Ulcerative colitis (UC) and Crohn s disease (CD) are
|
|
- Andrew Pitts
- 6 years ago
- Views:
Transcription
1 GASTROENTEROLOGY 2005;129: Interleukin-13 Is the Key Effector Th2 Cytokine in Ulcerative Colitis That Affects Epithelial Tight Junctions, Apoptosis, and Cell Restitution FRANK HELLER,* PETER FLORIAN, CHRISTIAN BOJARSKI,* JAN RICHTER, MELANIE CHRIST, BERND HILLENBRAND,* JOACHIM MANKERTZ,* ALFRED H. GITTER,, NATALY BÜRGEL,* MICHAEL FROMM, MARTIN ZEITZ,* IVAN FUSS, WARREN STROBER, and JÖRG D. SCHULZKE* *Departments of Gastroenterology and Clinical Physiology, Charité, Campus Benjamin Franklin, Berlin, Germany; Department of Medical Engineering, Jena University of Applied Sciences, Jena, Germany; and Mucosal Immunity Section, Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland Background & Aims: Ulcerative colitis (UC) is characterized by a Th2 immune response with inflammation and epithelial barrier dysfunction. So far, Th2 cytokines have not been shown to directly influence epithelial barrier function. Methods: Lamina propria mononuclear cells (LPMCs) were stimulated and interleukin (IL)-13 was measured by enzyme-linked immunosorbent assay. Functional IL-13 and IL-4 effects were studied on HT- 29/B6 colonic epithelial cells in Ussing chambers and by conductance scanning. Apoptosis was detected by terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick-end labeling assays. IL-13/IL-4 receptors were analyzed by reverse-transcription polymerase chain reaction and immunofluorescence. Western blotting combined with immunofluorescence was used to detect tight junction proteins. Furthermore, restitution velocity was measured. Finally, mucosal biopsy specimens from patients with UC were compared with cultured cells for these features. Results: LPMCs from patients with UC produced large amounts of IL-13 ( pg/ml), much more than from controls or patients with Crohn s disease. IL-13R 1 and IL-4R receptors were present in HT-29/B6 cells and colonic epithelial cells of control patients and patients with UC. IL-13 had a dose-dependent effect on transepithelial resistance of HT-29/B6 monolayers (reduction to 60% 4%), whereas IL-4 had no effect. This was due to an increased number of apoptotic cells (5.6-fold 0.9-fold) and an increased expression of the pore-forming tight junction protein claudin-2 to 295% 37%, both of which contributed equally. Finally, epithelial restitution velocity decreased from to m/h after treatment with IL-13. Parallel changes were observed in human samples, with an increase in claudin-2 expression to 956% 252%. Conclusions: IL-13 was identified as an important effector cytokine in UC that impairs epithelial barrier function by affecting epithelial apoptosis, tight junctions, and restitution velocity. Ulcerative colitis (UC) and Crohn s disease (CD) are chronic inflammatory bowel diseases (IBDs) characterized by an activated mucosal immune system leading to impaired epithelial barrier function and tissue destruction. Current experimental data suggest that the intestinal flora is an important antigenic stimulus. This has been shown in animal models of IBD, where the gut flora is essential for disease induction, and in humans, because antibiotic treatment or diversion of the fecal stream can ameliorate disease activity. 1 Whereas an inflammatory response to these antigens from the lumen is suppressed in healthy individuals, a destructive immune response is initiated in patients with IBD. This immune response is mediated by lymphocytes that can either be of a Th1 or a Th2 phenotype. In CD, the inflammation is clearly a Th1 response because it is associated with high levels of interleukin (IL)-12 and interferon (IFN)- secretion. 2 These cytokines lead to macrophage and granulocyte activation and thus the release of multiple downstream inflammatory cytokines such as tumor necrosis factor (TNF)- and IL-6. The result is a transmural (sometimes granulomatous) inflammation that is not primarily centered on epithelial cells, although collateral damage to the epithelium may occur. Until recently, the inflammation in UC has been difficult to classify using the Th1/Th2 paradigm. Abbreviations used in this paper: EGTA, ethylene glycol-bis( -aminoethyl ether)-n,n,n=,n=-tetraacetic acid; FACS, fluorescence-activator cell sorting; IFN, interferon; IL, interleukin; LDH, lactate dehydrogenase; LPMC, lamina propria mononuclear cell; NF- B, nuclear factor B; NKT cell, natural killer T cell; PCR, polymerase chain reaction; P-STAT-6, phosphorylated STAT-6; R t, transepithelial electrical resistance; TNF, tumor necrosis factor; TUNEL, terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick-end labeling by the American Gastroenterological Association /05/$30.00 doi: /j.gastro
2 August 2005 IL-13 IN ULCERATIVE COLITIS 551 Whereas in patients with UC the secretion of IFN- or IL-12 is not increased and thus the inflammation is clearly not a Th1 response, IL-4 (messenger RNA [mrna] or protein) is also reduced. 2,3 A breakthrough in our understanding of the disease came initially from the study of oxazolone colitis, a murine model of mucosal inflammation that resembles UC and is caused by IL-13 producing natural killer T cells (NKT cells). Based on these observations, we have recently shown that UC is also associated with increased IL-13 production by NKT cells and that the latter cells manifest reactivity to antigens presented by epithelial cells. 4 These immunologic changes may explain the fact that the inflammation in UC is different from that in CD in that it is a relatively superficial process marked by abnormalities of the epithelium. Ulcers ranging in size from microerosions to large defects disrupt the line of epithelial cells. Abscesses can be found in the base of the crypts. Already early in the disease process, the barrier function of the mucosa is severely impaired. 5 This arises from widespread apoptosis of epithelial cells and a decreased complexity of the tight junctions between epithelial cells causing increased paracellular permeability. 6 Here we report findings indicating that most of the functional defects of the mucosa can in fact be traced to direct effects of IL-13 on epithelial cells. This includes epithelial tight junction alterations and stimulation of epithelial apoptosis together with epithelial restitution arrest. Thus, IL-13 emerges as a key effector cytokine in UC acting adversely on various aspects of epithelial cell function that ultimately lead to the severe destructive inflammation seen in patients with UC. Materials and Methods Lamina Propria Mononuclear Cell Cytokine Production Lamina propria mononuclear cells (LPMCs) were isolated from surgical specimens of patients undergoing colectomy as described previously. 2 Six patients had chronic active UC, and 5 patients had CD; 4 patients without intestinal inflammation with colonic adenocarcinoma served as noninflammatory controls. The institutional review boards approved the collection of surgical specimens. Because repetitive culture of cells from the same surgical specimen showed almost identical cytokine production, we used each specimen only once for LPMC stimulation experiments and each measurement was obtained from another specimen. Freshly isolated LPMCs were cultured and stimulated in vitro with soluble antibodies to CD2 and CD28. IL-13, IL-4, and IFN- were measured by enzyme-linked immunosorbent assay (R&D Systems, Minneapolis, MN; Pierce Chemical Co, Rockford, IL; and BD PharMingen, New York, NY) in culture supernatants collected 48 hours after stimulation as described previously. 4 Detection of IL-13 Receptors and Claudin-2 mrna IL-13R 1, IL-13R 2, and IL-4R were detected by reverse-transcription polymerase chain reaction (PCR) and immunofluorescence. Claudin-2 mrna was quantified by realtime PCR. RNA was isolated from IL-13 treated (48 hours; 10 ng/ml) or control cultures of HT-29/B6 cells with RNAzol B (Wak-Chemie Medical GmbH, Steinbach, Germany) according to the manufacturer s protocol. After reverse transcription of 1.5 g total RNA for real-time PCR or 2 g total RNA for receptor PCR (Omniscript RT Kit; Qiagen, Hilden, Germany) (60 minutes at 37 C, 5 minutes at 93 C), IL-13 or IL-4 receptor complementary DNA (cdna) was amplified (35 cycles of 45 seconds at 95 C, 60 seconds at 60 C, and 60 seconds at 68 C) with the following primer pairs: hil13r 1FOR ggagccagctcaatttgtag, hil13r 1REV cacacgggaagttaaaggca, hil13r 2FOR ggagagaggcaatatcaagg, hil13r 2REV ggccatgactggaaactgt, hil4rfor gacctggagcaacccgtatc, and hil4rrev catagcacaacaggcagacg. The amplified products were verified by agarose gel electrophoresis and showed single bands of predicted sizes for each sample and no products in negative controls. In biopsy samples from patients with UC or noninflammatory controls, IL13R 1 and IL4R (both with antibodies from R&D Systems, Minneapolis, MN) were detected by immunofluorescence according to the protocol listed in the following text. cdna prepared from untreated or IL-13 treated HT-29/B6 cells as described previously was amplified with claudin-2 specific primers: CLDN2F gaatcccgagccaaagacagagtg and CLDN2B tcagggagaacagggaagaaataa. Quantitative LightCycler-PCR was performed using the FastStart DNA Master SYBR Green I Kit according to the manufacturer s instructions (Roche, Mannheim, Germany). The final MgCl 2 concentration was 3 mmol/l. Each sample contained 3 L cdna preparation. The reaction mixture was denatured for 10 minutes at 95 C and subjected to 40 cycles in a 3-step PCR (95 C for 15 seconds, 60 C for 5 seconds, and 72 C for 10 seconds). Detection of fluorescence occurred at the end of the 72 C elongation step. Specificity of PCR products was verified by melting curve analysis subsequent to the amplification. Amplification, data acquisition, and analysis were performed by LightCycler (Roche). Standardization was performed with a standard dilution of a pcr2.1-topo vector construct (Invitrogen, Karlsruhe, Germany) containing the 199 base pair amplicon generated by the primer pair CLDN2F and CLDN2B. Claudin-2 mrna copies were expressed per nanograms total RNA. Cell Culture of HT-29/B6 Cells HT-29/B6 cells represent a subclone of the human colorectal cancer cell line HT-29, which grow as highly differentiated polarized epithelial monolayers. 7 The cells were routinely cultured in 25-cm 2 culture flasks (Nunc, Wiesbaden, Germany). The culture medium contained RPMI 1640, 2%
3 552 HELLER ET AL GASTROENTEROLOGY Vol. 129, No. 2 L-glutamine, and 10% fetal calf serum (all from Biochrom, Berlin, Germany), and the ph was 7.4 in all experiments. Cultures were incubated at 37 C in a 95% air/5% CO 2 atmosphere. Cells were seeded on Millicell PCF filters (Millipore, Schwalbach, Germany; effective membrane area, 0.6 cm 2 )atan average concentration of cells/cm 2. Three inserts were placed together into one conventional culture dish (OD, 60 mm). Confluence of polarized monolayers was reached after 7 days. Experiments were performed on day 7 or 8, giving transepithelial resistances (R t ) of cm 2. The apical compartment was routinely filled with 600 L culture medium, and the basolateral compartment contained 10 ml. Cytokines (TNF-, TEBU, Offenbach, Germany; IL-4 and IL-13, R&D Systems, Wiesbaden, Germany) were added hours before an experiment to cultures to the basolateral compartment at 10 ng/ml IL-13 unless stated otherwise. The IL-13 receptor type I was blocked with 100 ng/ml of anti IL-4R antibodies (R&D Systems, Wiesbaden, Germany). Monitoring of R t R t of the monolayers was measured by a modification of the method described by Kreusel et al. 7 Electrical measurements were performed in the culture dishes by 2 fixed pairs of electrodes (World Precision Instruments, Sarasota, FL). R t was calculated from the voltage deflections caused by an external 10- A, 21-Hz rectangular current. Depth of immersion and position of the filters were standardized mechanically. The temperature was maintained at 37 C during the measurements. Resistance values were corrected for the resistance of the empty filter and the bathing solution. Flux Measurements For flux experiments, filters were incubated with 10 ng/ml IL-13 for 48 hours. The complete inserts were mounted into modified Ussing chambers, which were driven by a 6-channel computer-controlled voltage clamp device (CVC 6; Fiebig, Berlin, Germany). Measurements were performed under short-circuit conditions. The resistance of the bathing solution was determined before each experiment and subtracted from the raw data. Flux studies from the mucosal to the serosal side were performed with 3 H-mannitol, 3 H-lactulose, and 3 H-polyethylene glycol (PEG) 4000 (Biotrend, Köln, Germany) as described previously. 8 After equilibration, samples for flux measurements were collected every 15 minutes. Cytotoxicity Assay As a monitor of cell deterioration, lactate dehydrogenase (LDH) release from the cells was measured. The postexperimental LDH content in the supernatant of controls and of IL-13 treated cells was determined. After detergent extraction with 2% Triton X-100 for 30 minutes, the total LDH content of the residual cells was measured. Thereby, the percentage of LDH released into the supernatant could be calculated. Conductance Scanning Conductance scanning was performed as described previously. 9 Confluent monolayers were mounted horizontally in a modified Ussing-type chamber, which gave access to a scanning probe to be positioned close to the apical side of the tissue. The probe consisted of a pair of microelectrodes with tips set apart vertically by m ( z) that were connected to a differential amplifier and an AC bridge system with synchronous demodulation and kept at a distance of 25 m from the epithelial surface. While a constant electric current (sinusoidal AC, 0.1 ma/cm 2, 24 Hz) was passed through the monolayer, the resulting electric field was detected. The current in the probe induced a decrease in voltage across z and thereby the apparent conductivity G A of the probe could be calculated from the scanning signal. The conductivity of the cell culture filter support (22 ms/cm 2 ) was subtracted, and the conductance of apoptotic leaks was computed by spatial integration of G A. Western Blot Analysis Tight junction protein expression was determined by Western blot analysis of membrane extracts as described previously. 10 Briefly, cells or colonic biopsy specimens were homogenized with iced lysate buffer containing 20 mmol/l Tris, ph 7.4, 5 mmol/l MgCl 2, 1 mmol/l EDTA, 0.3 mmol/l ethylene glycol-bis( -aminoethyl ether)-n,n,n=,n=-tetraacetic acid (EGTA), 1 L/mL aprotinin, 16 g/ml benzamidine HCl, 10 g/ml phenanthroline, 10 g/ml leupeptin, 10 g/ml pepstatin, 1 mmol/l phenylmethylsulfonyl fluoride, 210 g/ml sodium fluoride, 2.16 mg/ml -glycerophosphate, 18.5 g/ml NaVO 4, and 1 L/mL trypsin inhibitor (all from Sigma Chemical Co, St Louis, MO). Subsequently, the lysate was passaged through a 26-gauge needle and then centrifuged at 200g for 5 minutes at 4 C. The membrane fraction was then sedimented by centrifugation at 43,000g for 30 minutes at 4 C. Phosphorylated STAT-6 (P-STAT-6) was detected in total cell lysate. HT-29/B6 cells were homogenized with iced lysate buffer containing 10 mmol/l imidazole, ph 6.8, 0.1 mol/l KCl, 0.3 mol/l sucrose, 2 mmol/l MgCl 2,10 mmol/l EGTA, 1 mmol/l NaF, 1 mmol/l MbO 2 4, 1 mmol/l NaVO 3, 0.2% Triton X-100 (vol/vol), and Complete Mini EDTA-Free Protease Inhibitor Cocktail Tablets (Roche, Mannheim, Germany) for 10 minutes at 4 C. After centrifugation (10 minutes, 4 C, 19000g), the protein content of the supernatant was determined. Protein concentrations were determined by bicinchoninic acid assay (Pierce Chemical Co). Aliquots of 2.5 g (for occludin), 5 g (for claudin-1, claudin-2, and claudin-4), or 20 g protein (for P-STAT-6 or biopsy samples) were separated by polyacrylamide gel electrophoresis (8.5% for occludin and STAT-6, 12.5% for claudins) and transferred to a polyvinylidene difluoride transfer membrane (NEN, Boston, MA). Blots were first blocked for 2 hours in 5% milk powder (not for P-STAT-6) and then overnight or for 2 hours (for P-STAT-6) in 5% bovine serum albumin followed by incubation with a primary antibody (Zymed, San
4 August 2005 IL-13 IN ULCERATIVE COLITIS 553 Francisco, CA, or New England Biolabs, Frankfurt am Main, Germany). POD-conjugated secondary antibodies and the chemiluminescence system Lumi-Light PLUS (Roche) were used to detect bound antibodies. Immunohistochemistry Tight junctions were localized by immunofluorescence after 48 hours of incubation with 10 ng/ml IL-13. Nuclear factor B (NF- B) translocation was detected in confluent HT-29/B6 cells after 24 hours of serum-free culture. TNF- (10,000 U/mL) or IL-13 (10 ng/ml) were added for 15 minutes. All samples were washed with phosphate-buffered saline (PBS) and fixed in ice-cold methanol for 10 minutes. Then, cells were washed with PBS and permeabilized with 0.5% Triton X-100 for 5 minutes. The samples were blocked with 0.5% goat serum for 30 minutes at room temperature before addition of the 1:50 diluted primary antibodies for tight junction proteins (Zymed; for monoclonal ZO-1, BD Transduction, Heidelberg, Germany) or 1:100 diluted antibody against the p65 subunit of NF- B (Santa Cruz, Heidelberg, Germany). After 30 minutes of incubation at room temperature and 2 washing steps with PBS 0.5%, goat serum 1:500 diluted secondary antibodies (Alexa Fluor; MoBiTec, Göttingen, Germany) were added for 30 minutes at room temperature. In some samples, nuclei were counterstained with 4=,6- diamidino-2-phenylindole 1:1000. Finally, samples were mounted in ProTaqs MountFluor (Biocyc, Luckenwalde, Germany) and images were taken with a confocal microscope (Zeiss LSM 510 META, Jena, Germany). Epithelial Restitution Assay HT-29/B6 cells were cultured for 7 8 days in regular culture medium and then incubated with IL-13 (10 ng/ml, 48 hours), epidermal growth factor (20 nmol/l), or regular medium (control). A longitudinal defect with a width of 200 m was scraped with a glass microelectrode driven by a computercontrolled micromanipulator. The monolayers were returned to regular cell culture conditions for 2 hours before the cells were fixed and stained for ZO-1. The exact width of the gap was measured in samples without restitution. As a marker of epithelial restitution, the velocity of defect closure was determined in micrometers per hour. Apoptosis Assays Apoptotic cells were stained with terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick-end labeling (TUNEL) assay (Roche) according to the manufacturer s instructions. In one set of experiments, cells were grown on glass slides. After cytokine treatment, the cells were fixed with formaldehyde, stained for TUNEL, and analyzed by microscopy. Samples of IL-13 treated (10 ng/ ml), IFN- treated (100 U/mL), or untreated cells were compared. The apoptotic rate was calculated as percentage of TUNEL-positive cells within total cells. In other experiments, monolayers were brought into single-cell suspensions with trypsin and resuspended at cells/ml in PBS. After fixation with paraformaldehyde, cells were permeabilized with 0.1% Triton X-100 in 0.1% sodium citrate. Then, apoptotic cells were stained with a TUNEL assay according to the manufacturer s instructions. Samples were analyzed by fluorescence-activator cell sorting (FACS) with a FACSCalibur (BD Biosciences, Heidelberg, Germany). The apoptotic rate was calculated as percentage of TUNEL-positive cells within total cells. Apoptosis was inhibited with 2 different caspase inhibitors: Z-VAD-FMK (N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone; Enzyme Systems Products, Livermore, CA) or Z-DEVD- FMK (Z-Asp-Glu-Val-Asp-fluoromethylketone; Alexis Deutschland, Grünberg, Germany). Statistical Analysis All values are given as mean SEM. The unpaired 2-tailed t test was used to determine the significance of differences. P.05 was considered significant. Results LPMCs From Patients With UC Produce IL-13 To quantify cytokine production from inflammatory T cells, LPMCs were isolated from intestinal specimens of patients with UC and respective controls (obtained at surgery) and stimulated in culture with antibodies to CD2 and CD28. After 3 days of stimulation, cytokine release in the supernatant was measured by enzyme-linked immunosorbent assay. Cells from patients with UC produced significantly higher levels of IL-13 ( pg/ml) than cells from patients with CD or noninflammatory controls ( and pg/ml, respectively) (Figure 1A). In contrast, cells from patients with CD produced significantly higher levels of IFN- (26, pg/ml) than cells from patients with UC or controls ( pg/ml and pg/ml, respectively) (Figure 1B). As already shown, 2 LPMCs from all 3 groups did not produce significant levels of IL-4 (data not shown). Because the LPMCs were stimulated with antibodies to CD2 and CD28, unstimulated cells do not produce significant levels of cytokines, and CD2 is only expressed on T cells, this type of stimulation has to be assumed to induce cytokine production specifically by T cells. Both Types of IL-13 Receptors Are Expressed in Colonic Epithelium By reverse-transcription PCR, we found IL- 13R 1 and IL-4R but not IL-13R 2 to be expressed on HT-29/B6 cells (Figure 1C). To identify receptors on epithelial cells, immunofluorescence was used for analysis of colonic biopsy specimens. Both receptors IL-13R 1
5 554 HELLER ET AL GASTROENTEROLOGY Vol. 129, No. 2 Figure 1. (A) IL-13 and (B) IFN- production of LPMCs. LPMCs were isolated from colectomy specimens of noninflammatory controls (NIC), patients with active CD, and patients with UC. T cells were stimulated with soluble antibodies for CD2 and CD28. Cytokines were measured by enzyme-linked immunosorbent assay in culture supernatants collected after 48 hours of culture. Cells did not produce any cytokines without stimulation. (C) IL-13 receptors are expressed on HT-29/B6 cells and epithelial cells in the colon. RNA was isolated from untreated (lanes 1 6) and IL-13 treated (lanes 7 12) HT-29/B6 cells. After reverse transcription, DNA of IL-13R 1 (lanes 1, 4, 7, and 10), IL-13R 2 (lanes 2, 5, 8, and 11), and IL-4R (lanes 3, 6, 9, and 12) was amplified. (D) HT-29/B6 monolayers and colonic biopsy specimens from noninflammatory controls and patients with UC were stained with antibodies for IL-4R (green) and IL-13R 1 (red). and IL-4R were detected on colonic enterocytes of noninflammatory controls and patients with UC (Figure 1D). The expression of these receptors on human epithelial cells has also been shown previously by other groups. 11 IL-13 Impairs the Epithelial Barrier Function of Human Colonic Epithelial Cells To study the effect of increased production of IL-13 on the function of the epithelial barrier, we determined the R t of a monolayer of HT-29/B6 cells after the addition of IL-13 to the basolateral surface of the cells. IL-13 (10 ng/ml) caused a decrease in R t from to cm 2 after 48 hours, corresponding to a decrease to 60% 4% from the initial resistance (P.001, n 9; Figure 2A). In a subgroup of cultures, we extended R t monitoring to 96 hours. At these late time points, R t remained diminished to 51% 3% of the initial resistance (P.001, n 6). This effect of IL-13 on R t was characterized by a sigmoidal curve of dose dependency with a point of inflection at 1 ng/ml (Figure 2B). A significant effect of IL-13 on the barrier function was only observed when IL-13 was added to the basolateral side, whereas apical addition, even at very high concentrations, did not affect R t (80 2% [n 6] at 10 ng/ml IL-13 vs 91 5% in controls [n 6; not significant]). Within the initial 24 hours, 10 ng/ml IL-13 had only a modest effect on R t (76% 2%). In parallel, at 500 U/mL, TNF- induced a decrease in R t to 73% 2% after 24 hours. However, this effect of small amounts of TNF- on R t was considerably intensified by IL-13. When combined with IL-13, TNF- reduced R t to 47%
6 August 2005 IL-13 IN ULCERATIVE COLITIS 555 Figure 2. Effect of IL-13 on R t.(a) Time course of R t after basolateral addition of 10 ng/ml IL-13 and without IL-13. Values are means SEM of 6 9 filters. (B) Dose-response curve 48 hours after basolateral addition of IL-13 (n 6 9; **P.01, ***P.001). (C) R t after addition of IL-13, IL-4, TNF-, or blocking antibodies to IL-4R. (D) IL-13 leads to STAT-6 phosphorylation but not nuclear translocation of NF- B. Western blot of untreated (lanes 1 and 3) and IL-13 treated (lanes 2 and 4) HT-29/B6 cells for phosphorylated STAT-6 at indicated times. Immunofluorescence localization of the p65 subunit of NF- B (red) and nuclei (4=,6-diamidino-2-phenylindole, blue). Only HT-29/B6 cells treated with TNF- but not control or IL-13 treated cells show nuclear translocation of NF- B. 1% of initial resistance (P.0001) (Figure 2C). Finally, we studied the effect of IL-4 on epithelial barrier function. At concentrations of 10 ng/ml or 100 ng/ml, IL-4 did not affect R t of HT-29/B6 monolayers (Figure 2C). Combined with TNF-, IL-4 did not amplify the decrease of R t induced by TNF- but attenuated the effect of TNF- (Figure 2C). Because both types of IL-13 receptors, the heterodimeric IL-4R /IL-13R 1 and the IL-13R 1 monomer, are expressed on colonic epithelial cells (see Discussion), we inhibited signaling with antibodies to the IL-4R chain to elucidate the functional role of the IL-13R 1 monomer. In these experiments, R t was decreased to 58% 1% after the addition of IL-13 compared with 53% 2% when both receptors remained active (Figure 2C). Signaling Pathways of IL-13 Action We performed Western blot analysis of P-STAT-6. As shown in Figure 2D, IL-13 induced the phosphorylation of STAT-6 in colonic HT-29/B6 epithelial cells. While untreated cells did not have detectable levels, P-STAT-6 became detectable after 30 minutes of incubation with IL-13. In contrast, translocation of the p65 subunit of NF- B into the nucleus was only induced with TNF-, not with IL-13 (Figure 2D). Effect of IL-13 on Paracellular Permeability In the next set of studies, we determined if IL-13 alters the transepithelial transport of ions or large molecules (Table 1). Accordingly, the initial short-circuit current of HT-29/B6 cells incubated with or without 10
7 556 HELLER ET AL GASTROENTEROLOGY Vol. 129, No. 2 Table 1. Effect of IL-13 on Mannitol, Lactulose, and PEG4000 Mucosal-to-Serosal Flux, R t, and Short-Circuit Current of HT- 29/B6 Cells J mannitol ms (nmol h 1 cm 2 ) J lactulose ms (nmol h 1 cm 2 ) J PEG4000 ms (nmol h 1 cm 2 ) R t ( cm 2 ) a Short-circuit current ( A cm 2 ) a Control IL P value NS NOTE. Data are means SEM of filters under control conditions and after addition of 10 ng/ml IL-13. J mannitol ms, mannitol mucosal-to-serosal flux (n 4); J lactulose ms, lactulose mucosal-to-serosal flux (control, n 5; IL-13, n 6); J PEG4000 ms, PEG4000 mucosal-to-serosal flux (n 6); NS, not significantly different from controls. a Control, n 15; IL-13, n 16. ng/ml IL-13 was measured. The initial short-circuit current of control and IL-13 treated cells was not different in both groups (9 1 A cm 2 ) and remained constant throughout the experiment. As shown previously, R t was diminished after incubation with IL-13 for 48 hours (control cells, cm 2 ; IL-13 treated cells, cm 2 ; P.001). Because shortcircuit current was not affected by IL-13, the decrease in R t is not due to activation of transporters involved in rheogenic ion transport. In related studies, we determined the paracellular permeability of HT-29/B6 monolayers for molecules of different size by measuring the flux of radioisotopes from the mucosal to the serosal site. We found that the addition of IL-13 increased the mucosal-to-serosal flux of 3 H-mannitol, 3 H-lactulose, and 3 H-PEG4000. This effect of IL-13 was dependent on the size of the respective tracer. While the flux of mannitol (182 daltons) increased 3-fold after incubation with IL-13, the flux of the larger tracers lactulose (344 daltons) and PEG (4000 daltons) increased only 1.4-fold and 1.2-fold, respectively. Necrosis Does Not Contribute to the IL-13 Effect First, HT-29/B6 cell size was not altered by IL-13, because cell count per power field was not significantly changed ( [n 5] in controls vs [n 5; not significant] after IL-13 exposure). We next determined if the observed effects of IL-13 on epithelial cells are secondary to necrosis of cells. For this purpose, we measured LDH released into culture supernatants before and after the addition of Triton X-100, with the latter value representing total cellular LDH. We found that LDH activity in the supernatant was 82 8 U/L in controls (n 6) and 79 1 U/L in IL-13 treated cultures (n 6; not significant), and both groups released the same amount of LDH after addition of Triton X-100 ( and U/L, respectively; not significant). Based on these results, the percentage of LDH released into the supernatants was not significantly different in controls and IL-13 treated cells (2.2% 0.2% vs 2.0% 0.04%; not significant), which indicates that the IL-13 induced decrease in R t was not due to cell necrosis. IL-13 Induces Epithelial Cell Apoptosis Because up-regulation of epithelial cell apoptosis is a typical feature of the changes found in UC, 6 the effect of IL-13 on epithelial apoptosis was investigated in HT- 29/B6 monolayers. In these studies, we determined the apoptotic ratio in control, TNF-, and IL-13 treated cells after 48 hours of incubation with either cytokine. TUNEL staining of adherent cells showed typical changes associated with epithelial apoptosis-like condensation of chromatin, its compaction along the periphery of the nucleus, and segmentation of the nucleus in TUNEL-positive cells. The number of apoptotic cells was determined by manual counting in monolayers and by FACS scanning of single-cell suspensions. We found that control monolayers exhibited a rate of 1.0% 0.5% (n 6) apoptotic cells, whereas in IL-13 treated cultures the rate of apoptotic cells was increased to 5.6% 0.9% (n 6, P.001; Figure 3A). By FACS scanning, the number of apoptotic cells in untreated cultures was (Figure 3B). After incubation with 10 ng/ml IL-13, 11.2% 0.7% stained positive for apoptosis. In comparison, TNF- induced apoptosis in 11.8% 0.6% of cells. Monolayers treated with the combination of IL-13 and TNF- showed 17.2% 0.7% of apoptotic cells. Apoptosis induced by either cytokine could be completely blocked by the addition of Z-VAD-FMK (Figure 3B), which is very important for the interpretation of the relation of apoptotic and tight junctional contributions to the IL-13 induced barrier effect (see below). IL-13 Increases the Conductance of Apoptotic Lesions In epithelial cell layers, apoptosis of single cells occurs spontaneously. Around such lesions, the surrounding
8 August 2005 IL-13 IN ULCERATIVE COLITIS 557 Figure 3. Epithelial cell apoptosis is induced by IL-13. (A) Apoptosis of HT-29/B6 monolayers stained with TUNEL (original magnification 20 ). Condensed chromatin fragments in nuclei and segmentation of the nuclei indicate epithelial cell apoptosis. Apoptotic rate is the percentage of TUNEL-positive cells per total counted cells. (B) HT-29/B6 monolayers were treated with the indicated cytokines and/or Z-VAD-FMK as apoptosis inhibitor. After 48 hours, cells were brought into single-cell suspension and stained with TUNEL. Cell suspensions were then analyzed by FACS. ***P.001. epithelial cells form apoptotic rosettes. The local conductance of individual rosettes was studied by conductance scanning in HT-29/B6 monolayers treated with or without IL-13. In control cultures, the median conductance of spontaneous apoptotic rosettes was ns (n 16) and the maximum conductivity was 360 ns. After IL-13 incubation, the median conductance of the rosettes was increased about 8-fold to ns (n 16; P.002). The minimal conductance was 0 ns, and the maximal conductance was 2830 ns. Only 25% of the analyzed apoptotic rosettes exhibited a conductance 400 ns (Figure 4B). These findings show that in areas of apoptotic cells, the conductance can vary and is significantly increased by IL-13.
9 558 HELLER ET AL GASTROENTEROLOGY Vol. 129, No. 2 Contribution of Epithelial Cell Apoptosis to the Effect of IL-13 To determine whether the previously described effects of IL-13 on the epithelial barrier are primarily due to induction of epithelial cell apoptosis, the caspase inhibitors Z-VAD-FMK and Z-DEVD-FMK were added to cell cultures. We found that both caspase inhibitors partially prevented the decrease in R t induced by IL-13. As shown in Figure 4C, R t decreased to 61% 1% of control values 48 hours after addition of IL-13, whereas R t of cultures treated with IL-13 and Z-VAD-FMK only decreased to 81% 1% (P.001). Z-VAD-FMK alone had no significant effect on R t (95% 2%), indicating that the spontaneous apoptotic rate is low in control cells and does not contribute significantly to overall conductivity under control conditions. A similar inhibiting effect on IL-13 action was also achieved by the second caspase inhibitor, Z-DEVD-FMK. Finally, it should be noted that after inhibition of apoptosis with Z-VAD- FMK or Z-DEVD-FMK, the R t of IL-13 treated cultures was still decreased compared with controls (Figure 4C), indicating that a second mechanism besides apoptosis must contribute to the effect of IL-13 on epithelial barrier function. IL-13 Modifies the Composition of Tight Junctions To determine if the observed IL-13 induced decrease in R t is due to changes in tight junction function, we first performed immunofluorescence studies of tight junction proteins in IL-13 treated and untreated HT- 29/B6 monolayers using antibodies to ZO-1, occludin, and claudin-2. Microscopic analysis revealed that the tight junction network is still intact after IL-13 treatment. Z-scans of the monolayers showed that the tight junction proteins were still located at the level of the tight junctional network, pointing against significant degradation or internalization under the influence of IL-13 (Figure 5). To investigate if changes in tight junction structure contribute to the decrease in epithelial resistance, Western blot analysis of cell membrane fractions was performed for the tight junction proteins claudin-1, claudin-2, and claudin-4 and occludin and their expression quantified by densitometry (Figure 6A). Figure 4. IL-13 causes an increase in conductance of apoptotic leaks. (A) Representative image of a single-cell apoptosis (arrows) in colonic epithelial cells after staining of the tight junction proteins occludin (red) and ZO-1 (green) and merging those 2 images (overlay in yellow). The blue lines in the z-stacks indicate the level of focus for the top image. (B) After identification of the single-cell apoptosis, conductance scanning revealed an increase in conductance of single apoptosis after IL-13 incubation. In control specimens, median conductance was 100 ns (white columns) and after IL-13 incubation was 630 ns (gray columns). (C) Z-VAD-FMK or Z- DEVD-FMK can inhibit the effect of IL-13 only partially. HT29/B6 cells were incubated with or without IL-13 and the apoptosis inhibitors Z-VAD- FMK or Z-DEVD-FMK. The decrease of R t after IL-13 incubation is significantly ameliorated (**P.001) but not completely prevented.
10 August 2005 IL-13 IN ULCERATIVE COLITIS 559 Figure 5. Immunofluorescence localization of the tight junction proteins ZO-1, occludin, and claudin-2 in HT-29/B6 epithelial cells. Under control conditions and after incubation with IL-13 (10 ng/ml) for 48 hours (original magnification 6300 ), some regions of the monolayer slightly leave the focus level of single pictures. Refocusing of these respective regions clearly revealed an intact monolayer at all sites. While occludin (n 5), claudin-1 (n 6), and claudin-4 (n 6) remained unchanged by IL-13, we found that IL-13 induced a 3-fold increase in expression of the pore-forming tight junction protein claudin-2 (295% 37% compared with controls, n 6, P.01). The increased expression of claudin-2 is at least partially a result of increased transcription of the claudin-2 gene, because IL-13 induces a significant increase of claudin-2 mrna as shown by real-time PCR (Figure 6B). The amount of claudin-2 mrna increases in HT- 29/B6 cells after 48 hours of treatment with 10 ng/ml IL-13 from to copies/ng total RNA (n 5, P.001). This increase of claudin-2 expression may represent the mechanism by which R t is decreased by IL-13 besides the induction of apoptosis. As already mentioned, the relative contribution of epithelial apoptosis induction and tight junction alteration caused by IL-13 in HT-29/B6 monolayers was quantified by the blocking effect of the caspase inhibitor Z-VAD-FMK on apoptosis. It turned out that about half of the IL-13 effect was due to the increase in apoptotic rate and the other half to the regulation of tight junctions (Figure 4C). IL-13 Impairs Epithelial Restitution Under physiologic conditions, epithelial cells can close gaps in the epithelium by migration of neighboring cells into the defect. This physiologic repair mechanism was studied under the influence of IL-13. In control cultures, artificially induced lesions with a width of 200 m were closed by cell migration at a velocity of m/h (n 12). IL-13 reduced the velocity of this restitution by 30% to m/h (n 11, P.001; Figure 7). In contrast, as shown previously, 12 epidermal growth factor used as a positive control increased restitution velocity by 82% when compared with controls (data not shown). Claudin-2 Expression Is Increased in UC The previously described effects of IL-13 on cultured cells prompted us to study tight junction proteins in colonic biopsy specimens from patients with UC and controls in a similar manner. Indeed, Western blot analysis of biopsy specimens from patients with UC showed a 10-fold higher expression of claudin-2 (density, 956% 252%; P.01) when compared with controls. Expression of occludin, claudin-1, and claudin-4 was lower than in controls (Figure 8). Discussion UC is associated with an epithelial barrier defect characterized by reduced active absorption and increased mucosal leakiness 13,14 ; these abnormalities, rather than active secretion, are responsible for the diarrhea seen in patients with UC. However, the pathologic mechanisms leading to this barrier defect are still far from clear. One potential factor leading to the observed changes in barrier function is cytokines secreted from lymphocytes infiltrating the lamia propria. In patients with CD, the Th1 cytokines TNF- and IFN- play an important role. 15 However, so far, it remained unclear which cytokines regulate inflammation and induce the significant barrier disturbance in UC. The Th2 marker cytokine IL-4 is not produced in relevant amounts, 2,3 and other cytokines described (eg, IL-5) do not have an effect on epithelial barrier function. We have recently shown that IL-13 plays a central role in an animal model of UC: oxazolone colitis. In this animal model, IL-13 is produced by CD1-reactive NKT cells. 16 Such IL-13 producing NKT cells can also be found in the lamina propria and peripheral blood of patients with acute UC. 4 Therefore, we characterized the role of IL-13 as an effector cytokine that induces the intestinal pathology seen in
11 560 HELLER ET AL GASTROENTEROLOGY Vol. 129, No. 2 Figure 6. Expression of the poreforming tight junction protein claudin-2 is increased by IL-13 in HT-29/B6 cells. (A) Expression of tight junction proteins in crude membrane fractions by Western blotting. Lanes 1 3 represent samples from controls, and lanes 4 6 represent samples from IL- 13 treated cells. Protein expression was quantified by densitometry. The Table shows protein expression after IL-13 incubation in percent of the control. (B) RNA was isolated from control or IL- 13 treated cells. After adjusting RNA concentration and reverse transcription, claudin-2 cdna was quantified by real-time PCR (n 5 each, ***P.001). UC. Because intestinal epithelial cells express CD1d 17,18 and are able to present glycolipid antigens directly to NKT cells, in inflamed mucosa epithelial cells must receive a constant IL-13 signal from NKT cells. Recently, IL-13 has been found to be the key mediator for the development of allergic asthma. 19,20 Similar to our findings in colonic epithelial cells, this was due to a direct effect of IL-13 on bronchial epithelial cells. 21 Although IL-4 is the marker cytokine in Th2 cell responses, 22 biologic activities of IL-4 and IL-13 have been shown to overlap. 23 This is in part due to the use of common receptors. IL-4 binds to IL-4R and can recruit either the common chain (IL-2R c) or the IL-13R 1 into the receptor complex. IL-13, on the other hand, binds to IL-13R 1, and this complex can recruit the IL-4R chain but can act as IL-13 receptor also as a monomer. 24 Both receptors are differentially regulated. IL-13R 1 is down-regulated in activated T cells, ren-
12 August 2005 IL-13 IN ULCERATIVE COLITIS 561 Figure 7. The velocity of epithelial restitution is impaired by IL-13. HT29/B6 cells were treated with 10 ng/ml IL-13 (gray column) and compared with untreated control samples (white column). After scraping of standardized 200- m-wide gaps, the velocity of epithelial restitution was estimated from the time until the gap is completely closed. dering them unresponsive to IL However, many nonhematopoietic (eg, epithelial) cells express IL-13R 1 and thereby are responsive to IL In the present study, both IL-4R and IL-13R 1 were shown to be expressed in HT-29/B6 cells and in human colon epithelium of controls and patients with UC. It had been shown before that human colonic epithelial cell lines express heterodimeric receptors for IL-4 and IL-13 that are composed of the IL-4R and IL-13R 1 chain but not of the c chain of cytokine receptors. 27 The fact that IL-13 can signal through the heterodimeric receptor IL-4R /IL-13R 1 and through the IL-13R 1 monomer can also explain our present finding that the blockade of the heterodimeric form with antibodies resulted only in a slight inhibition of IL-13 signaling in HT-29/B6 cells. To assess the effect of IL-13 on epithelial cell function, we measured the capacity of IL-13 to alter the R t of monolayers of differentiated colonic epithelial cells. We found that compared with other cytokines or mediators, IL-13 has a profound effect on epithelial barrier function. A decrease in resistance developed rapidly within 24 hours and was long lasting and dose dependent. A sig- Figure 8. Expression of claudin-2 is increased in UC. Expression of tight junction proteins in crude membrane fractions of biopsy specimens by immunoblotting. Lanes 1 3 represent samples from noninflammatory controls, and lanes 4 6 represent samples from patients with active UC. Statistical data of densitometric quantification represent protein expression of the samples from 6 to 8 controls and from 5 to 7 patients with UC (in percent of the controls).
13 562 HELLER ET AL GASTROENTEROLOGY Vol. 129, No. 2 nificant effect was only observed when IL-13 was added to the basolateral site of layers. This suggests that IL-13 depends on receptors expressed on the basolateral membrane of enterocytes. Although IL-13 had already a dramatic effect when given alone, it was even enhanced when TNF- was added. This could, for example, be explained by the observation of Lugli et al in endothelial cells that TNF- enhances IL-13 induced STAT-6 activation. 28 In contrast, the other important Th2 cytokine IL-4 had no significant effect on epithelial barrier in HT-29/B6 cell function, stressing the important role of IL-13 as a Th2-effector cytokine. IFN-, a marker cytokine of Th1 responses, also has synergistic effects together with TNF-. Aggarwal and Eessalu have described the induction of TNF receptors by IFN-, although this was not the only mechanism because not only IFN- but also other IFNs acted synergistically with TNF- but only IFN- induced TNF receptor expression. 29 The synergism between IL-13 and TNF- could also explain the response in some patients with UC to treatment with TNF- inhibitors. 30,31 In follow-up of these basic studies of epithelial barrier function, we conducted several additional studies to understand the mechanism of the effect of IL-13 on epithelial cells. We used an LDH release assay to exclude significant cytotoxic effects, and indeed there was no evidence for induction of necrosis by IL-13. IL-13 treated cells did not appear to be different from control cells on light microscopy. Also, immunofluorescence localization of occludin and ZO-1 did not indicate that IL-13 disrupts any part of the cell monolayer, a result that is in accordance with the negative LDH assay. In addition to that, IL-13 did not influence short-circuit current in HT-29/B6 cells. Because the IL-13 effect on resistance was not due to cytotoxicity and not to activation of a rheogenic transport, the IL-13 induced decrease in resistance should be most likely based on an increase in paracellular permeability. To yield further evidence for this hypothesis, mucosal-to-serosal fluxes of 3 H-mannitol, 3 H-lactulose, and 3 H-PEG4000 were measured. Very much indeed, IL-13 increased tracer fluxes of either size, the magnitude of which depended on the molecular size of the respective tracer. Also in support of this concept, the conductance scanning technique identified a higher number of spots with elevated conductivity in HT-29/B6 monolayers after treatment with IL-13. It had been suggested before that epithelial apoptosis contributes to the destruction of the mucosa in UC. 32 To study the effect of IL-13 on the apoptosis of epithelial cells in UC, we quantified the number of apoptotic cells in HT-29/B6 monolayers in IL-13 treated cultures. A dramatic increase was found in response to IL-13. In contrast, the Th1 cytokine IFN- did not significantly affect epithelial apoptosis. Whether epithelial cell apoptosis contributes to the impairment of the intestinal barrier has been controversially discussed. Extrusion of cells from the epithelium is a physiologic event and accompanied by tight junction rearrangement with maintenance of the macromolecular barrier. Therefore, apoptosis of epithelial cells was often assumed to occur without relevant disruption of epithelial integrity. 33 However, recent measurements of ion permeability directly at the site of apoptotic rosettes have clearly shown local leaks of apoptotic sites. 8,34 Accordingly, IL-13 increases the conductance of apoptotic lesions. In support of the latter view, about half of the decrease in R t was blocked if caspase inhibitors were added to HT-29/B6 monolayers before treatment with IL-13. This indicates that apoptosis contributes to approximately 50% of the decrease in R t after treatment with IL-13. However, similar to the effect of IFN- on epithelial cells, 35 this experiment suggested an additional apoptosis-independent pathway contributing to the decrease of R t. Paracellular permeability is regulated by the tight junction network between epithelial cells. To study the effect of IL-13 on this network, we quantified the expression of tight junction proteins under the influence of IL-13. These include occludin and several claudins, products of a multigene family. 36,37 The exact physiologic role of these integral membrane proteins is far from clear. In the family of claudin proteins, a barrier role of claudin-1 38 and claudin-4 39 was suggested by transfection experiments in MDCK cells. In contrast, a permeabilizing or pore-forming property was identified for claudin-2, because transfection resulted in the conversion of MDCK cells from a high-resistance toward a low-resistance, cation-permeable phenotype. 40 It has been shown that cleavage of occludin can induce a barrier breakdown in airway epithelial cells, 41 although other studies seem to indicate that occludin is not a condition sine qua non for barrier formation. 37 Hence, intestinal barrier function was not affected in occludin-deficient mice, 42 a finding that can be explained by functional redundancy of occludin among many other tight junction strand forming proteins. Thus, tight junction strands are composed as heteropolymers of different tight junction proteins that can in part functionally substitute each other. Therefore, we included occludin, claudin-1, and claudin-4 into our analysis as well as claudin-2. IL-13 caused a 3-fold higher expression of claudin-2 in HT-29/B6 cell monolayers, while the expression of the other tight junction proteins remained unchanged. To show a similar change in tight junction protein expression in UC, these proteins were quantified in biopsy specimens from inflamed mucosa of
14 August 2005 IL-13 IN ULCERATIVE COLITIS 563 patients with UC. Indeed, we found a dramatic increase in claudin-2 expression in the tight junction network in UC. As alluded to previously, the increased expression of claudin-2 can lead a tight junction network to become leaky for small cations. 40 Because NKT cells in inflamed mucosa produce IL-13, the increased expression of claudin-2 is most likely induced by IL-13 and contributes significantly to the diarrhea in UC. In inflamed mucosa, the absolute number of epithelial cells is decreased due to the rarefication of crypts in UC. Consequently, tight junctional area per serosal area is decreased. This leads to an underestimation of tight junction protein detection in Western blots on UC mucosa, a phenomenon that is even intensified by the protein pool expansion resulting from the subepithelial inflammatory process. This, however, makes absolute quantification of mucosal proteins very difficult. In a recent study from our laboratory performed on UC specimens at a similar stage of inflammation (Truelove I-II), this dilution artifact was calculated to be 1.63 (obtained from a 1.29-fold decrease in mucosal surface area and a 1.26 increase in submucosal protein pool in UC). 43 Therefore, this dilution artifact may be responsible for the reduction in occludin, claudin-1, and claudin-4 expression observed in UC samples, although an additional effect as, for example, a regulatory influence of TNF- is possible. However, the dramatic increase of claudin-2 expression in these samples has to be assumed to result from a specific up-regulation of expression. In this regard, tight junction protein expression in UC resembles that observed in HT-29/B6 cells exposed to IL-13. In addition to the effect of IL-13 on apoptosis and tight junctions, IL-13 inhibits spreading and migration of epithelial cells after setting standardized lesions in the epithelium. The reduced velocity of restitution can play an important role in the response of an epithelial layer to naturally occurring or pathogen-induced small lesions. While normal epithelial cells can rapidly close such gaps by restitution, this ability is greatly diminished in cells under the influence of IL-13 and could explain the ulcertype lesions found in active UC. Our data indicate that T cells from patients with UC produce large amounts of IL-13, which can induce epithelial apoptosis and facilitate development of erosions and ulcer-type lesions by epithelial restitution arrest. Furthermore, tight junction strands can become more leaky as the result of a claudin-2 up-regulation. A significant barrier dysfunction has indeed been documented during intestinal inflammation in UC. 5 As a consequence of this, barrier disturbance invasion of small antigens or noxious agents is increased and loss of ions and water into the intestinal lumen leads to diarrhea (leak flux diarrhea). Although the role of Th1 cytokines (eg, TNF- ) in respect to intestinal barrier function is well established, the present report is the first to yield direct evidence for such an effector role for the Th2-cytokine IL-13. Because the facilitated antigen uptake in response to IL-13 can provoke additional stimulation of lamina propria cells with the release of more IL-13, a perpetuation of inflammation could be induced. Therefore, neutralization of IL-13 (eg, with therapeutic antibodies) is a potential treatment for patients with active UC that could interrupt tissue destruction by activated immune cells. References 1. Sartor RB. Current concepts of the etiology and pathogenesis of ulcerative colitis and Crohn s disease. Gastroenterol Clin North Am 1995;24: Fuss IJ, Neurath M, Boirivant M, Klein JS, de la Motte C, Strong SA, Fiocchi C, Strober W. Disparate CD4 lamina propria (LP) lymphokine secretion profiles in inflammatory bowel disease. Crohn s disease LP cells manifest increased secretion of IFNgamma, whereas ulcerative colitis LP cells manifest increased secretion of IL-5. J Immunol 1996;157: West GA, Matsuura T, Levine AD, Klein JS, Fiocchi C. Interleukin 4 in inflammatory bowel disease and mucosal immune reactivity. Gastroenterology 1996;110: Fuss IJ, Heller F, Boirivant M, Leon F, Yoshida M, Fichtner-Feigl S, Yang Z, Exley M, Kitani A, Blumberg RS, Mannon P, Strober W. Nonclassical CD1d-restricted NK T cells that produce IL-13 characterize an atypical Th2 response in ulcerative colitis. J Clin Invest 2004;113: Schmitz H, Barmeyer C, Fromm M, Runkel N, Foss HD, Bentzel CJ, Riecken EO, Schulzke JD. Altered tight junction structure contributes to the impaired epithelial barrier function in ulcerative colitis. Gastroenterology 1999;116: Gitter AH, Wullstein F, Fromm M, Schulzke JD. Epithelial barrier defects in ulcerative colitis: characterization and quantification by electrophysiological imaging. Gastroenterology 2001;121: Kreusel KM, Fromm M, Schulzke JD, Hegel U. Cl-secretion in epithelial monolayers of mucus-forming human colon cells (HT- 29/B6). Am J Physiol 1991;261:C574 C Bojarski C, Gitter AH, Bendfeldt K, Mankertz J, Schmitz H, Wagner S, Fromm M, Schulzke JD. Permeability of human HT-29/B6 colonic epithelium as a function of apoptosis. J Physiol 2001; 535: Gitter AH, Bertog M, Schulzke J, Fromm M. Measurement of paracellular epithelial conductivity by conductance scanning. Pflugers Arch 1997;434: Bürgel N, Bojarski C, Mankertz J, Zeitz M, Fromm M, Schulzke JD. Mechanisms of diarrhea in collagenous colitis. Gastroenterology 2002;123: Blanchard C, Durual S, Estienne M, Bouzakri K, Heim MH, Blin N, Cuber JC. IL-4 and IL-13 up-regulate intestinal trefoil factor expression: requirement for STAT6 and de novo protein synthesis. J Immunol 2004;172: Dignass AU, Podolsky DK. Cytokine modulation of intestinal epithelial cell restitution: central role of transforming growth factor beta. Gastroenterology 1993;105: Sandle GI, Higgs N, Crowe P, Marsh MN, Venkatesan S, Peters TJ. Cellular basis for defective electrolyte transport in inflamed human colon. Gastroenterology 1990;99: Fasano A, Baudry B, Pumplin DW, Wasserman SS, Tall BD, Ketley JM, Kaper JB. Vibrio cholerae produces a second enterotoxin,
Therapeutic options to modulate intestinal barrier
15 + 5 min J.D. Schulzke Dept. of General Medicine Therapeutic options to modulate intestinal barrier What makes up epithelial barrier function? ions/h 2 O antigens/bacteria tight junction apoptoses erosions
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationChemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationPREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS
TMM,5-2011 PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS Ice-cold means cooled in ice water. In order to prevent proteolysis, make sure to perform all steps on ice. Pre-cool glass homogenizers, buffers
More informationProcaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
More informationSupplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24
Current Biology, Volume 24 Supplemental Information Autophagy in Oncogenic K-Ras Promotes Basal Extrusion of Epithelial Cells by Degrading S1P Gloria Slattum, Yapeng Gu, Roger Sabbadini, and Jody Rosenblatt
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationInstructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests
3URGXFW,QIRUPDWLRQ Sigma TACS Annexin V Apoptosis Detection Kits Instructions for Use APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests For Research Use Only. Not for use in diagnostic procedures.
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationAnnexin V-PE Apoptosis Detection Kit
Annexin V-PE Apoptosis Detection Kit Catalog Number KA0716 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationWestern Immunoblotting Preparation of Samples:
Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationInfluenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationIntestinal Microbiota in Health and Disease
Intestinal Microbiota in Health and Disease February 27, 2015 Master s Course in Gastroenterology Prof. Kathy McCoy 1 Overview Overview of Gut Microbiota Microbiota in Health Microbiota in Disease 2 Gut
More informationSUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationRayBio Annexin V-FITC Apoptosis Detection Kit
RayBio Annexin V-FITC Apoptosis Detection Kit User Manual Version 1.0 May 25, 2014 (Cat#: 68FT-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
More informationSupplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
More informationRayBio Annexin V-Cy5 Apoptosis Detection Kit
RayBio Annexin V-Cy5 Apoptosis Detection Kit User Manual Version 1.0 Mar 20, 2014 (Cat#: 68C5-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0376 TITLE: Proteolytic Regulation of the Intestinal Epithelial Barrier: Mechanisms and Interventions PRINCIPAL INVESTIGATOR: Toni M. Antalis CONTRACTING ORGANIZATION: University
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationFOCUS SubCell. For the Enrichment of Subcellular Fractions. (Cat. # ) think proteins! think G-Biosciences
169PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name FOCUS SubCell For the Enrichment of Subcellular Fractions (Cat. # 786 260) think
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationTreatment of murine Th1- and Th2-mediated inflammatory bowel disease with NF-κB decoy oligonucleotides
Research article Treatment of murine Th1- and Th2-mediated inflammatory bowel disease with NF-κB decoy oligonucleotides Stefan Fichtner-Feigl, Ivan J. Fuss, Jan C. Preiss, Warren Strober, and Atsushi Kitani
More informationHistological and immunological characteristics of colitis associated with anti-ctla 4 antibody therapy
Histological and immunological characteristics of colitis associated with anti-ctla 4 antibody therapy M. Perdiki 2, G. Bamias 1, D. Pouloudi 2, H. Gogas 3, I. Delladetsima 2 1 Academic Dpt. of Gastroenterology,
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More informationButyrate induces cell apoptosis through activation of JNK MAP kinase pathway in human colon cancer RKO cells.
Chem Biol Interact. 2010 May 14;185(3):174-81. Epub 2010 Mar 25. Butyrate induces cell apoptosis through activation of JNK MAP kinase pathway in human colon cancer RKO cells. Zhang Y, Zhou L, Bao YL, Wu
More informationSUMMARY Coeliac disease is a common food intolerance in Western populations, in which it has a prevalence of about 1%. In early infancy, when the transition is made to a gluten-containing diet (particularly
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationThe epithelial sodium channel (ENaC) is a heteromultimeric
GASTROENTEROLOGY 2007;132:236 248 Butyrate Induces Intestinal Sodium Absorption via Sp3-Mediated Transcriptional Up-Regulation of Epithelial Sodium Channels SEBASTIAN ZEISSIG,*, ANJA FROMM,* JOACHIM MANKERTZ,*
More informationNOTES. Received 24 January 2003/Returned for modification 21 February 2003/Accepted 6 June 2003
INFECTION AND IMMUNITY, Sept. 2003, p. 5355 5359 Vol. 71, No. 9 0019-9567/03/$08.00 0 DOI: 10.1128/IAI.71.9.5355 5359.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. NOTES
More informationCommercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
More informationSupplementary material: Materials and suppliers
Supplementary material: Materials and suppliers Electrophoresis consumables including tris-glycine, acrylamide, SDS buffer and Coomassie Brilliant Blue G-2 dye (CBB) were purchased from Ameresco (Solon,
More information10.00 PBS OVA OVA+isotype antibody 8.00 OVA+anti-HMGB1. PBS Methatroline (mg/ml)
RESEARCH ARTICLE Penh (100% of PBS) 1 PBS 8.00 +anti-hmgb1 6.00 4.00 p=0.054 Cellular & Molecular Immunology advance online publication, PBS 3.12 6.25 Methatroline (mg/ml) Neutrophil isolation and culture
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationGenetics. Environment. You Are Only 10% Human. Pathogenesis of IBD. Advances in the Pathogenesis of IBD: Genetics Leads to Function IBD
Advances in the Pathogenesis of IBD: Genetics Leads to Function Pathogenesis of IBD Environmental Factors Microbes Scott Plevy, MD Associate Professor of Medicine, Microbiology & Immunology UNC School
More informationof an untreated HS-stained BAEC monolayer viewed using a laser confocal microscope; Bar = 10 µm.
Supplemental Figure 1: EC monolayer heparan sulfate fluorescence intensity. (A) Enface perspective of an untreated HS-stained BAEC monolayer viewed using a laser confocal microscope; Bar = 10 µm. (B) Enface
More information12/10/2009. Department of Pathology, Case Western Reserve University. Mucosal Cytokine Network in IBD
Cytokine-Mediated Inflammation in IBD Theresa T. Pizarro Department of Pathology, Case Western Reserve University Mucosal Cytokine Network in IBD Andoh, et al., 2008 1 Interleukin-1 (IL-1) Family Cytokine
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationBIL 256 Cell and Molecular Biology Lab Spring, Tissue-Specific Isoenzymes
BIL 256 Cell and Molecular Biology Lab Spring, 2007 Background Information Tissue-Specific Isoenzymes A. BIOCHEMISTRY The basic pattern of glucose oxidation is outlined in Figure 3-1. Glucose is split
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationFor the rapid, sensitive and accurate measurement of apoptosis in various samples.
ab14082 500X Annexin V-FITC Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples. This product is for research use only and
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationAcute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A.
UvA-DARE (Digital Academic Repository) Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A. Link to publication Citation for published
More informationDifferential responses of human colonic ILCs to gut commensal bacteria altered during HIV infection
Differential responses of human colonic ILCs to gut commensal bacteria altered during HIV infection Moriah J. Castleman, Ph.D. Laboratory of Dr. Cara Wilson University of Colorado Anschutz Medical Campus
More informationSUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
More informationSUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
More informationIndex. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305
Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationExosomes as a. Novel Therapeutic Approach to Gastrointestinal Diseases Rebecca Murray APRN, FNP, CDE
Exosomes as a Novel Therapeutic Approach to Gastrointestinal Diseases Rebecca Murray APRN, FNP, CDE Endocrine Nurse Practitioner Institute for Hormonal Balance Orlando, FL Medical Director Ward-Murray
More informationSupplemental Information. Helicobacter pylori Employs a Unique Basolateral. Type IV Secretion Mechanism for CagA Delivery
Cell Host & Microbe, Volume 22 Supplemental Information Helicobacter pylori Employs a Unique Basolateral Type IV Secretion Mechanism for CagA Delivery Nicole Tegtmeyer, Silja Wessler, Vittorio Necchi,
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSD-1 SD-1: Cathepsin B levels in TNF treated hch
SD-1 SD-1: Cathepsin B levels in TNF treated hch. A. RNA and B. protein extracts from TNF treated and untreated human chondrocytes (hch) were analyzed via qpcr (left) and immunoblot analyses (right) for
More informationTSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationRole of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More informationSupplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
More informationSupplementary table and figures
3D single molecule tracking with multifocal plane microscopy reveals rapid intercellular transferrin transport at epithelial cell barriers Sripad Ram, Dongyoung Kim, Raimund J. Ober and E. Sally Ward Supplementary
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationAnti-ceramide Antibody Prevents the Radiation GI Syndrome in Mice
Anti-ceramide Antibody Prevents the Radiation GI Syndrome in Mice Jimmy A. Rotolo 1, Branka Stancevic 1, Jianjun Zhang 1, Guoqiang Hua 1, John Fuller 1, Xianglei Yin 1, Adriana Haimovitz-Friedman 2, Kisu
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationAssay Name: Transwell migration using DAPI
Assay Name: Transwell migration using DAPI Assay ID: Celigo_04_0001 Table of Contents Experiment: Identification of cells which have migrated through the membrane of a transwell insert....2 Celigo Setup...2
More informationTumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages
Research article Tumor development in murine ulcerative colitis depends on MyD88 signaling of colonic F4/80 + CD11b high Gr1 low macrophages Gabriela Schiechl, 1 Bernhard Bauer, 1 Ivan Fuss, 2 Sven A.
More informationC-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is
' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationMolecular and Cellular Basis of Immune Protection of Mucosal Surfaces
Molecular and Cellular Basis of Immune Protection of Mucosal Surfaces Department of Biologic & Materials Sciences School of Dentistry University of Michigan Ann Arbor, Michigan 48109-1078 1 Image quality
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationAnnexin V-Cy3 Apoptosis Detection Reagent
ab14143 Annexin V-Cy3 Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples This product is for research use only and is not
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationFor the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:
Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC
More informationSipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the
Supplementary information, Data S1 Materials and Methods Mice, Ad vectors and reagents Female C57BL/6 mice, 8-10 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co. (Shanghai,
More informationSupplemental Data Figure S1 Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells.
Supplemental Data Figure S1. Effect of TS2/4 and R6.5 antibodies on the kinetics of CD16.NK-92-mediated specific lysis of SKBR-3 target cells. (A) Specific lysis of IFN-γ-treated SKBR-3 cells in the absence
More informationAnnexin V-FITC Apoptosis Detection Kit
ab14085 Annexin V-FITC Apoptosis Detection Kit Instructions for Use For the rapid, sensitive and accurate measurement of Apoptosis in living cells (adherent and suspension). View kit datasheet: www.abcam.com/ab14085
More informationIntroduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
More informationHEK293 cells transfected with human MATE1, MATE2-K, or vector control were established by
SUPPLEMENTAL DIGITAL CONTENT METHODS In Vitro Metformin Transport Studies Effect of Dolutegravir on Metformin Transport by MATE1 and MATE2-K HEK293 cells transfected with human MATE1, MATE2-K, or vector
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationGut Microbiota and IBD. Vahedi. H M.D Associate Professor of Medicine DDRI
Gut Microbiota and IBD Vahedi. H M.D Associate Professor of Medicine DDRI 1393.3.1 2 GUT MICROBIOTA 100 Trillion Microbes - 10 times more than cells in our body Collective weight of about 1kg in human
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationMedical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
More information