Special Issue on CleanWAS 2015

Transcription

1 Open Life Sci. 2016; 11: Special Issue on CleanWAS 2015 Open Access Yujuan Chen, Yanlu Gao, Muhammad Aqeel Ashraf, Wei Gao* Effects of the Traditional Chinese Medicine on Airway Remodeling in Rats with OVA-induced- Asthma DOI /biol Received February 12, 2016; accepted September 14, 2016 Abstract: The present study focuses on the effects and suggests possible mechanisms of the traditional Chinese medicine as compared to dexamethasone on lower respiratory tract remodeling in rats with asthma. The number of leukocytes and eosinophils in blood from the inferior vena cava and bronchoalveolar lavage fluid (BALF) were counted. Lung tissues underwent hematoxylin and eosin staining. The thickness of the basement membrane and smooth muscle or the airways, and the ratio of inner to outer diameter of the airway wall were measured. Levels of transforming growth factor β1 (TGF-β1), matrix metallopeptidase 9/ tissue inhibitor of metalloproteinase 1 (MMP-9/TIMP-1), urokinase plasminogen activator (upa), plasminogen activator inhibitor 1 (PAI-1), and c-myc(mrna) were evaluated. Results indicate that treatment with decreased the number of eosinophils in blood and BALF, decreased levels of TGF-β1, MMP-9/TIMP-1, upa, PAI-1 and c-myc, and ameliorated the thickening of airway walls, airway basement membrane and airway smooth muscle. Co-treatment with dexamethasone was found to intensity these effects. The cellularity of eosinophils and thickness of the airway basement membrane and smooth muscle were positively correlated with levels of TGF- 1, upa, and c-myc. Treatment with, either alone or in combination with dexamethasone, could inhibit and partly reverse airway remodeling in rats with asthma at an early stage. *Corresponding author: Wei Gao, Department Department of intensive care unit, The Second Hospital of Shandong University, Jinan, , China, yyshjk@163.com Yujuan Chen, Yanlu Gao, The Second Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, , China Muhammad Aqeel Ashraf, Faculty of Science and Natural Resources, University Malaysia Sabah, Kota Kinabalu Sabah, Malaysia; International Water, Air & Soil Conservation Society, Kuala Lumpur, Malaysia Keywords: Airway remodeling,, TGF-β1, MMP-9/ TIMP-1, upa/pai-1, C-Myc. 1 Introduction More recently, the mechanisms of airway remodeling are closely associated with incrassation of the airway wall, extracellular matrix apposition, hypertrophy and hyperplasia of airway smooth muscle cells (ASMCs), incrassation of basement membranes, angiogenesis, and gland enlargement. These conditions cause irreversible luminal narrowing, airway hyper responsiveness and recurrent asthma attacks [1,2]. Traditional Chinese medicine, which has a documented history dating back X-thousand years, has produced several therapies for asthma. This was based on the understanding that the lungs provide gas exchange and connects all vessels, and the heart governs blood flow through the vessels, and together control blood circulation. As asthma patterns involved the lungs, asthma attacks were reasoned to be based on impaired function of lung gas exchange and the circulation of blood through vessels [3]. Many medical experts in ancient Chinese medicine noticed the relation between asthmatic coughs and blood stasis, and it is now known that microcirculation-improving drugs can prevent fibroblasts from synthesizing collagen to cause connective tissue thinning, reduce puffing, and resolve proliferative lesions. Despite a lack of knowledge regarding the exact mechanisms of action, traditional treatments were effective at resolving asthmatic symptoms [4]. One such traditional treatment was based on the use of, a preparation made from the dried body of the earthworm Pheretima aspergillum, and functioned to reduce body temperature and tranquilizing the mind, in addition to its anti-asthmatic and diuretic effects. also has also been shown to exhibit many pharmacological effects, such as decreasing blood 2016 Yujuan Chen et al., published by De Gruyter Open. This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivs 3.0 License.

2 Effects of the Traditional Chinese Medicine on Airway Remodeling in Rats with OVA-induced-Asthma 499 pressure, preventing thrombus formation, and prevent cancer [5]. has also been suggested to inhibit or partly reverse the proliferation of fibrous tissues, and its thrombolytic effects involve plasminogen, lumbrukinase and collagenase [6]. Certain preparations of have been approved for clinical use in China, and are marketed mainly as Guang, is produced in Guangdong and Guangxi provinces. is an anti-inflammatory drug that inhibits the proliferation of eosinophils, and inhibits the proliferation of smooth muscle cells in asthma patients from the early stage by inhibiting histamine and thrombin release, and acts to dissolve collagen-based components in the extracellular matrix [7]. It contains hypoxanthine and succinic acid, and is effective in spasmolysis. It. Animal experiments show that Guang extracted with 90% ethanol can inhibit bronchoconstriction induced by histamine and pilocarpine to increase pulmonary ventilation 3 to 4 times. The microcirculation-improving actions are beneficial in relieving microcirculatory disturbances by increasing oxygen saturation and inhibiting pathological changes caused by chronic asthma. The objective of this study was to examine the effects and possible mechanisms of, alone and in combination with dexamethasone (Dex), on airway remodeling in rats with chronic asthma. 2 Materials and methods 2.1 preparation strips (13 cm) were dried at < 50 C, then cut into short pieces (0.5-2 cm) and crushed. The material was dissolved in saline for 2 h by use of an ultrasonic machine at a low temperature (< 15 C). Then the solution was centrifuged and the sediments were removed. The final solution was 1 g extract per 2.5 ml solution. in treatment groups received medication via intragastric administration every two days. The low, moderate and high doses were 0.018, , and 1.215g/100 g bodyweight, respectively. The Dex dose was 0.05 mg/100 g bodyweight given intraperitoneally. The group treated with both and Dex received g/100 g intraperitoneally and 0.05 mg/100 g Dex intragastrically. Thirty minutes after treatment, all rats except the control group inhaled atomised ovalbumin (OVA) in airtight boxes [8]. OVA was the allergen to induce asthma attack. 2.3 Asthma model and assessment In order to induce asthma, all subjects ( g), except those in the control group, received an intraperitoneal injection of 0.5 ml OVA (1 mg/ml on days 1 and 8, and inhaled atomized OVA (1%) at a flow rate of 3 ml/min from days 15 to 23, 2% from days 25 to 31 and 3% from days 33 to 39. Control rats received an intraperitoneal injection of 0.5 ml saline on days 1 to 8 and inhaled atomized saline from day 15 to day 39 [9]. 2.4 Blood and tissue samples All subjects were euthanized by use of 10% chloral hydrate (0.35 ml/100 mg) after the last OVA inhalation. Blood was drawn from the inferior vena cava after laparotomy, then heart and lungs were excised. Alveoli in the left lung were washed with 2.5 ml saline. Broncho-alveolar lavage fluid (BALF) was stored in EP tubes (1.5 ml) that had been refrigerated with DEPC at -80 C. Portions of the right lung were stored in paraformaldehyde (4%), while other portions were dissected immediately to dissociate the bronchus smooth muscle (Fig. 1). These samples were homogenized, suspended in 1:10 saline in 1.5 ml EP tubes, and stored at a low temperature (-80 C). 2.2 Drug treatment We randomly divided 80 male Sprague-Dawley rats into 7 treatments groups: control (n = 14); asthma (n = 11); low-, medium- and high-dose treatments with (n = 11 each); treatment with Dex (n = 11); and mediumdose combination treatment with and Dex (n = 11). Rats in the control group received an intraperitoneal injection and intragastric administration of 5 ml saline respectively, then inhaled saline vapors for 30 min. Rats Figure 1. Dissociated bronchus sample of a control group.

3 500 Y. Chen, et al. 2.5 Leukocyte and eosinophil counting The number of leukocytes in blood and BALF were counted The absolute number of eosinophils was calculated as as the number of leukocytes the percentage of eosinophils. 2.6 Pathology The ratio of inner to outer diameter of the airway wall, thickness of the airway wall basement membrane, and thickness of the airway smooth muscle of lung tissues were determined by H&E staining of tissue sections, using the BI-2000 medical image analysis system (Chengdu Temo Technology, China). 2.7 Immunohistochemistry Tissues were sectioned into 4 µm segments for hematoxylin and eosin (H&E) staining. Immunohistochemical kits (Wuhan Boster Bio-Engineering, China), provided in June 2009, were used to detect the expression of transforming growth factor ß1 (TGF-ß1),vmatrix metalloproteinase 9 (MMP-9), tissue inhibitor of metalloproteinase 1 (TIMP-1). 2.8 In situ hybridization In situ hybridization kits (Wuhan Boster Bio-Engineering, China) were used to detect the expression of c-myc in lung tissues RT-PCR Expression of c-myc in airway smooth muscle homogenates by was determined by RT-PCR, (MyCycler PCR, USA). Rattus-Myc product length: 374 bp Upper Primer: GTCTCTACTCACCAGCACAATTATG; Lower Primer: TGTTCTCGCCGTTTCCTCAG internal reference (Rattus-Actb) product length: 348 bp Upper Primer: TGTTGTCCCTGTATGCCTCTG Lower Primer: ACCGCTCATTGCCGATAGTG c-myc: 374b p 2.9 ELISA Expression of upa and PAI-1 in airway smooth muscle homogenates were determined using ELISA kits (Shanghai Westang-Bio Science Co., China) Statistical analysis Statistical analysis was performed using SPSS v12.0. Results are presented as mean ± SD. Student t test was used for analysis of continuous, normally distributed variables. P < 0.05 was considered statistically significant. 3 Results Asthma was observed in all OVA-treated subjects, who showed dysphoria, abdominal respiration, shortness of breath, abdominal retraction, prostration and immobility, while the rats in control group didn t show these symptoms. Subjects in the high- and medium-dose, and -Dex treatment groups, showed milder symptoms than those in low-dose treatment group. 3.1 Leukocytes and eosinophils The number of leukocytes and eosinophils in the BALF in asthmatic group was significantly higher than those in controls (P < 0.01). The number of leukocytes in BALF was lower in rats with medium-dose, high-dose, Dex, and and Dex than in rats with asthma (P < 0.01) (Table-1). 3.2 Pathology The airway wall, basement membrane and smooth muscle were thicker in group with asthma than controls. The surface epithelium of the airway shed, and eosinophils and lympholeukocytes infiltrated in the airway wall (Fig. 2). The ratio of inner to outer diameter of the airway wall was greater in rats with high- and medium-dose and Dex than in rats with asthma. The airway smooth muscle and airway wall basement membrane were thinner in rats with medium- and high-dose, Dex, and and Dex than in rats with asthma (Table 2). 3.3 TGF-ß1, MMP9/TIMP-1 expression The area ratio and optical density of the expression of TGF-β1, MMP-9 and TIMP-1 were lower in rats with medium- and high-dose, Dex, and and Dex than in rats with asthma (all P < 0.01) (Table-3).

4 Effects of the Traditional Chinese Medicine on Airway Remodeling in Rats with OVA-induced-Asthma 501 Table 1. Number of leukocytes and eosinophils in inferior vena cava blood and bronchoalveolar fluid (BALF) of rats with asthma and controls and treated rats. Group (n) Blood BALF Leukocytes (109) Eosinophils (109) Leukocytes (109) Eosinophils (109) Control (13) (3.89) 0.37 (0.13) (3.74) 0.12(0.01) Asthma (10) (3.38)ΔΔ 0.59 (0.18)ΔΔ (15.20)ΔΔ 5.23 (2.12) Low dose (10) (3.30)** 0.52 (0.17) (7.58)* 3.78 (0.50)* Medium dose (10) (0.78)** 0.47 (0.10) (14.21)** 3.01 (0.95)** High dose (9) (1.91)** 0.37 (0.07)** (8.77)** 1.97 (0.68)** Dex (9) (4.55) 0.35 (0.08)** (6.24)** 2.26 (0.69)** Medium-dose & Dex (8) (2.85)** 0.30 (0.10)** (6.17)** 1.88 (1.78)** Data are mean (±SD). ΔΔP < 0.01 compared with control; * P < 0.05;** P < 0.01, compared with asthma; P < 0.05; P < 0.01 compared with Dex Table 2. Ratio of inner to outer diameter, thickness of smooth muscle and basement membrane in lung tissue of rats with asthma and treated rats. Group (n) Inner to outer diameter ratio Thickness of smooth muscle Basement membrane thickness Control (13) 0.77 (0.06) 3.70 (0.47) 2.52 (0.49) Asthma (10) 0.60 (0.07)ΔΔ 11.8 (1.44)ΔΔ 3.93 (0.46)ΔΔ Low dose (10) 0.61 (0.06) 9.83 (3.0) (0.44) Medium dose (10) 0.63 (0.10) 6.19 (1.45)** 3.36 (0.42)** High dose (9) 0.68 (0.04)** 5.65 (1.21)** 3.32 (0.6)3** Dex (9) 0.63 (0.08) 6.70 (1.30)** 3.37 (0.75) Medium-dose & Dex (8) 0.69 (0.04)** 5.11 (0.93)** 3.26 (0.60)** Data are mean (SD). ΔΔP < 0.01 compared with control; * P < 0.05;** P < 0.01, compared with asthma; P < 0.05; P < 0.01 compared with Dex Figure 2. Lung tissue pathology (H&E staining, magnification 10 10).

5 502 Y. Chen, et al. 3.4 c-myc Expression The mrna expression of c-myc was stronger in rats with asthma than in those with medium- and high-dose, Dex, and and Dex (P < 0.01). The expression was weakest in rats with and Dex and controls (Fig. 3). In situ hybridization revealed the expression of c-myc mostly in smooth muscle, basal membrane, endothelial cells, and infiltrative inflammatory cells (Fig. 4). The expression of c-myc was lower in rats with medium- and high-dose, Dex, and and Dex than in rats with asthma (P < 0.01) (Table 4). Table 3. Expression of transforming growth factor β1 (TGF-β1), matrix metalloproteinase 9 (MMP-9) and tissue inhibitor of metalloproteinase 1 (TIMP-1) in rats with asthma and treated rats. Group (n) TGF-β1 MMP-9 TIMP-1 Area ratio (%) OD Area ratio (%) OD Area ratio (%) OD Control (13) (4.30) (3.18) (3.75) (1.89) (2.67) (2.10) Asthma (10) 45.5(5.76)ΔΔ 3.3(12.38)ΔΔ 40.2(4.98)ΔΔ 49.1(12.38)ΔΔ (4.71)ΔΔ (8.18)ΔΔ Low dose (10) 39.6 (4.26)** 54.2 (8.75) 33.7 (5.08)** 40.7 (7.21) (4.65) (8.14) Medium dose (10) 33.5 (5.10)** 43.2 (5.47)** 32.6 (3.84)** 38.2 (4.73)** (2.81)** 36.4 (3.89)** High dose (9) (2.75)** (3.42)** (2.71)** (3.22)** (3.43)** (2.46)** Dex (9) (1.86)** (2.96)** (3.16)** (4.95)** (2.64)** (4.35)** Medium-dose & Dex (8) (2.99)* 31.11(2.09)** (5.92)** (4.32)** (4.68)** (2.10)** Data are mean (SD). ΔΔP < 0.01 compared with control; * P < 0.05;** P < 0.01, compared with asthma; P < 0.05; P < 0.01 compared with Dex. Figure 3. RT-PCR analysis of mrna expression of c-myc in airway smooth muscle of rats with asthma and treated rats. Lane 1, asthma; 2, lowdose ; 3, medium-dose ; 4, high-dose ; 5, Dex; 6, medium-dose and Dex; 7, control. Figure 4. Lung tissue pathology (in situ hybridization, magnification 10 40)

6 Effects of the Traditional Chinese Medicine on Airway Remodeling in Rats with OVA-induced-Asthma upa/pai-1 expression The concentration of upa, PAI-1 was lower in rats with medium- and high-dose, Dex, and and Dex than in rats with asthma (both P < 0.01) (Table 5). 4 Discussion (earthworm) is an effective anti-asthma traditional Chinese drug. Its pharmacological actions have been widely investigated in recent years. Here we investigated whether has a role in airway remodeling in asthma. decreased the number of eosinophils in inferior vena cava blood and BALF fluid of rats with asthma. It inhibited the thickened airway wall, as well as airway wall basement membrane and airway smooth muscle in asthmatic rats. Dex could reinforce s effects. decreased the levels of TGF-β1, MMP-9/TIMP-1, upa, PAI-1 and c-myc. The cellularity of eosinophils, thickness of the airway wall basement membrane and airway smooth muscle were positively associated with levels of TGF-ß1, upa, and c-myc. Thus, may have a role in ameliorating airway remodeling in asthma [10]. Airway remodeling of asthma mainly includes loss of airway epithelial cells, extracellular matrix deposition, vascular proliferation, and increased tracheal smooth muscles and secretion. Eosinophils play a significant role during the generation and development of bronchial asthma characterized by allergies and airway inflammation triggered by environmental agents. A growing body of evidence suggests that eosinophils are also important in airway remodeling. Eosinophils can synthesize many tissue remodeling factors, such as TGF-a, TGF-β1, VEGF, and MMP-9. We found that Table 4. Expression of c-myc by in situ hybridization in rats with asthma and treated rats. Group (n) c-myc expression Control (13) (13.43) Asthma (10) (5.90)ΔΔ Low dose (10) (3.53) Medium dose (10) (7.43)** High dose (9) (4.78)** Dex (9) (3.89)** Medium-dose & Dex (8) (7.38)** Data are mean (SD). ΔΔP < 0.01 compared with normal control; * P < 0.05;** P < 0.01, compared with asthma; P < 0.05; P < 0.01 compared with Dex. Table 5. Expression of upa, PAI-1 in airway smooth muscle homogenates in rats with asthma and treated rats. Group (n) upa (ng/l) PAI-1 (ng/l) Control (13) (5.31) 8.91 (3.18) Asthma (10) (9.75)ΔΔ (2.01)ΔΔ Low dose (10) (6.87) (3.73) Medium dose (10) (4.59)** 9.97 (2.58)** High dose (9) (5.54)** 8.17 (2.13)** Dex (9) (4.54)** 9.63 (3.19)** Medium-dose &Dex (8) (3.88)** 8.17 (2.13)** Data are mean (SD). ΔΔP < 0.01 compared with control; * P < 0.05;** P < 0.01, compared with asthma; P < 0.05; P < 0.01 compared with Dex.

7 504 Y. Chen, et al. could decrease the number of eosinophils in the inferior vena cava blood and BALF of rats with asthma. During asthma attacks, the expression of TGF-β1 is strong; the factor participates in abnormal reparation of epithelial tissues after damage, proliferation of myofibroblast and fibrous degeneration of fibrous tissues under the basal membrane. This results in chronic airway inflammation and remodeling. Hoshino et al. found the basement membrane of asthmatic patients thicker than that of healthy controls [11]. Electron microscopy of the basement membrane revealed thickened subepithelial lamina reticularis, which was associated with the number of fibroblasts in the submucosa in asthmatic patients but not controls. Moreover, with chronic inflammation, fibroblast proliferation (likely caused by increased TGF-β1 level) leads to collagen deposition, airway remodeling and aggravated asthma [12]. We found that could decrease the expression of TGF-β1 in our rats with asthma. The imbalance between MMP-9 and TIMP-1 contributes to airway remodeling in bronchial asthma, which can be shown by reorganization of interstitial substances, angiogenesis, and hyperplasia of bronchial smooth muscle. MMPs may be key factors in altering lung extracellular matrix [11]. By digesting components of the ECM, including the basement membrane, MMP-9 leads to airway remodeling [13]. However, increased TIMP-1 expression leads to airway remodeling due to the composition of extracellular matrix components [14]. So the imbalance between MMP-9 and TIMP-1 is a marker of airway remodeling. Here, we found that could alter the expression of MMP-9 and TIMP-1 in rats with asthma. Lumbrukinase in promotes fibrinolysis and is clinically effective against thrombosis. Zhang et al. [15] reported that increased upa and upar may act on matrix degradation in the early fibrotic liver. upar and tpa were associated with overall inhibition of matrix degradation in advanced cirrhotic liver. However, a similar relationship among the expression of PAI-1, upa, upar and airway remodeling has not been reported in experimental rat models of asthma, as in liver cirrhosis. Here, we found that could decrease the expression of upa and PAI-1 in rats with asthma [15]. Myc, the product of protein expression of protooncogene c-myc, may induce the proliferation, growth and differentiation of smooth muscle cells and fibroblasts in airways, an important factor of airway remodeling [16]. C-Myc is the early gene necessary for mrna transcription of some inflammatory factors (endothelial growth factor, TGF-β1, interleukin 4 and 5), and the common final passage during signal transduction. Recent studies confirmed that the induction of c-myc expression can release many cytokines and mediators of inflammation, which stimulate the further release of c-myc and perpetuates airway remodeling. The proliferation of smooth muscle cells and fibroblasts depends on the function of several growth factors, but some cytokines can also promote the expression of c-myc [17]. We found that could decrease the expression of c-myc in rats with asthma. 5 Conclusion This study explored the inhibitive action of on airway remodeling in asthmatic rats and suggested mechanisms by which this may occur. We analyzed basement membrane thickness because airway remodeling from incrassation of the basement membrane is the feature of asthma that distinguishes it from other diseases. inhibited the thickened airway wall, as well as airway wall basement membrane and airway smooth muscle, in asthmatic rats and decreased the levels of TGF-β1, MMP-9/TIMP-1, upa, PAI-1 and c-myc, features of asthma. Thus, may have a role in ameliorating airway remodeling in asthma. Acknowledgements: The Funds for this study were provided by the Shandong Provincial administration of traditional Chinese medicine and the Shandong University of Traditional Chinese Medicine (NO ). Conflict of interest: Authors declared that there is no conflict of interest. References [1] Atkinson J.J., Senior R.M, Matrix metalloproteinase-9 in lung remodeling, Am. J. Respir. Cell Mol. Biol, 2003, 28, [2] Hoshino M., Nakarnura Y., Sim J. J., Expression of growth factors and remodeling of the airway wall in bronchial asthma, Thorax, 1998, 53, [3] Huber H.L., Koessler K.K., The pathololgy of bronchial asthma, Arch. Intern. Med, 1922, 30, [4] Kelly E.A., Jarjour N.N., Role of matrix metalloproteinases in asthma, Curr. Opin. Pulm. Med, 2003, 9, [5] Kohl N.E., Ruley H.E., Role of c myc in the transformation of REF52 cells by viral and cellular oncogenes, Oncogene, 1987, 2, [6] Lin J., Liu B., Study on effects of traditional Chinese anti-asthma medicine on airway in Experimental guinea pig model of allergic asthma, Shanghai J. Trad. Chinese Med, 1996, 19, [7] Liu X.Y., The research on the pharmacological actions of earthworm, Liaoning J. Trad. Chinese Med, 2008, 35, [8] Xu-qiang H., Li D., Gen L., Chun-hui H., Pei-qiong W., Zhi-wei X., Ashraf M.A., Research on the treatment of Pseudomonas

8 Effects of the Traditional Chinese Medicine on Airway Remodeling in Rats with OVA-induced-Asthma 505 aeruginosa pneumonia in children by macrolide antibiotics, Open Med., 2015, 10, [9] Mormex J.F., Martinet Y., Yamauchi K., et al., Spontaneous expression of the sis gene and release PDGF molecule human macrophage, J. Clin. Invest., 1986, 78, [10] Palmansels, Johan C.K., Romain A.P., Prolonged allergen exposure induces structural airway changes in sensitized rats, Am. J. Respir. Crit. Care Med., 2000, 161, [11] Vignola A.M., Riccobono L., Mirabella A., et al., Sputum metalloproteinase-9/tissue inhibitor of metalloproteinase-1 ratio correlates with airflow obstruction in asthma and chronic bronchitis, Am. J. Respir. Crit. Care Med., 1998, 158, [12] Xu F. C., Gao X.Y., Wang W.J., et al., Progress in the study of effective component of medication and nutrition from earthworm, J. South China Agri. Uni., 2001, 22, [13] Zhang H., Luo K., The significance of airway remodeling of asthma and the enlightenment of traditional Chinese anti-asthma medicine. J. Emerg. Trad. Chinese Med., 2000, 9, [14] Zhang L.P., Li R.H., A survey of pharmacological research and clinical application of, Fujian J. Trad. Chinese Med., 1990, 21, [15] Zhang L.P., Takahara T., Yata Y., et al., Increased expression of plasminogen activator and plasminogen activator inhibitor during liver fibrogenesis of rats: role of stellate cells, J. Hepatol., 1999, 31, [16] Hu Y., Dai S., Wang B., Qu W., Ashraf, M.A., Gao J., Application of food-specific IgG antibody detection in allergy dermatosis, Open Med., 2015, 10, [17] Hu Y., Dai S., Wang B., Qu W., Gao J., Ashraf M. A., Analysis of the relations between allergen specific LgG antibody and allergic dermatosis of 14 kinds foods, Open Med., 2015, 10,