TP53 ABERRATIONS Methodical considerations

Size: px
Start display at page:

Download "TP53 ABERRATIONS Methodical considerations"

Transcription

1 TP53 ABERRATIONS Methodical considerations Sarka Pavlova University Hospital and Masaryk University, Brno, Czech republic Belgrade March 16-17, 2018

2 TP53 gene in CLL: modes of inactivation mutation(s) without 17p deletion FISH neg 17p deletion without mutation FISH pos mutation & 17p deletion monoallelic mutation N=228 mutation/cn-loh N=52 (SNP array) Examine not only del(17p) by FISH but also TP53 mutation Karla Plevova

3 TP53 gene in CLL: KEEP IN MIND Despite some codons are mutated more frequently (hotspots), deleterious variants can occur IN ANY PART OF CODING SEQUENCE Leroy etal., Human Mutation 2014 Pospisilova and Pettitt, 2010 In CLL, TP53 mutations are (1) frequently subclonal, (2) clinically significant even if the second allele remains intact KNOW DETECTION LIMIT OF YOUR METHOD AND CANCER CELL FRACTION Landau et al., Cell 2013 SangerSeq detection limit Mutations can NEWLY OCCUR IN RELAPSE Pre-therapy Relapse 1 Pre-therapy Relapse 1 Relapse 2-n Malcikova et al., Leukemia 2015

4 Gene analysis: technical view Part I From clinician to lab: SAMPLING WHEN to sample? WHAT type of tissue? INFORMATION which should be provided WHICH CELLS to enrich for? DNA or RNA? WHICH GENE PARTS to analyze? METHOD? SANGER SEQ: protocol and analysis? NGS: what to consider? CORRECT VARIANT DESCRIPTION INTERPRETATION: does the variant affect function? Keep communicating Part III From lab to clinician: REPORTING clear and precise message from lab to clinician ALWAYS KEEP GENERAL STANDARDS OF LABORATORY PRACTICE: strictly avoid sample swap/cross-contamination at any phase and include appropriate controls

5 Part I From clinician to lab 1. WHEN to analyze TP53 during disease course? IF DECIDING ABOUT TREATMENT = before first therapy and before every subsequent therapy Not necessary if the information does not impact patient s management: mutation documented previously p53-independent therapy cannot be given (comorbidities, limited access)? if targeted therapy is given irrespective of TP53 status 2. WHAT type of tissue? PERIPHERAL BLOOD Optionally - if cancer cell fraction (CCF) is low in PB (SLL/CLL) BONE MARROW LYMPH NODE: fresh (frozen) FFPE not suitable unless specific methodology is established

6 WHICH CELLS to enrich for? MONONUCLEAR FRACTION works for majority of samples density gradient centrifugation using appropriate media, i.e. Ficoll or Histopaque 1077 Optionally for <60-70% lymphocytes: CD19+ separation is recommended e.g. RosetteSep or MACS, magnetic-activated cell sorting or FACS use sensitive method (deep NGS) and recalculate VAF CLL cells = Cancer cell fraction (CCF)

7 CD 19 CD 19 WHICH CELLS to enrich for? Cancer cell fraction (CCF) Mutation VAF CLL: WBC 14.7x10 9 /L lymphocytes 59% MONONUCLEAR CELLS (gradient centrifugation) B-CELLS (non B-cell depletion by RosetteSep) LEUKOCYTES Cancer Cell Fraction (CCF): CLL = 20% 1 % normal B-cells CLL 35% 2 % normal B-cells CLL >95% 21 % MNC cells CD 5 43 % CD5+ T-cells 1 % MNC cells p.y220c gdna 8% p.y220c gdna 21% CD 5 <1 % CD5+ T-cells CONSIDER CANCER CELL FRACTION either during sample processing or result interpretation (esp. CLL/SLL) INFORMATION ON BLOOD CELL COUNT parameters (at least WBC) provided with the sample may be helpful

8 NUCLEID ACID isolation and storage DNA of standard quality DNA storage (deep NGS): in TE buffer with low EDTA (0.1mM) at -20 C for longer periods avoid unnecessary dilution For NGS, low concentration or poor quality low amount of template molecules in the sample false negative and false positive results

9 HOW: which gene parts should be covered OPTIMUM: WHOLE CODING REGION = EXONS 2-11 Leroy etal., Human Mutation 2014; Pospisilova and Pettitt, 2010

10 HOW: which gene parts should be covered OPTIMUM: WHOLE CODING REGION = EXONS 2-11 Thierry Soussi, The TP53 Web Page Leroy etal., Human Mutation 2014; Pospisilova and Pettitt, 2010

11 HOW: which gene parts should be covered minimum: exons 4-10 Thierry Soussi, The TP53 Web Page ALWAYS INCLUDE SPLICE SITES intronic +/- 2 bp from intron/exon boundaries Splice site variants are pathogenic

12 METHOD OF ANALYSIS TP53 Sanger sequencing Sanger sequenci ng and NGS 28% Sanger seq, I am not NGS and sure other 1% 6% Next generation Sequencing - NGS Other only 2% NGS only 25% Sanger seq only 38% ERIC/Gilead survey Easy and cheap to establish for any lab using capillary sequencing Running few samples per month Fast Subclonal variants with 10-20% VAF may escape Incorrect quantification for some variants Easily detects all 10-20% mutations if properly established Quantitative High-throughput method large cohorts More genes/diseases at once in a gene panel Research on clonal evolution minor mutations <<10% can be caught Takes longer High-throughput = expensive or slow for low sample numbers or if not combined with other genes/diseases If low-vaf variants desired, higher coverage must be applied for all genes in the panel

13 NGS IN RESEARCH ON CLONAL EVOLUTION 01/2014 Before therapy 11/2015 Complete remission 06/2016 Progression R-Bendamustine 4x del(17p) neg p.g105d 2.5% VAF cell separation CLL 15% 96% TP53 mutations 70% VAF p.g105d 61% VAF + 6 other mutations 2.9%-0.5% del(17p) neg, cn-loh 80% TP53 mutations 76% VAF p.g105d 68% VAF + 6 other mutations 2.1%-0.5% 02/2014 Before therapy FCR 4x efekt PR 11/2016 Progression Minor clones may evolve into prevalent refractory clone under therapy pressure (but not always do) Landau et al., 2013; Rossi et al., 2014; Malcikova et al. Ibrutinib? del(17p) neg c.128delt 1.5% del(17p) neg c.128delt 4.2% p.r248q 1.5% Convergent mutated subclones occur in parallel Jehtwa et al., 2013; Malcikova et al Jitka Malcikova, Jana Kotaskova

14 TP53 Next Generation Sequencing Standalone assay or gene panel Amplicon-based or capture-based Unique molecular identifiers (UMI) may be helpful Minimum limit of detection Sanger seq, i.e. 10% or less Corresponding coverage at all analyzed positions (to reach at least 10 reads per variant) and DNA/allelic input (6 pg per human cell) FALSE NEGATIVE RESULTS Low/non-uniform coverage Low DNA input or quality sampling effect Inefficient capture low DNA input Variant excluded/not recognized by bioinformatics pipeline (suboptimal alignment or variant calling) FALSE POSITIVE RESULTS Background noise are higher than your expectations Sequencing errors PCR errors Non-proof reading polymerase DNA from FFPE False variant created or not excluded during bioinformatics pipeline library preparation sequencing bioinformatics pipeline manual inspection and interpretation

15 Sanger sequencing of TP53 gene SEQUENCING PROTOCOL: you may start at IARC p53 WEBSITE ALWAYS SEQUENCE BOTH FORWARD AND REVERSE STRAND IARC p53 website protocol: adaptable, can be modified number of PCR cycles some primers span rare polymorphic sites some primers very close to exon/intron boundary

16 Sanger sequencing of TP53 gene Carefully go through chromatogram not to overlook subclonal variants Free web-based software GLASS available via ERIC website Do not trust software completely and check the sequence manually

17 Variant interpretation: does the variant affect function? CHECK FUNCTIONAL IMPACT OF THE MUTATION IN GENE-SPECIFIC DATABASE (do not use dbsnp) TP53 web site/seshat tool TP53 IARC database p53.iarc.fr IF YOU HAVE DOUBTS (RARE or FUNCTIONAL VARIANT), REPEAT THE ANALYSIS FROM PCR TO EXCLUDE ANALYTICAL ERRORS

18 Variant interpretation: does the variant affect function? SEVERAL WELL-DESCRIBED SNPs / NEUTRAL GERMLINE EXONIC VARIANTS OCCUR IN HUMAN POPULATION:

19 Variant interpretation: does the variant affect function? MOST OTHER VARIANTS DETECTED BY SANGER ARE DELETERIOUS BUT, VARIANTS THAT PROBABLY DOES NOT AFFECT FUNCTION MAY RARELY OCCUR OFTEN GERMLINE - RARE SNPs! c.704a>g: p.asn235ser c.847c>t: p.arg283cys our cases: 4/4 germline no personal or family history of Li-Fraumeni syndrome NEVER REPORT THESE VARIANTS AS PATHOGENIC Ask for non-tumor DNA (buccal swab, T-cells etc.) WT R283C MUT R175H RGC p21 bax RGC p21 bax RGC p21 bax Adapted from Jagosova et al. Int J Oncol 2012

20 Part III From lab to clinician: REPORTING Reporting -clear and precise message from lab to clinician REPORT TEMPLATE see ERIC webpage and ERIC Recommendations on TP53 Analysis GIVE CLEAR RESULT - It is preferred not to include common polymorphisms in the report to physicians. REPORT VARIANTS DETECTABLE BY SANGER SEQUENCING AND VARIANTS PRESENT IN >10% VAF IF TESTED BY NGS Reporting variants between 5-10% VAF is acceptable only if explicitly stating that the clinical impact of minor subclonal mutations has not been conclusively documented.! Low VAF in sample with low CCF 5% VAF in sample with 20% CCF corresponds to 25% in sample with 100% purity

21 Part III From lab to clinician: REPORTING Reporting: variant description Use HGVS NOMENCLATURE: Report the cdna and protein level including reference sequence (LRG_321 NM_00546) NGS: pipelines do not often describe dup, ins and dels correctly, always inspect NGS: notice if appropriate reference sequence is used

22 Final note: Publishing and databases Publishing and scientific reporting in databases Do not change patient and sample IDs in various papers duplicities in databases Include genomic coordinates and reference genome List all variants, including synonymous and benign variants

23 THANK YOU FOR ATTENTION Jitka Malčíková Šárka Pospíšilová Michael Doubek Jana Kotašková Yvona Brychtová Lenka Juračková Anna Panovská Marcela Ženatová Jiří Mayer Lenka Kociánová clinical department Renata Hurníková staff Zuzana Bučková Karla Plevová Jana Šmardová Martin Trbušek Boris Tichý Nikola Tom Karol Pál cytogenetic and flowcytometry laboratory TP53 aberrations: Methodical considerations

BASIC PROCEDURES SAMPLING, MATERIAL, SANGER SEQUENCING

BASIC PROCEDURES SAMPLING, MATERIAL, SANGER SEQUENCING Technical aspects of TP53 mutation analysis: BASIC PROCEDURES SAMPLING, MATERIAL, SANGER SEQUENCING Sarka Pavlova University Hospital and Masaryk University, Brno, Czech republic TP53 gene in CLL: KEEP

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

Importance of minor TP53 mutated clones in the clinic

Importance of minor TP53 mutated clones in the clinic Importance of minor TP53 mutated clones in the clinic Davide Rossi, M.D., Ph.D. Hematology IOSI - Oncology Institute of Southern Switzerland IOR - Institute of Oncology Reserach Bellinzona - Switzerland

More information

TP53 mutational profile in CLL : A retrospective study of the FILO group.

TP53 mutational profile in CLL : A retrospective study of the FILO group. TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :

More information

ERIC TP53 Network activities and outcomes. Sarka Pospisilova

ERIC TP53 Network activities and outcomes. Sarka Pospisilova ERIC TP53 Network activities and outcomes Sarka Pospisilova ERIC TP53 NETWORK 11 Training Centres 3 Certifying Centres Uppsala/Stockholm Belfast Copenhagen Amsterdam Paris Ulm Novara Brno Bellinzona Salamanca

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi

THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS Pr. Thierry Soussi thierry.soussi@ki.se thierry.soussi@upmc.fr TP53: 33 YEARS AND COUNTING STRUCTURE FUNCTION RELATIONSHIP OF WILD AND MUTANT TP53 1984

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014

Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014 Issues arising from UKNEQAS schemes Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014 2013 schemes There was great variation in the way HGVS nomenclature was applied Scheme would like

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Please Silence Your Cell Phones. Thank You

Please Silence Your Cell Phones. Thank You Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Research Strategy: 1. Background and Significance

Research Strategy: 1. Background and Significance Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity

More information

Update on the ERIC TP53 Network Activities and TP53 Certification Overview and Results of Round 4

Update on the ERIC TP53 Network Activities and TP53 Certification Overview and Results of Round 4 Update on the ERIC TP53 Network Activities and TP53 Certification Overview and Results of Round 4 Sarka Pospisilova Jitka Malcikova CEITEC, Masaryk University and University Hospital Brno, Czech Republic

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC. Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the

More information

Introduction. Introduction

Introduction. Introduction Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts

More information

A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis

A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown

More information

Molecular Pathology Evaluation Panel and Molecular Pathology Consortium Advice Note

Molecular Pathology Evaluation Panel and Molecular Pathology Consortium Advice Note Molecular Pathology Evaluation Panel and Molecular Pathology Consortium Advice Note MPEP/MPC Advice Note 2016-02 June 2016 Test evaluated: Tumour Protein p53 (TP53) Molecular Pathology Evaluation Panel

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy

Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant

More information

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix. SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:

More information

Variant Classification: ACMG recommendations. Andreas Laner MGZ München

Variant Classification: ACMG recommendations. Andreas Laner MGZ München Variant Classification: ACMG recommendations Andreas Laner MGZ München laner@mgz-muenchen.de OVERVIEW Introduction ACMG-AMP Classification System Evaluation of inter-laboratory concordance in variant classification

More information

Initial Diagnosis and Treatment 81 Male

Initial Diagnosis and Treatment 81 Male Case SH2017-0359 Shiraz Fidai 1, Sandeep Gurbuxani 1, Girish Venkataraman 1, Gordana Raca 2, Madina Sukhanova 3, Michelle M Le Beau 3, Y. Lynn Wang 4, Mir Alikhan 4, Megan M.McNerney 4, Yuri Kobzev 4,

More information

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

ERIC recommendations for TP53 mutation analysis in chronic lymphocytic leukemia-update on methodological approaches and results interpretation

ERIC recommendations for TP53 mutation analysis in chronic lymphocytic leukemia-update on methodological approaches and results interpretation Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2018 ERIC recommendations for TP53 mutation analysis in chronic lymphocytic

More information

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech

More information

Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first

Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase

More information

Next Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory

Next Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory Next Generation Sequencing in Haematological Malignancy: A European Perspective Wolfgang Kern, Munich Leukemia Laboratory Diagnostic Methods Cytomorphology Cytogenetics Immunophenotype Histology FISH Molecular

More information

COMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI)

COMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI) COMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI) Kevin D McCormick; Kerri J Penrose; Rahil Sethi; Jacob Waldman; William Schwarzmann; Uma Chandran;

More information

MRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.

MRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53. SALSA MLPA probemix P056-C1 TP53 Lot C1-0215 & lot C1-0214. As compared to version B1 (lot B1-1011) most of the reference and flanking probes have been replaced and several have been added. Furthermore,

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra54/dc1 Supplementary Materials for Clonal status of actionable driver events and the timing of mutational processes in cancer evolution

More information

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow

More information

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%) Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999

More information

Variant Classification: ACMG recommendations. Andreas Laner MGZ München

Variant Classification: ACMG recommendations. Andreas Laner MGZ München Variant Classification: ACMG recommendations Andreas Laner MGZ München laner@mgz-muenchen.de Overview Introduction ACMG-AMP Classification System Evaluation of inter-laboratory concordance in variant classification

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow

More information

Author Version: Published ahead of online first

Author Version: Published ahead of online first AUTHOR VERSION Author Version: Published ahead of online first ERIC recommendations for TP53 mutation analysis in chronic lymphocytic leukemia update on methodological approaches and results interpretation

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

Cell-free tumor DNA for cancer monitoring

Cell-free tumor DNA for cancer monitoring Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

Laboratory Service Report

Laboratory Service Report Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic

More information

Hematopathology Service Memorial Sloan Kettering Cancer Center, New York

Hematopathology Service Memorial Sloan Kettering Cancer Center, New York SH2017-0334 t(14;18) Negative Follicular Lymphoma with 1p36 abnormality associated with In Situ Follicular Neoplasia with t(14;18) translocation Pallavi Khattar MD, Jennifer Maerki MD, Alexander Chan MD,

More information

Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA

Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for

More information

OncoPhase: Quantification of somatic mutation cellular prevalence using phase information

OncoPhase: Quantification of somatic mutation cellular prevalence using phase information OncoPhase: Quantification of somatic mutation cellular prevalence using phase information Donatien Chedom-Fotso 1, 2, 3, Ahmed Ashour Ahmed 1, 2, and Christopher Yau 3, 4 1 Ovarian Cancer Cell Laboratory,

More information

The Human Major Histocompatibility Complex

The Human Major Histocompatibility Complex The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure

More information

Supplementary information to:

Supplementary information to: Supplementary information to: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin Embedded Tumors by Next Generation Sequencing Authors

More information

Cancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16

Cancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer Validation in the 100,000 genomes project Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer is a lesion of the Genome Diagnosis Cancer Molecular Lesions Prognosis Disease Monitoring Why is

More information

Implementation of BRCA Oncomine panel for germline and somatic variant analysis

Implementation of BRCA Oncomine panel for germline and somatic variant analysis Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University

More information

Enterprise Interest Thermo Fisher Scientific / Employee

Enterprise Interest Thermo Fisher Scientific / Employee Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical

More information

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae

More information

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences

More information

TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations.

TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations. Supplementary Figure 1 TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations. The CpG motifs closest to the breakpoints are highlighted in red boxes and the

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Minimal residual disease of CLL in our everyday hematological practice

Minimal residual disease of CLL in our everyday hematological practice Minimal residual disease of CLL in our everyday hematological practice M. Doubek, J. Chovancová, B. Tichý, O. Stehlíková, H. Francová Skuhrová, M. Klabusay, K. Malinová, M. Krejčí, Y. Brychtová, Š. Pospíšilová,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Liquid biopsy in lung cancer: The EGFR paradigm

Liquid biopsy in lung cancer: The EGFR paradigm Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

REAL LIFE AMBULATORIALE E STUDI CLINICI RANDOMIZZATI NELLA PROGRAMMAZIONE TERAPEUTICA DELLA LEUCEMIA LINFATICA CRONICA.

REAL LIFE AMBULATORIALE E STUDI CLINICI RANDOMIZZATI NELLA PROGRAMMAZIONE TERAPEUTICA DELLA LEUCEMIA LINFATICA CRONICA. REAL LIFE AMBULATORIALE E STUDI CLINICI RANDOMIZZATI NELLA PROGRAMMAZIONE TERAPEUTICA DELLA LEUCEMIA LINFATICA CRONICA Roberta Murru Struttura Complessa Ematologia e Centro Trapianti Presidio Ospedaliero

More information

Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS

Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS Comprehensive Testing for Constitutional/Mosaic Mutations with Deep Coverage via NGS NF1/SPRED1 and Other RASopathy Related Conditions NF1 only NGS testing and copy number analysis for the NF1 gene (NF1

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

PG-Seq NGS Kit for Preimplantation Genetic Screening

PG-Seq NGS Kit for Preimplantation Genetic Screening Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances

More information

Internal Validation Guide of Y-STR Systems for Forensic Laboratories Printed in USA. 11/12 Part# GE713

Internal Validation Guide of Y-STR Systems for Forensic Laboratories Printed in USA. 11/12 Part# GE713 REFERENCE MANUAL Internal Validation Guide of Y-STR Systems for Forensic Laboratories 11/12 Internal Validation Guide of Y-STR Systems for Forensic Laboratories PLEASE DISCARD PREVIOUS VERSIONS. All technical

More information

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary

More information

RNA-Seq guided gene therapy for vision loss. Michael H. Farkas

RNA-Seq guided gene therapy for vision loss. Michael H. Farkas RNA-Seq guided gene therapy for vision loss Michael H. Farkas The retina is a complex tissue Many cell types Neural retina vs. RPE Each highly dependent on the other Graw, Nature Reviews Genetics, 2003

More information

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:

More information

MRC-Holland MLPA. Description version 18; 09 September 2015

MRC-Holland MLPA. Description version 18; 09 September 2015 SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the

More information

Rapid genomic screening of embryos using nanopore sequencing

Rapid genomic screening of embryos using nanopore sequencing Rapid genomic screening of embryos using nanopore sequencing Daniel J Turner, PhD Senior Director of Applications Oxford Nanopore Technologies Forman EJ & Scott RT Jr Contemporary OB/GYN () 2014 Euploid

More information

Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source

Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. Introduction

More information

CLL Complete SM Report

CLL Complete SM Report Reported: 02/01/2012 Σ CGI ID No:5 Client:r Client Address: CLINICAL DATA: Lymphoma No CBC results provided. CLL Complete SM Report FINAL DIAGNOSIS: CD19+ B cell lymphoma, ZAP-70 + (44%), with borderline

More information

NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE. Single Technology Appraisal. Ibrutinib for treating chronic lymphocytic leukaemia.

NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE. Single Technology Appraisal. Ibrutinib for treating chronic lymphocytic leukaemia. NATIONAL INSTITUTE FOR HEALTH AND CARE EXCELLENCE Single Technology Appraisal Ibrutinib for treating chronic lymphocytic leukaemia Final scope Remit/appraisal objective To appraise the clinical and cost

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information

More information

Product # Kit Components

Product # Kit Components 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information

More information

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

Circulating Tumor DNA in GIST and its Implications on Treatment

Circulating Tumor DNA in GIST and its Implications on Treatment Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing

More information

CLL Biology and Initial Management. Gordon D. Ginder, MD Director, Massey Cancer Center Lipman Chair in Oncology

CLL Biology and Initial Management. Gordon D. Ginder, MD Director, Massey Cancer Center Lipman Chair in Oncology CLL Biology and Initial Management Gordon D. Ginder, MD Director, Massey Cancer Center Lipman Chair in Oncology CLL- Epidemiology Most common adult leukemia 25-30% in western world Incidence in US 4.5

More information

MRC-Holland MLPA. Description version 06; 23 December 2016

MRC-Holland MLPA. Description version 06; 23 December 2016 SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated

More information

Submitting Laboratory: London NE RGC GOSH

Submitting Laboratory: London NE RGC GOSH Submitting laboratory: London NE RGC GOSH 1. Disorder/condition approved name (please provide UK spelling if different from US) and symbol as published on the OMIM database (alternative names will be listed

More information