Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014

Size: px
Start display at page:

Download "Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014"

Transcription

1 Issues arising from UKNEQAS schemes Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014

2 2013 schemes There was great variation in the way HGVS nomenclature was applied Scheme would like to promote a universal system and encourages labs to follow HGVS guidelines Marks were deducted when HGVS was not used except for dups/dels and triplet repeat expansions Brackets were a common problem, especially at the protein level, but marks were not deducted Most variation was in reporting of dels/dups

3 Duplications / deletions 5 disease schemes: BRCA, FH, LS, Rett, VHL A minority of labs attempted to use HGVS Up to 6 different versions in one scheme Do not want to insist on HGVS for this reason But if dup/del is described in words, the report must say what is meant by the numbering of the exons

4 Exon numbering GenBank ref seqs do not include reference to exon numbers May have exons missing e.g. BRCA1 NM_ has no exon 4 The report must explain the numbering used The MLPA kit ref no. is not sufficient to indicate the exon number LRG sequences

5 LRG Locus Reference Genomic sequences LRG sequences provide a stable genomic DNA framework for reporting mutations with a permanent ID and core content that never changes. The Scheme has agreed to promote the use of LRGs and will include all published LRGs in future documentation.

6 BRCA1 & 2 scheme Heterozygous deletion of exon 3 in BRCA1 Most labs described it in words Only 6/24 attempted HGVS

7 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature No. of labs BRCA1 ref seq c.81-?_134+?del p.(cys27*) 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U

8 HGVS feedback comments Should not give a protein description without RNA analysis having been performed Should use p.? or put in brackets to indicate it s a prediction

9 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ HGVS feedback comment c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U

10 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ HGVS feedback comment c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U

11 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del HGVS feedback comment c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U

12 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] HGVS feedback comment Incorrect nucleotide description as does not indicate del. c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U

13 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] HGVS feedback comment Incorrect nucleotide description as does not indicate del. c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U

14 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] HGVS feedback comment Incorrect nucleotide description as does not indicate del. c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U

15 Summary of the HGVS nomenclature used in BRCA 2013 EQA Q1. Nomenclature c.81-?_134+?del p.(cys27*) No. of labs BRCA1 ref seq 2 NM_ c.81-?_134+?del c.[81-?_134+?];[=] c.[81-?_134+?del];[=]; p.[?];[=] c.[81-?_134+?del];[=] p.[(cys27*)];[=] c.[81-?_134+?del](;)[=] p.([cys27*];[=]) 1 U HGVS feedback comment Incorrect nucleotide description as does not indicate del. Incorrect nucleotide The semicolon should not be in brackets.

16 Familial Hypercholesterolaemia Heterozygous duplication of exons 3-8 in LDLR 4/9 labs used HGVS Nomenclature Number of labs LDLR reference sequence quoted c.[191-?_c.1186+?(2)];[=] 1 NM_ c.[191-?_1186+?dup];[=] 1 NM_ c.191-?_1186+?dup 2 NM_ dup should only be used if the duplication has been shown to be in tandem 2 should be used if no experimental evidence as the second copy could be anywhere in the genome

17 Lynch syndrome Heterozygous deletion of exons 9-16 in MSH2 6 labs (29%) used HGVS Summary of the HGVS nomenclature used in Lynch syndrome 2013 EQA Question 1. Nomenclature No. of labs MSH2 reference sequence quoted c.1387-?_2805+?del and c.[1387-?_2805+?del];[=], p.[?];[=] 1 NM_ c.[1387-?_c.2805+?del];[=] 1 NM_ c.1387-?_2805+? 1 NM_ c.1387-?_(*279_?)del 2 NM_ Nomenclature submitted described a different deletion, so not reproduced here 1 N/A

18 Heterozygous deletion of exons 9-16 in MSH2 GenBank MSH2 ref seq recently updated: NM_ c.1387-?_(*272_?)del NM_ c.1387-?_(*279_?)del Exon 16 is last exon LRG sequence for MSH2 now available

19 Rett syndrome Heterozygous for a partial deletion of exon 4 of MECP2 5/11 labs used HGVS Summary of the HGVS nomenclature used in Rett syndrome 2013 EQA Question 1. Nomenclature c.[378-?_704+?del];[=] p.[?];[=] No. of labs MECP2 reference sequence quoted 1 NM_ c.[378-?_1029+?del];[=] 1 NM_ c.378-?_1051+?del 1 NM_ c ?_1051+?del c ?_1087+?del 1 NM_ (MECP2_e2) NM_ (MECP2_e1) c ?_1029+?del 1 NM_ Following HGVS, best answer is the most precise description by taking into account the MLPA probe sequences

20 Von Hippel Lindau Heterozygous deletion of exons 1-3 of VHL 3/8 used HGVS Summary of the HGVS nomenclature used in VHL 2013 EQA Question 2. Nomenclature Number of labs VHL reference sequence quoted c.1-?_642+?del (correct) 1 NM_ c.1-?_642+?del (correct) 1 Not stated c.(?_-213) (*3705_?)del (incorrect) 1 NM_

21 BRCA dup /del nomenclature summary Need HGVS nomenclature (especially when submitting the information to the mutation databases) Need to be comprehensible to all recipients, so advisable to describe the exonic deletion in words. DMD best practice guidelines: dup / dels should be described in words rather than HGVS. Most labs provided a ref seq but only 5 gave the MLPA kit and version no. in the BRCA scheme. In future EQA schemes a ref seq will be required.

22 Nomenclature (all) What is clearest for the clinician? What is clearest for other labs reading the report to carry out e.g. predictives? What is clearest for the disease-specific mutation databases and does this need to be on the report? Could all these be included in one report and should they be?

23

24 Recommendations? Could have het del exon 3 in words and then other descriptions in the footnotes Do we need square bracket versions? To indicate a termination codon either (*) or Ter is acceptable. Is it clear though? All variants listed on report (e.g. table of those tested for in CF screen) should be in HGVS, but for templates only need to set this up once. CF clinical team is always asking for extra copies of this indication it s confusing?.

25 Recommendations? Will insisting on full HGVS with brackets become too onerous for busy labs? Is writing and checking every variant in HGVS creating unnecessary work? What will we expect in the QA returns as a minimum? (>1 correct answer so difficult to assess) Will labs only do it for QA?

26 Mutation nomenclature examples To describe a no mutation detected result: To describe a heterozygous result: To describe the presence of two different mutations when the phase is not known: To describe the presence of two different mutations shown to be in trans: To describe the presence of two different heterozygous mutations shown to be in cis: To describe a confirmed homozygous result (e.g. confirmed by parental testing): To describe an apparent homozygous result: To describe a mutation when also using accompanying words to state heterozygous/homozygous/etc.: c.[=];[=] p.[(=)];[(=)] c.[1521_1523del];[=] p.[(phe508del)];[(=)] c.[1521_1523del(;)1657c>t] p.[(phe508del(;)arg553*)] c.[1521_1523del];[1657c>t] p.[(phe508del)];[(arg553*)] c.[1521_1523del;1657c>t];[=] p.[(phe508del;arg553*)];[(=)] c.[1521_1523del];[1521_1523del] p.[(phe508del)];[(phe508del)] c.[1521_1523del];[(1521_1523del)] p.[(phe508del)];[(phe508del)] c.1521_1523del p.(phe508del)

27

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix. SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:

More information

MRC-Holland MLPA. Description version 08; 30 March 2015

MRC-Holland MLPA. Description version 08; 30 March 2015 SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Product Description SALSA MLPA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.

Product Description SALSA MLPA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Product Description SALSA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19

More information

Concurrent Practical Session ACMG Classification

Concurrent Practical Session ACMG Classification Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim

More information

Collaboration between CEQAS and UK NEQAS for Molecular Genetics Solid Tumour EQAs and variant interpretation

Collaboration between CEQAS and UK NEQAS for Molecular Genetics Solid Tumour EQAs and variant interpretation Collaboration between CEQAS and UK NEQAS for Molecular Genetics Solid Tumour EQAs and variant interpretation Dr Jenni Fairley Deputy Scheme Director (Molecular Pathology), GenQA, Edinburgh, UK From 1 st

More information

MRC-Holland MLPA. Description version 18; 09 September 2015

MRC-Holland MLPA. Description version 18; 09 September 2015 SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the

More information

Importance of Clinical Information for Optimal Genetic Test Selection and Interpretation

Importance of Clinical Information for Optimal Genetic Test Selection and Interpretation Importance of Clinical Information for Optimal Genetic Test Selection and Interpretation Chris Miller, MS, LCGC ARUP Laboratories Learning Objectives Understand the relevance of clinical information for

More information

MRC-Holland MLPA. Description version 14; 28 September 2016

MRC-Holland MLPA. Description version 14; 28 September 2016 SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium

More information

UW359 Ovary 3c 3 Serous Recurrent 68 BRCA1 816delGT BRCA1 del exon 1-2. UW417 Ovary 3c 3 Serous Primary 38 BRCA1 1675delA

UW359 Ovary 3c 3 Serous Recurrent 68 BRCA1 816delGT BRCA1 del exon 1-2. UW417 Ovary 3c 3 Serous Primary 38 BRCA1 1675delA Supplementary Table 1. Cases with deleterious germline mutations, somatic HR mutations, and somatic PTEN mutations. ID Site Stage Grade Histology Tumor Age Germline mutation(s) a Somatic HR mutation(s)

More information

CPT Codes for Pharmacogenomic Tests

CPT Codes for Pharmacogenomic Tests CPT s for Pharmacogenomic Tests The table below lists CPT codes and lab fee information for pharmacogenomic tests as established by the Centers for Medicare and Medicaid Services. It was compiled by the

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

TP53 ABERRATIONS Methodical considerations

TP53 ABERRATIONS Methodical considerations TP53 ABERRATIONS Methodical considerations Sarka Pavlova University Hospital and Masaryk University, Brno, Czech republic Belgrade March 16-17, 2018 TP53 gene in CLL: modes of inactivation mutation(s)

More information

Importance of Clinical Information for Optimal Genetic Test Selection and Interpretation. Chris Miller, MS, LCGC ARUP Laboratories

Importance of Clinical Information for Optimal Genetic Test Selection and Interpretation. Chris Miller, MS, LCGC ARUP Laboratories Importance of Clinical Information for Optimal Genetic Test Selection and Interpretation Chris Miller, MS, LCGC ARUP Laboratories Learning Objectives Explain the relevance of clinical information for genetic

More information

MRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.

MRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53. SALSA MLPA probemix P056-C1 TP53 Lot C1-0215 & lot C1-0214. As compared to version B1 (lot B1-1011) most of the reference and flanking probes have been replaced and several have been added. Furthermore,

More information

Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet

Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet All cancer is due to genetic mutations. However, in cancer that clusters in families (familial cancer) at least one of these mutations

More information

Product Description SALSA MLPA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol.

Product Description SALSA MLPA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol. Product Description SALSA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol. Version C1. For complete product history see page 7. Catalogue numbers: P138-025R: SALSA MLPA probemix

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes

More information

Product Description SALSA MLPA Probemix P055-D1 PAH To be used with the MLPA General Protocol.

Product Description SALSA MLPA Probemix P055-D1 PAH To be used with the MLPA General Protocol. Product Description SALSA Probemix P055-D1 PAH To be used with the MLPA General Protocol. Version D1. For complete product history see page 7. Catalogue numbers: P055-025R: SALSA MLPA probemix P055 PAH,

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

MRC-Holland MLPA. Description version 29;

MRC-Holland MLPA. Description version 29; SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,

More information

HIV Testing and Systems for Managing HIV Implementation in Resource Limited Settings

HIV Testing and Systems for Managing HIV Implementation in Resource Limited Settings HIV Testing and Systems for Managing HIV Implementation in Resource Limited Settings Elizabeth M. Dax with the staff of the National Serology Reference Laboratory, Australia My Background Worked in HIV

More information

SALSA MLPA probemix P315-B1 EGFR

SALSA MLPA probemix P315-B1 EGFR SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional

More information

NRL EQAS for NAT: Assessing the variability and performance of molecular assays for clinical pathogens

NRL EQAS for NAT: Assessing the variability and performance of molecular assays for clinical pathogens NRL EQAS for NAT: Assessing the variability and performance of molecular assays for clinical pathogens Vincini GA*, Cabuang LM, Land S, Best SJ NRL London, 12 January 2011 NRL EQAS for NAT HCV Genotyping

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

CANCER GENETICS PROVIDER SURVEY

CANCER GENETICS PROVIDER SURVEY Dear Participant, Previously you agreed to participate in an evaluation of an education program we developed for primary care providers on the topic of cancer genetics. This is an IRB-approved, CDCfunded

More information

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted. mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised

More information

The Next Generation of Hereditary Cancer Testing

The Next Generation of Hereditary Cancer Testing The Next Generation of Hereditary Cancer Testing Why Genetic Testing? Cancers can appear to run in families. Often this is due to shared environmental or lifestyle patterns, such as tobacco use. However,

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent

More information

SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407

SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA

More information

CentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION

CentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION CentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION CentoCancer our most comprehensive oncogenetics panel for hereditary mutations Hereditary pathogenic variants confer an increased risk of developing

More information

Genomic and Genetic Medicine in the Clinical Setting

Genomic and Genetic Medicine in the Clinical Setting Genomic and Genetic Medicine in the Clinical Setting Objectives Define genomic and genetic medicine Introduce molecular genetic testing Outline clinical applications including those for: Mendelian disease

More information

Information for You and Your Family

Information for You and Your Family Information for You and Your Family What is Prevention? Cancer prevention is action taken to lower the chance of getting cancer. In 2017, more than 1.6 million people will be diagnosed with cancer in the

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

TGL clinical User Guide

TGL clinical User Guide TGL clinical User Guide The Institute of Cancer Research Brookes Lawley Building 15 Cotswold Road Sutton, Surrey SM2 5NG Page 1 of 7 TGL clinical This document describes the services provided by TGL clinical

More information

MRC-Holland MLPA. Description version 29; 31 July 2015

MRC-Holland MLPA. Description version 29; 31 July 2015 SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082

More information

Mutation specific therapies

Mutation specific therapies Taken from www.dmd.nl/gt. Used with permission Mutation specific therapies Introduction Two therapies for Duchenne patients are currently being tested in clinical trials, which are applicable only to patients

More information

MRC-Holland MLPA. Description version 12; 13 January 2017

MRC-Holland MLPA. Description version 12; 13 January 2017 SALSA MLPA probemix P219-B3 PAX6 Lot B3-0915: Compared to version B2 (lot B2-1111) two reference probes have been replaced and one additional reference probe has been added. In addition, one flanking probe

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Overview of the ESP Lung and Colon EQA schemes with a focus on Dutch laboratories

Overview of the ESP Lung and Colon EQA schemes with a focus on Dutch laboratories Overview of the ESP Lung and Colon EQA schemes with a focus on Dutch laboratories Dr. Nils t Hart University Medical Center Groningen, The Netherlands Drs. Cleo Keppens Catholic University of Leuven, Belgium

More information

SALSA MLPA probemix P371-A1 Microdeletion Syndromes 5 Lot A1-0509

SALSA MLPA probemix P371-A1 Microdeletion Syndromes 5 Lot A1-0509 mix P371-A1 Microdeletion Syndromes 5 Lot A1-0509 The purpose of the P371 mix is to further investigate results found with the P245 Microdeletion mix. The P245 mix provides a possibility to screen samples

More information

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Product Description SALSA MLPA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol.

Product Description SALSA MLPA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol. Product Description SALSA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol. Version F2. Compared to version F1, two reference probes have been replaced and the 118 nt Y fragment has been

More information

Implementation of BRCA Oncomine panel for germline and somatic variant analysis

Implementation of BRCA Oncomine panel for germline and somatic variant analysis Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing

More information

Select analysis on the next pages. Sample request and sending address see last page. Institut für Pathologie und Molekularpathologie

Select analysis on the next pages. Sample request and sending address see last page. Institut für Pathologie und Molekularpathologie Diagnostic Tumor Genome Analysis Schmelzbergstrasse 12 8091 Zürich Tel.: (+41) 044 255 3929 Fax.: (+41) 044 255 4416 Client (address, telephone number): ngs.pathologie@usz.ch www.pathologie.usz.ch Sample-Nr:

More information

MSI positive MSI negative

MSI positive MSI negative Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden

More information

Bio 312, Spring 2017 Exam 3 ( 1 ) Name:

Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.

More information

Lynch Syndrome and COLARIS Testing

Lynch Syndrome and COLARIS Testing Lynch Syndrome and COLARIS Testing Webinar Objectives Review of Lynch syndrome as a multi-gene disorder COLARIS Enhancements Technical Overview COLARIS test offerings Test development and validation process

More information

Colon cancer: practical molecular diagnostics. Wade S. Samowitz, M.D. University of Utah and ARUP

Colon cancer: practical molecular diagnostics. Wade S. Samowitz, M.D. University of Utah and ARUP Colon cancer: practical molecular diagnostics Wade S. Samowitz, M.D. University of Utah and ARUP Disclosure Dr. Samowitz may receive royalties in the future related to the Ventana BRAF V600E antibody.

More information

Information for Service Users

Information for Service Users Molecular Genetics Laboratory Northern Genetics Service Northern Genetics Service Molecular Genetics Laboratory Information for Service Users 2017 Accredited Medical Laboratory Reference No: 2212 Laboratory

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

SALSA MLPA KIT P060-B2 SMA

SALSA MLPA KIT P060-B2 SMA SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the

More information

The Meaning of Genetic Variation

The Meaning of Genetic Variation Activity 2 The Meaning of Genetic Variation Focus: Students investigate variation in the beta globin gene by identifying base changes that do and do not alter function, and by using several CD-ROM-based

More information

NGS for Cancer Predisposition

NGS for Cancer Predisposition NGS for Cancer Predisposition Colin Pritchard MD, PhD University of Washington Dept. of Lab Medicine AMP Companion Society Meeting USCAP Boston March 22, 2015 Disclosures I am an employee of the University

More information

MRC-Holland MLPA. Description version 30; 06 June 2017

MRC-Holland MLPA. Description version 30; 06 June 2017 SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Product Description SALSA MLPA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.

Product Description SALSA MLPA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Product Description SALSA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19

More information

Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines

Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Tracy Brandt, Ph.D., FACMG Disclosure I am an employee of GeneDx, Inc., a wholly-owned

More information

Programme of community action in the field of health ( ) 2012 ACTIVITY REPORT DELIVERABLE 8: EVALUATION REPORT

Programme of community action in the field of health ( ) 2012 ACTIVITY REPORT DELIVERABLE 8: EVALUATION REPORT Page 1 Programme of community action in the field of health (2008-2013) 2012 ACTIVITY REPORT DELIVERABLE 8: EVALUATION REPORT Page 2 Description of the deliverable An end of year external evaluation report

More information

The Human Major Histocompatibility Complex

The Human Major Histocompatibility Complex The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure

More information

PROVIDER POLICIES & PROCEDURES

PROVIDER POLICIES & PROCEDURES PROVIDER POLICIES & PROCEDURES GENETIC CANCER SUSCEPTIBILITY PANELS USING NEXT GENERATION SEQUENCING The purpose of this document is to assist providers enrolled in the Connecticut Medical Assistance Program

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

MRC-Holland MLPA. Description version 06; 23 December 2016

MRC-Holland MLPA. Description version 06; 23 December 2016 SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated

More information

MRC-Holland MLPA. Description version 19;

MRC-Holland MLPA. Description version 19; SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL

More information

CHROMOSOMAL MICROARRAY (CGH+SNP)

CHROMOSOMAL MICROARRAY (CGH+SNP) Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due

More information

MRC-Holland MLPA. Description version 08; 07 May 2015

MRC-Holland MLPA. Description version 08; 07 May 2015 mix P185-C1 Intersex Lot C1-0611: As compared to the previous version B2 (lot B2-0311), s for CYP21A2 have been removed and s for the CXorf21 gene as well as additional s for NR0B1, NR5A1 and the Y chromosome

More information

Informed Consent Columbia Whole Genome or Whole Exome Sequencing

Informed Consent Columbia Whole Genome or Whole Exome Sequencing Informed Consent Columbia Whole Genome or Whole Exome Sequencing Please read the following form carefully and discuss with your ordering physician before signing consent. This consent is intended for the

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISEASE/CONDITION POPULATION TRIAD Submitting laboratory: Cambridge RGC Approved: September 2012

More information

Product Description SALSA MS-MLPA Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol.

Product Description SALSA MS-MLPA Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol. Product Description SALSA MS- Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol. Version C1. As compared to the previous version (lot B3-1017), this probemix has been

More information

Q2b How could you follow up. Q1 Describe two features of Identify a feature = 1 mark Extra detail = 1 mark Do this twice.

Q2b How could you follow up. Q1 Describe two features of Identify a feature = 1 mark Extra detail = 1 mark Do this twice. Paper 1: Medicine & The Historic Environment: Western Front 191-18 Q1 Describe two features of Identify a feature = 1 mark Extra detail = 1 mark Do this twice. Q2a How useful? 2 paragraphs 8 Say how useful

More information

Genetic Variation Junior Science

Genetic Variation Junior Science 2018 Version Genetic Variation Junior Science http://img.publishthis.com/images/bookmarkimages/2015/05/d/5/c/d5cf017fb4f7e46e1c21b874472ea7d1_bookmarkimage_620x480_xlarge_original_1.jpg Sexual Reproduction

More information

DNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work.

DNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA Basics We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA is packaged into structures called chromosomes. Each chromosome contains many genes and each

More information

Reporting and commenting on metabolic results. JR Bonham, Sheffield Children s Trust

Reporting and commenting on metabolic results. JR Bonham, Sheffield Children s Trust Reporting and commenting on metabolic results JR Bonham, Sheffield Children s Trust Outline Why is reporting important? What are we trying to achieve? Some features of good practice Some points to bear

More information

CASE STUDY. Germline Cancer Testing in A Proband: Extension of Benefits to Unaffected Family Members. Introduction. Patient Profile.

CASE STUDY. Germline Cancer Testing in A Proband: Extension of Benefits to Unaffected Family Members. Introduction. Patient Profile. CASE STUDY Germline Cancer Testing in A Proband: Extension of Benefits to Unaffected Family Members Introduction Most cancers are caused by genetic damage resulting from random mutations and exposure to

More information

MRC-Holland MLPA. Description version 08; 18 November 2016

MRC-Holland MLPA. Description version 08; 18 November 2016 SALSA MLPA probemix P122-D1 NF1 AREA Lot D1-1016. As compared to lot C2-0312, four probes in the NF1 area and one reference probe have been removed, four reference probes have been replaced and several

More information

SALSA MLPA probemix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four probes have been adjusted.

SALSA MLPA probemix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four probes have been adjusted. mix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four s have been adjusted. The sex-determining region on chromosome Y (SRY) is the most important

More information

ProstateGene GeneHealth UK

ProstateGene GeneHealth UK ProstateGene GeneHealth UK ProstateGene What is hereditary Prostate cancer? Prostate cancer is the most common cancer among men in the UK. Unfortunately, 1 in 8 men will be diagnosed with prostate cancer,

More information

Genomic Medicine in Oncology

Genomic Medicine in Oncology Winter Refresher Course for Family Medicine Providers 2/1/18 Michael P. Mullane, MD Medical Director, Hereditary Cancer Prevention and Management Center Attending, Oncology Precision Medicine Clinic Aurora

More information

Low Proportion of Whole Exon Deletions Causing Phenylketonuria in Denmark and Germany

Low Proportion of Whole Exon Deletions Causing Phenylketonuria in Denmark and Germany HUMAN MUTATION Mutation in Brief #952 (2007) Online MUTATION IN BRIEF Low Proportion of Whole Exon Deletions Causing Phenylketonuria in Denmark and Germany Lisbeth Birk Møller 1 *, Anders O.H. Nygren 2,

More information

Product Description SALSA MS-MLPA Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol.

Product Description SALSA MS-MLPA Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol. Product Description SALSA MS- Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol. Version C1. For complete product history see page 9. Catalogue numbers: ME028-025R: SALSA

More information

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025

More information

MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers

MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers POLICY: PG0067 ORIGINAL EFFECTIVE: 07/30/02 LAST REVIEW: 01/25/18 MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers GUIDELINES This policy does not certify benefits or authorization of benefits,

More information

Chromosomal Mutations

Chromosomal Mutations Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Submitting Laboratory: London NE RGC GOSH

Submitting Laboratory: London NE RGC GOSH Submitting laboratory: London NE RGC GOSH 1. Disorder/condition approved name (please provide UK spelling if different from US) and symbol as published on the OMIM database (alternative names will be listed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599

More information

Genetics and Genomics: Applications to Developmental Disability

Genetics and Genomics: Applications to Developmental Disability Tuesday, 12:30 2:00, B1 Objective: Genetics and Genomics: Applications to Developmental Disability Helga Toriello 616-234-2712 toriello@msu.edu Identify advances in clinical assessment and management of

More information

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISEASE/CONDITION POPULATION TRIAD Submitting laboratory: London North East RGC GOSH Approved: September

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

MRC-Holland MLPA. Description version 28; 4 January 2018

MRC-Holland MLPA. Description version 28; 4 January 2018 SALSA MLPA probemix ME011-B3 Mismatch Repair genes Lot B3-1017 and B3-0715. As compared to the previous version B2 (lot B2-0614), one probe has a small change in length but no change in the sequence detected.

More information

Product Description SALSA MLPA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol.

Product Description SALSA MLPA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Product Description SALSA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Version D1. For a complete product history see page 11. Catalogue numbers: P002-025R: SALSA MLPA probemix P002

More information

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical

More information

Bioinformatics Laboratory Exercise

Bioinformatics Laboratory Exercise Bioinformatics Laboratory Exercise Biology is in the midst of the genomics revolution, the application of robotic technology to generate huge amounts of molecular biology data. Genomics has led to an explosion

More information

MRC-Holland MLPA. Description version 07; 26 November 2015

MRC-Holland MLPA. Description version 07; 26 November 2015 SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced

More information

Clinical Policy Title: Genetic tests for Duchenne muscular dystrophy

Clinical Policy Title: Genetic tests for Duchenne muscular dystrophy Clinical Policy Title: Genetic tests for Duchenne muscular dystrophy Clinical Policy Number: 02.01.23 Effective Date: February 1, 2017 Initial Review Date: January 18, 2017 Most Recent Review Date: January

More information