Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014
|
|
- Lewis Stevens
- 5 years ago
- Views:
Transcription
1 Issues arising from UKNEQAS schemes Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014
2 2013 schemes There was great variation in the way HGVS nomenclature was applied Scheme would like to promote a universal system and encourages labs to follow HGVS guidelines Marks were deducted when HGVS was not used except for dups/dels and triplet repeat expansions Brackets were a common problem, especially at the protein level, but marks were not deducted Most variation was in reporting of dels/dups
3 Duplications / deletions 5 disease schemes: BRCA, FH, LS, Rett, VHL A minority of labs attempted to use HGVS Up to 6 different versions in one scheme Do not want to insist on HGVS for this reason But if dup/del is described in words, the report must say what is meant by the numbering of the exons
4 Exon numbering GenBank ref seqs do not include reference to exon numbers May have exons missing e.g. BRCA1 NM_ has no exon 4 The report must explain the numbering used The MLPA kit ref no. is not sufficient to indicate the exon number LRG sequences
5 LRG Locus Reference Genomic sequences LRG sequences provide a stable genomic DNA framework for reporting mutations with a permanent ID and core content that never changes. The Scheme has agreed to promote the use of LRGs and will include all published LRGs in future documentation.
6 BRCA1 & 2 scheme Heterozygous deletion of exon 3 in BRCA1 Most labs described it in words Only 6/24 attempted HGVS
7 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature No. of labs BRCA1 ref seq c.81-?_134+?del p.(cys27*) 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U
8 HGVS feedback comments Should not give a protein description without RNA analysis having been performed Should use p.? or put in brackets to indicate it s a prediction
9 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ HGVS feedback comment c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U
10 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ HGVS feedback comment c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U
11 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del HGVS feedback comment c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U
12 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] HGVS feedback comment Incorrect nucleotide description as does not indicate del. c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U
13 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] HGVS feedback comment Incorrect nucleotide description as does not indicate del. c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U
14 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] HGVS feedback comment Incorrect nucleotide description as does not indicate del. c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U
15 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U HGVS feedback comment Incorrect nucleotide description as does not indicate del. Incorrect nucleotide The semicolon should not be in brackets.
16 Familial Hypercholesterolaemia Heterozygous duplication of exons 3-8 in LDLR 4/9 labs used HGVS Nomenclature Number of labs LDLR reference sequence quoted c.[191-?_c.1186+?(2)];[=] 1 NM_ c.[191-?_1186+?dup];[=] 1 NM_ c.191-?_1186+?dup 2 NM_ dup should only be used if the duplication has been shown to be in tandem 2 should be used if no experimental evidence as the second copy could be anywhere in the genome
17 Lynch syndrome Heterozygous deletion of exons 9-16 in MSH2 6 labs (29%) used HGVS Summary of the HGVS nomenclature used in Lynch syndrome 2013 EQA Question 1. Nomenclature No. of labs MSH2 reference sequence quoted c.1387-?_2805+?del and c.[1387-?_2805+?del];[=], p.[?];[=] 1 NM_ c.[1387-?_c.2805+?del];[=] 1 NM_ c.1387-?_2805+? 1 NM_ c.1387-?_(*279_?)del 2 NM_ Nomenclature submitted described a different deletion, so not reproduced here 1 N/A
18 Heterozygous deletion of exons 9-16 in MSH2 GenBank MSH2 ref seq recently updated: NM_ c.1387-?_(*272_?)del NM_ c.1387-?_(*279_?)del Exon 16 is last exon LRG sequence for MSH2 now available
19 Rett syndrome Heterozygous for a partial deletion of exon 4 of MECP2 5/11 labs used HGVS Summary of the HGVS nomenclature used in Rett syndrome 2013 EQA Question 1. Nomenclature c.[378-?_704+?del];[=] p.[?];[=] No. of labs MECP2 reference sequence quoted 1 NM_ c.[378-?_1029+?del];[=] 1 NM_ c.378-?_1051+?del 1 NM_ c ?_1051+?del c ?_1087+?del 1 NM_ (MECP2_e2) NM_ (MECP2_e1) c ?_1029+?del 1 NM_ Following HGVS, best answer is the most precise description by taking into account the MLPA probe sequences
20 Von Hippel Lindau Heterozygous deletion of exons 1-3 of VHL 3/8 used HGVS Summary of the HGVS nomenclature used in VHL 2013 EQA Question 2. Nomenclature Number of labs VHL reference sequence quoted c.1-?_642+?del (correct) 1 NM_ c.1-?_642+?del (correct) 1 Not stated c.(?_-213) (*3705_?)del (incorrect) 1 NM_
21 BRCA dup /del nomenclature summary Need HGVS nomenclature (especially when submitting the information to the mutation databases) Need to be comprehensible to all recipients, so advisable to describe the exonic deletion in words. DMD best practice guidelines: dup / dels should be described in words rather than HGVS. Most labs provided a ref seq but only 5 gave the MLPA kit and version no. in the BRCA scheme. In future EQA schemes a ref seq will be required.
22 Nomenclature (all) What is clearest for the clinician? What is clearest for other labs reading the report to carry out e.g. predictives? What is clearest for the disease-specific mutation databases and does this need to be on the report? Could all these be included in one report and should they be?
23
24 Recommendations? Could have het del exon 3 in words and then other descriptions in the footnotes Do we need square bracket versions? To indicate a termination codon either (*) or Ter is acceptable. Is it clear though? All variants listed on report (e.g. table of those tested for in CF screen) should be in HGVS, but for templates only need to set this up once. CF clinical team is always asking for extra copies of this indication it s confusing?.
25 Recommendations? Will insisting on full HGVS with brackets become too onerous for busy labs? Is writing and checking every variant in HGVS creating unnecessary work? What will we expect in the QA returns as a minimum? (>1 correct answer so difficult to assess) Will labs only do it for QA?
26 Mutation nomenclature examples To describe a no mutation detected result: To describe a heterozygous result: To describe the presence of two different mutations when the phase is not known: To describe the presence of two different mutations shown to be in trans: To describe the presence of two different heterozygous mutations shown to be in cis: To describe a confirmed homozygous result (e.g. confirmed by parental testing): To describe an apparent homozygous result: To describe a mutation when also using accompanying words to state heterozygous/homozygous/etc.: c.[=];[=] p.[(=)];[(=)] c.[1521_1523del];[=] p.[(phe508del)];[(=)] c.[1521_1523del(;)1657c>t] p.[(phe508del(;)arg553*)] c.[1521_1523del];[1657c>t] p.[(phe508del)];[(arg553*)] c.[1521_1523del;1657c>t];[=] p.[(phe508del;arg553*)];[(=)] c.[1521_1523del];[1521_1523del] p.[(phe508del)];[(phe508del)] c.[1521_1523del];[(1521_1523del)] p.[(phe508del)];[(phe508del)] c.1521_1523del p.(phe508del)
27
New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
More informationMRC-Holland MLPA. Description version 08; 30 March 2015
SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationProduct Description SALSA MLPA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.
Product Description SALSA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19
More informationConcurrent Practical Session ACMG Classification
Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim
More informationCollaboration between CEQAS and UK NEQAS for Molecular Genetics Solid Tumour EQAs and variant interpretation
Collaboration between CEQAS and UK NEQAS for Molecular Genetics Solid Tumour EQAs and variant interpretation Dr Jenni Fairley Deputy Scheme Director (Molecular Pathology), GenQA, Edinburgh, UK From 1 st
More informationMRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
More informationImportance of Clinical Information for Optimal Genetic Test Selection and Interpretation
Importance of Clinical Information for Optimal Genetic Test Selection and Interpretation Chris Miller, MS, LCGC ARUP Laboratories Learning Objectives Understand the relevance of clinical information for
More informationMRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium
More informationUW359 Ovary 3c 3 Serous Recurrent 68 BRCA1 816delGT BRCA1 del exon 1-2. UW417 Ovary 3c 3 Serous Primary 38 BRCA1 1675delA
Supplementary Table 1. Cases with deleterious germline mutations, somatic HR mutations, and somatic PTEN mutations. ID Site Stage Grade Histology Tumor Age Germline mutation(s) a Somatic HR mutation(s)
More informationCPT Codes for Pharmacogenomic Tests
CPT s for Pharmacogenomic Tests The table below lists CPT codes and lab fee information for pharmacogenomic tests as established by the Centers for Medicare and Medicaid Services. It was compiled by the
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationTP53 ABERRATIONS Methodical considerations
TP53 ABERRATIONS Methodical considerations Sarka Pavlova University Hospital and Masaryk University, Brno, Czech republic Belgrade March 16-17, 2018 TP53 gene in CLL: modes of inactivation mutation(s)
More informationImportance of Clinical Information for Optimal Genetic Test Selection and Interpretation. Chris Miller, MS, LCGC ARUP Laboratories
Importance of Clinical Information for Optimal Genetic Test Selection and Interpretation Chris Miller, MS, LCGC ARUP Laboratories Learning Objectives Explain the relevance of clinical information for genetic
More informationMRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.
SALSA MLPA probemix P056-C1 TP53 Lot C1-0215 & lot C1-0214. As compared to version B1 (lot B1-1011) most of the reference and flanking probes have been replaced and several have been added. Furthermore,
More informationGenome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet
Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet All cancer is due to genetic mutations. However, in cancer that clusters in families (familial cancer) at least one of these mutations
More informationProduct Description SALSA MLPA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol. Version C1. For complete product history see page 7. Catalogue numbers: P138-025R: SALSA MLPA probemix
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
More informationProduct Description SALSA MLPA Probemix P055-D1 PAH To be used with the MLPA General Protocol.
Product Description SALSA Probemix P055-D1 PAH To be used with the MLPA General Protocol. Version D1. For complete product history see page 7. Catalogue numbers: P055-025R: SALSA MLPA probemix P055 PAH,
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationMRC-Holland MLPA. Description version 29;
SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,
More informationHIV Testing and Systems for Managing HIV Implementation in Resource Limited Settings
HIV Testing and Systems for Managing HIV Implementation in Resource Limited Settings Elizabeth M. Dax with the staff of the National Serology Reference Laboratory, Australia My Background Worked in HIV
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationNRL EQAS for NAT: Assessing the variability and performance of molecular assays for clinical pathogens
NRL EQAS for NAT: Assessing the variability and performance of molecular assays for clinical pathogens Vincini GA*, Cabuang LM, Land S, Best SJ NRL London, 12 January 2011 NRL EQAS for NAT HCV Genotyping
More informationReporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
More informationCANCER GENETICS PROVIDER SURVEY
Dear Participant, Previously you agreed to participate in an evaluation of an education program we developed for primary care providers on the topic of cancer genetics. This is an IRB-approved, CDCfunded
More informationSALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.
mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised
More informationThe Next Generation of Hereditary Cancer Testing
The Next Generation of Hereditary Cancer Testing Why Genetic Testing? Cancers can appear to run in families. Often this is due to shared environmental or lifestyle patterns, such as tobacco use. However,
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent
More informationSALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407
SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA
More informationCentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION
CentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION CentoCancer our most comprehensive oncogenetics panel for hereditary mutations Hereditary pathogenic variants confer an increased risk of developing
More informationGenomic and Genetic Medicine in the Clinical Setting
Genomic and Genetic Medicine in the Clinical Setting Objectives Define genomic and genetic medicine Introduce molecular genetic testing Outline clinical applications including those for: Mendelian disease
More informationInformation for You and Your Family
Information for You and Your Family What is Prevention? Cancer prevention is action taken to lower the chance of getting cancer. In 2017, more than 1.6 million people will be diagnosed with cancer in the
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationTGL clinical User Guide
TGL clinical User Guide The Institute of Cancer Research Brookes Lawley Building 15 Cotswold Road Sutton, Surrey SM2 5NG Page 1 of 7 TGL clinical This document describes the services provided by TGL clinical
More informationMRC-Holland MLPA. Description version 29; 31 July 2015
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082
More informationMutation specific therapies
Taken from www.dmd.nl/gt. Used with permission Mutation specific therapies Introduction Two therapies for Duchenne patients are currently being tested in clinical trials, which are applicable only to patients
More informationMRC-Holland MLPA. Description version 12; 13 January 2017
SALSA MLPA probemix P219-B3 PAX6 Lot B3-0915: Compared to version B2 (lot B2-1111) two reference probes have been replaced and one additional reference probe has been added. In addition, one flanking probe
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationOverview of the ESP Lung and Colon EQA schemes with a focus on Dutch laboratories
Overview of the ESP Lung and Colon EQA schemes with a focus on Dutch laboratories Dr. Nils t Hart University Medical Center Groningen, The Netherlands Drs. Cleo Keppens Catholic University of Leuven, Belgium
More informationSALSA MLPA probemix P371-A1 Microdeletion Syndromes 5 Lot A1-0509
mix P371-A1 Microdeletion Syndromes 5 Lot A1-0509 The purpose of the P371 mix is to further investigate results found with the P245 Microdeletion mix. The P245 mix provides a possibility to screen samples
More informationVariant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18
Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationProduct Description SALSA MLPA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol. Version F2. Compared to version F1, two reference probes have been replaced and the 118 nt Y fragment has been
More informationImplementation of BRCA Oncomine panel for germline and somatic variant analysis
Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing
More informationSelect analysis on the next pages. Sample request and sending address see last page. Institut für Pathologie und Molekularpathologie
Diagnostic Tumor Genome Analysis Schmelzbergstrasse 12 8091 Zürich Tel.: (+41) 044 255 3929 Fax.: (+41) 044 255 4416 Client (address, telephone number): ngs.pathologie@usz.ch www.pathologie.usz.ch Sample-Nr:
More informationMSI positive MSI negative
Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden
More informationBio 312, Spring 2017 Exam 3 ( 1 ) Name:
Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.
More informationLynch Syndrome and COLARIS Testing
Lynch Syndrome and COLARIS Testing Webinar Objectives Review of Lynch syndrome as a multi-gene disorder COLARIS Enhancements Technical Overview COLARIS test offerings Test development and validation process
More informationColon cancer: practical molecular diagnostics. Wade S. Samowitz, M.D. University of Utah and ARUP
Colon cancer: practical molecular diagnostics Wade S. Samowitz, M.D. University of Utah and ARUP Disclosure Dr. Samowitz may receive royalties in the future related to the Ventana BRAF V600E antibody.
More informationInformation for Service Users
Molecular Genetics Laboratory Northern Genetics Service Northern Genetics Service Molecular Genetics Laboratory Information for Service Users 2017 Accredited Medical Laboratory Reference No: 2212 Laboratory
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationThe Meaning of Genetic Variation
Activity 2 The Meaning of Genetic Variation Focus: Students investigate variation in the beta globin gene by identifying base changes that do and do not alter function, and by using several CD-ROM-based
More informationNGS for Cancer Predisposition
NGS for Cancer Predisposition Colin Pritchard MD, PhD University of Washington Dept. of Lab Medicine AMP Companion Society Meeting USCAP Boston March 22, 2015 Disclosures I am an employee of the University
More informationMRC-Holland MLPA. Description version 30; 06 June 2017
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationProduct Description SALSA MLPA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19
More informationMerging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines
Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Tracy Brandt, Ph.D., FACMG Disclosure I am an employee of GeneDx, Inc., a wholly-owned
More informationProgramme of community action in the field of health ( ) 2012 ACTIVITY REPORT DELIVERABLE 8: EVALUATION REPORT
Page 1 Programme of community action in the field of health (2008-2013) 2012 ACTIVITY REPORT DELIVERABLE 8: EVALUATION REPORT Page 2 Description of the deliverable An end of year external evaluation report
More informationThe Human Major Histocompatibility Complex
The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure
More informationPROVIDER POLICIES & PROCEDURES
PROVIDER POLICIES & PROCEDURES GENETIC CANCER SUSCEPTIBILITY PANELS USING NEXT GENERATION SEQUENCING The purpose of this document is to assist providers enrolled in the Connecticut Medical Assistance Program
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationMRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
More informationMRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationMRC-Holland MLPA. Description version 08; 07 May 2015
mix P185-C1 Intersex Lot C1-0611: As compared to the previous version B2 (lot B2-0311), s for CYP21A2 have been removed and s for the CXorf21 gene as well as additional s for NR0B1, NR5A1 and the Y chromosome
More informationInformed Consent Columbia Whole Genome or Whole Exome Sequencing
Informed Consent Columbia Whole Genome or Whole Exome Sequencing Please read the following form carefully and discuss with your ordering physician before signing consent. This consent is intended for the
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISEASE/CONDITION POPULATION TRIAD Submitting laboratory: Cambridge RGC Approved: September 2012
More informationProduct Description SALSA MS-MLPA Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol. Version C1. As compared to the previous version (lot B3-1017), this probemix has been
More informationQ2b How could you follow up. Q1 Describe two features of Identify a feature = 1 mark Extra detail = 1 mark Do this twice.
Paper 1: Medicine & The Historic Environment: Western Front 191-18 Q1 Describe two features of Identify a feature = 1 mark Extra detail = 1 mark Do this twice. Q2a How useful? 2 paragraphs 8 Say how useful
More informationGenetic Variation Junior Science
2018 Version Genetic Variation Junior Science http://img.publishthis.com/images/bookmarkimages/2015/05/d/5/c/d5cf017fb4f7e46e1c21b874472ea7d1_bookmarkimage_620x480_xlarge_original_1.jpg Sexual Reproduction
More informationDNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work.
DNA Basics We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA is packaged into structures called chromosomes. Each chromosome contains many genes and each
More informationReporting and commenting on metabolic results. JR Bonham, Sheffield Children s Trust
Reporting and commenting on metabolic results JR Bonham, Sheffield Children s Trust Outline Why is reporting important? What are we trying to achieve? Some features of good practice Some points to bear
More informationCASE STUDY. Germline Cancer Testing in A Proband: Extension of Benefits to Unaffected Family Members. Introduction. Patient Profile.
CASE STUDY Germline Cancer Testing in A Proband: Extension of Benefits to Unaffected Family Members Introduction Most cancers are caused by genetic damage resulting from random mutations and exposure to
More informationMRC-Holland MLPA. Description version 08; 18 November 2016
SALSA MLPA probemix P122-D1 NF1 AREA Lot D1-1016. As compared to lot C2-0312, four probes in the NF1 area and one reference probe have been removed, four reference probes have been replaced and several
More informationSALSA MLPA probemix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four probes have been adjusted.
mix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four s have been adjusted. The sex-determining region on chromosome Y (SRY) is the most important
More informationProstateGene GeneHealth UK
ProstateGene GeneHealth UK ProstateGene What is hereditary Prostate cancer? Prostate cancer is the most common cancer among men in the UK. Unfortunately, 1 in 8 men will be diagnosed with prostate cancer,
More informationGenomic Medicine in Oncology
Winter Refresher Course for Family Medicine Providers 2/1/18 Michael P. Mullane, MD Medical Director, Hereditary Cancer Prevention and Management Center Attending, Oncology Precision Medicine Clinic Aurora
More informationLow Proportion of Whole Exon Deletions Causing Phenylketonuria in Denmark and Germany
HUMAN MUTATION Mutation in Brief #952 (2007) Online MUTATION IN BRIEF Low Proportion of Whole Exon Deletions Causing Phenylketonuria in Denmark and Germany Lisbeth Birk Møller 1 *, Anders O.H. Nygren 2,
More informationProduct Description SALSA MS-MLPA Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol. Version C1. For complete product history see page 9. Catalogue numbers: ME028-025R: SALSA
More informationPersonalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection
Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025
More informationMEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers
POLICY: PG0067 ORIGINAL EFFECTIVE: 07/30/02 LAST REVIEW: 01/25/18 MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers GUIDELINES This policy does not certify benefits or authorization of benefits,
More informationChromosomal Mutations
Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationSubmitting Laboratory: London NE RGC GOSH
Submitting laboratory: London NE RGC GOSH 1. Disorder/condition approved name (please provide UK spelling if different from US) and symbol as published on the OMIM database (alternative names will be listed
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationGenetics and Genomics: Applications to Developmental Disability
Tuesday, 12:30 2:00, B1 Objective: Genetics and Genomics: Applications to Developmental Disability Helga Toriello 616-234-2712 toriello@msu.edu Identify advances in clinical assessment and management of
More informationSALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISEASE/CONDITION POPULATION TRIAD Submitting laboratory: London North East RGC GOSH Approved: September
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationMRC-Holland MLPA. Description version 28; 4 January 2018
SALSA MLPA probemix ME011-B3 Mismatch Repair genes Lot B3-1017 and B3-0715. As compared to the previous version B2 (lot B2-0614), one probe has a small change in length but no change in the sequence detected.
More informationProduct Description SALSA MLPA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Version D1. For a complete product history see page 11. Catalogue numbers: P002-025R: SALSA MLPA probemix P002
More informationAssessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical
More informationBioinformatics Laboratory Exercise
Bioinformatics Laboratory Exercise Biology is in the midst of the genomics revolution, the application of robotic technology to generate huge amounts of molecular biology data. Genomics has led to an explosion
More informationMRC-Holland MLPA. Description version 07; 26 November 2015
SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced
More informationClinical Policy Title: Genetic tests for Duchenne muscular dystrophy
Clinical Policy Title: Genetic tests for Duchenne muscular dystrophy Clinical Policy Number: 02.01.23 Effective Date: February 1, 2017 Initial Review Date: January 18, 2017 Most Recent Review Date: January
More information