anti-ctla 4 antibody therapy M. Perdiki 2, G. Bamias 1, D. Pouloudi 2, H. Gogas 3, I. Delladetsima 2 1 Academic Dpt. of Gastroenterology,
More informationMinimally invasive screening for colitis using attenuated total internal reflectance fourier transform infrared spectroscopy
J. Biophotonics 1 8 (2016) / DOI 10.1002/jbio.201600041 FULL ARTICLE Minimally invasive screening for colitis using attenuated total internal reflectance fourier transform infrared spectroscopy Jitto Titus
More informationSupplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationSupplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
More informationA20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool
More informationNKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationNature Medicine doi: /nm.3957
Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationDietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome
Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome Benoit Chassaing, Georgia State University Omry Koren, Bar Ilan University Julia Goodrich, Cornell University
More informationGut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Gut Reaction Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Ley, R. et al (2005) PNAS vol. 102 no. 31 Bacterial diversity in the distal gut (ceca) of C57BL6 mice. (A) Phylogenetic tree of
More informationSupplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More informationSupplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
More informationMicroRNA-182 is induced by IL-2 and promotes clonal expansion of
1 Supplemental Material 2 3 4 MicroRNA-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes 5 6 7 8 9 10 11 12 Anna-Barbara Stittrich 1, Claudia Haftmann 1, Evridiki Sgouroudis
More informationEosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSupplementary Material
Supplementary Material Identification of mir-187 and mir-182 as biomarkers for early diagnosis and prognosis in prostate cancer patients treated with radical prostatectomy Irene Casanova-Salas 1, José
More informationMonitoring of the patients treated by Anti-TNFα : a step towards the personalized medicine.
10 th World Congress on Inflammation Paris (France) Satellite Symposium June 27 th 2011 Monitoring of the patients treated by Anti-TNFα : a step towards the personalized medicine. 1 Introduction Pr. Xavier
More informationSantulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More information?Who binds to it. ? Who binds these inflammatory proteins RAGE SUGAR-FREE GLYCOBIOLOGY INFLAMMATION. BASIC SCIENCE?sugar chain structure
SUGAR-FREE GLYCOBIOLOGY BASIC SCIENCE?sugar chain structure Unusual Sugar Chain It -- is a carboxylate Make lots of It Make an It antibody Inflammatory proteins?who binds to it? Who binds these inflammatory
More informationInnate immune regulation of T-helper (Th) cell homeostasis in the intestine
Innate immune regulation of T-helper (Th) cell homeostasis in the intestine Masayuki Fukata, MD, Ph.D. Research Scientist II Division of Gastroenterology, Department of Medicine, F. Widjaja Foundation,
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More information