Performance Characteristics BRCA MASTR Plus Dx
|
|
- Paul Norton
- 6 years ago
- Views:
Transcription
1 Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan Niel Belgium
2 Table of Contents 1. Workflow Performance Characteristics of BRCA MASTR Plus workflow (Somatic Application) Samples Study Design Success Rate and On-Target Read Counts Limit of Detection Sensitivity, Specificity and Accuracy Repeatability and Reproducibility Lot Equivalence Disclaimer PERFORMANCE CHARACTERISTICS of BRCA MASTR Plus Dx workflow (Germline Samples Study Design Success Rate and On-Target Read Counts Sensitivity, Specificity and Accuracy Repeatability and Reproducibility Lot Equivalence Disclaimer List of Figures Figure 1: graphic representation of the MASTR workflow... 4 List of Tables Table 1: Composition proficiency panel... 5 Table 2: Expected VAF for the proficiency panel... 5 Table 3: PES design... 6 Table 4: Instrumentation used at the different study sites... 6 Table 5: Sensitivity, specificity and accuracy at 5 % VAFsample... 7 Table 6: Repeatability at 5 % VAFsample... 8 Table 7: Reproducibility at 5 % VAFsample... 8 Table 8: Repeatability of BRCA MASTR Plus Dx assay. For each proficiency sample, the mean VAF and the coefficient of variation (CV) are shown per variant Table 9: Reproducibility of BRCA MASTR Plus Dx assay. For each proficiency sample, the mean VAF and the CV are shown per variant Table 10: Reproducibility of BRCA MASTR Plus Dx assay. For each proficiency sample, the mean VAF and the CV are shown per variant. (continued)... 9 Table 11: Lot equivalence at 5 % VAFsample... 9 Revision date: August 23, 2017 Page 2 of 15
3 Table 12: PES design of the HMW samples assayed with BRCA MASTR Plus Dx in combination with Illumina MiSeq platform Table 13: PES design of the HMW samples assayed with BRCA MASTR Plus Dx in combination with Illumina MiniSeq platform Table 14: PES design of the HMW samples assayed with BRCA MASTR Plus Dx in combination with Illumina NextSeq platform Table 15: Instrumentation used in the PES Table 16: Success rate and on-target read counts Table 17: Estimated sensitivity, specificity and accuracy of the BRCA MASTR Plus on the Illumina MiSeq, MiniSeq and.. 14 Table 18: Repeatability of the BRCA MASTR Plus on the Illumina MiSeq, MiniSeq and NextSeq Table 19: Reproducibility of the BRCA MASTR Plus on the Illumina MiSeq, MiniSeq and NextSeq Abbreviations CV coefficient of variation DQC DNA quality coefficient FFPE formalin-fixed paraffin-embedded FN false negative FP false positive GIAB Genome In A Bottle HP homopolymer IFU instructions for use IGV integrative genomics viewer indels insertions and/or deletions IVD For In Vitro Diagnostic Use LOD limit of detection MASTR multiplex amplification of specific targets for re-sequencing NGS Next-Generation Sequencing PES performance evaluation study SNV single nucleotide variation TN true negative TP true positive VAF variant allele frequency Revision date: August 23, 2017 Page 3 of 15
4 1. WORKFLOW Figure 1: graphic representation of the MASTR workflow Revision date: August 23, 2017 Page 4 of 15
5 2. PERFORMANCE CHARACTERISTICS OF BRCA MASTR PLUS WORKFLOW (SOMATIC APPLICATION) 2.1. Samples The study population comprised 54 FFPE-derived DNA extracts from 51 clinical and 3 proficiency samples. The clinical samples were derived from 42 ovarian cancers, 4 breast cancers, 3 tonsillar cancers, 1 colon cancer and 1 fallopian tube cancer. Different DNA extraction kits were used to obtain DNA from the FFPE tumor tissue: QIAamp FFPE DNA tissue (Qiagen), QIAsymphony DSP DNA Mini Kit (Qiagen) and iprep ChargeSwitch Forensic kit (Life technologies). DNA extracts were subjected to the QC Plex (Multiplicom, QC ), those showing a DQC value 0.1 were included, indicating sufficient DNA quality for reliable amplification and sequencing. DNA was of excellent (5 samples), good (15 samples) or acceptable DNA quality (31 samples). The proficiency panel (Mix 1-3) was based on 3 Genome In A Bottle (GIAB) FFPE sections (Horizon Discovery). At Multiplicom, DNA was extracted from the FFPE sections using the QIAamp DNA FFPE Tissue Kit. The extracted DNA was mixed to obtain variants in a broad VAF range (5-100 %) (Table 1 and 2). Table 1: Composition proficiency panel GIAB samples NIST ID Coriell ID Reference Standard Horizon Discovery HG003 GM24149 Ashkenazim PGP Father - FFPE Reference Standard HG004 GM24143 Ashkenazim PGP Mother - FFPE Reference Standard HG005 GM24631 Asian PGP Son - FFPE Reference Standard Percentage GIAB sample per proficiency sample Mix 1 Mix 2 Mix 3 10 % 15 % 20 % 80 % 70 % 60 % 10 % 15 % 20 % Table 2: Expected VAF for the proficiency panel Variant Expected VAF Chrom pos rs number Mix 1 Mix 2 Mix 3 chr13: t>c rs % 7.5 % 10 % chr13: a>g rs % 7.5 % 10 % chr17: t>c rs % 15 % 20 % chr17: a>g rs % 15 % 20 % chr17: t>c rs % 15 % 20 % chr17: a>g rs % 15 % 20 % chr17: t>c rs % 15 % 20 % chr17: g>a rs % 15 % 20 % chr17: g>a rs % 15 % 20 % chr13: c>t rs % 42.5 % 40 % chr13: a>g rs % 92.5 % 90 % chr13: a>g rs % 92.5 % 90 % Revision date: August 23, 2017 Page 5 of 15
6 2.2. Study Design Three genetic centers (study sites SS1-3) performed the entire BRCA MASTR Plus Dx workflow on a total of 23 samples per site (Table 23). The PES assessed the performance of BRCA MASTR Plus Dx to detect SNVs and small indels for 5 % VAFsample, thus taking into account: (i) sequencing depth, (ii) expected VAF of the proficiency panel, (iii) data analysis settings. Table 3: PES design SS1 SS2 SS3 3 proficiency samples in triplicate 13 clinical samples (1 in duplicate) 3 proficiency samples 19 clinical samples (1 in duplicate) Illumina MiSeq platform Illumina MiSeq Reagent Kit v3 (600 cycles, run at 2x251bp) Sequencing Different instrumentation was used at the different study sites. Table 4: Instrumentation used at the different study sites depth for 5 % VAF sample 23 samples/run: ± 905,000 read pairs/sample 2 lots BRCA MASTR Plus Dx 1 lot MID Dx 1-48 for Illumina MiSeq 3 proficiency samples 19 clinical samples (1 in duplicate) Instrument SS1 SS2 SS3 Thermal cycler 9700 (Applied Biosystems) SimpliAmp (Applied Biosystems) Fragment analyzer 3130XL (Applied Biosystems) 3130XL (Applied Biosystems) C1000 Biorad (Bio-Rad) 3130XL (Applied Biosystems) Data analysis was performed with the SeqNext module version (JSI Medical Systems) and the Sophia DDM platform (ILL1MR1S5_BRCA_Tumorv2). The target region was defined as the BRCA1 and BRCA2 coding regions +/- 2 bp Success Rate and On-Target Read Counts The success rate of the BRCA MASTR Plus Dx is defined as the percentage of amplicons that show at least 0.2 x the mean amplicon coverage. The percentage of generated reads with a length of 60 bp or more that map back to the amplicons determines the on-target read counts. Of the 69 samples, one sample did not result in a measurable amplicon library and was not sequenced. The overall success rate of BRCA MASTR Plus Dx is 93.9 % (90.6 % 95.7 %). The on-target read count of BRCA MASTR Plus Dx is 99.1 % (98.5 % 99.5 %) Limit of Detection The limit of detection is defined as the lowest VAF that can be distinguished from the background, determined as the maximum measured noise over all target bases in all samples + 3 x standard deviation. The limit of detection of BRCA MASTR Plus Dx is 1 %. The LOD for variants in HP of 6, 7 or 8 bases is 3, 5 and 9 %, respectively. Revision date: August 23, 2017 Page 6 of 15
7 2.5. Sensitivity, Specificity and Accuracy Sensitivity is calculated as TP / (TP + FN). Specificity is calculated as TN / (TN + FP). Accuracy is calculated as (TP + TN)/ (TP+FP+FN+TN) with: True positive (TP): variant call based on BRCA MASTR Plus Dx data and on reference data in case of sufficient coverage (at least 50/VAF) True negative (TN): no variant in BRCA MASTR Plus Dx data or reference data in case of sufficient coverage (at least 50/VAFsample ) False positive (FP): variant call based on BRCA MASTR Plus Dx data but absent in reference data, in case of sufficient coverage (at least 50/VAF) False negative (FN): no variant in BRCA MASTR Plus Dx data but variant called in reference data, in case of sufficient coverage (at least 50/VAFsample ) Each clinical sample contributed once to these performance characteristics. For three clinical samples analyzed in duplicate, the replicate that performed worst was included. Since none of these samples showed FNs or FPs, the replicate with the lowest number of TNs was included. Of the 51 clinical samples that were included in the study, one sample was not sequenced because it did not result in a measurable amplicon library and one sample showed very low read counts. In total, 49 clinical samples contributed to the calculation of sensitivity, specificity and accuracy. GeneRead DNAseq Targeted Panels V2 - Human BRCA1 and BRCA2 Panel (Qiagen) was used as a targeted resequencing- based reference method. The true status of a variant is defined based on the GeneRead results in combination with the analysis of mapped raw read counts using integrative genomics viewer (IGV). Table 5: Sensitivity, specificity and accuracy at 5 % VAFsample SeqNext Sophia DDM TP FN 0 0 FP 1 * 0 TN 691, ,607 Sensitivity % [95 % CI %] % [95 % CI %] Specificity % [95 % CI %] % [95 % CI %] Accuracy % [95 % CI %] % [95 % CI %] * SeqNext reported a true positive 10 bp insertion with a VAF of 84 % at 75 %. Additionally, a false positive base change at 8 % was called at the same position Repeatability and Reproducibility Repeatability and reproducibility are defined as the number of concordant bases over the total number of bases. For each variant of the proficiency samples, the variability of the VAF is calculated (coefficient of variation (CV)). Only regions with a coverage of 50/VAFsample or higher are included. Repeatability is determined using three proficiency samples analyzed in triplicate at the same site. Reproducibility is determined using three proficiency samples analyzed at different sites. Since one site performed the same analysis in triplicate, the analysis that generated the highest discordance determines the reproducibility. Revision date: August 23, 2017 Page 7 of 15
8 Table 6: Repeatability at 5 % VAFsample SeqNext Sophia DDM Proficiency sample Concordant bases Discordant bases Concordant bases Discordant bases Mix 1 16, ,041 0 Mix 2 16, ,041 0 Mix 3 16,039 2 * 16,041 0 Repeatability % [95 % CI %] % [95 % CI %] * rs and rs both at ± 5 % did not appear in filtered variant list due to the data analysis settings (VAF sample 5 %, VAF: 4 %). Table 7: Reproducibility at 5 % VAFsample SeqNext Sophia DDM Proficiency sample Concordant bases Discordant bases Concordant bases Discordant bases Mix 1 16, ,041 0 Mix 2 15, ,067 0 Mix 3 16,039 2 * 16,041 0 Reproducibility % [95 % CI %] % [95 % CI %] * rs and rs both at ± 5 % did not appear in filtered variant list due to the data analysis settings (VAF sample 5 %, VAF: 4 %). Table 8: Repeatability of BRCA MASTR Plus Dx assay. For each proficiency sample, the mean VAF and the coefficient of variation (CV) are shown per variant. Variant Mix 1 Mix 2 Mix 3 Chrom pos rs number Mean VAF CV Mean VAF CV Mean VAF CV chr13: t>c rs % % 7.50 % 7.87 % % 5.09 % chr13: a>g rs % % 7.00 % 7.87 % % 5.41 % chr17: t>c rs % 4.33 % % 5.68 % % 0.00 % chr17: a>g rs % 4.33 % % 0.00 % % 2.37 % chr17: t>c rs % 5.41 % % 8.65 % % 4.55 % chr17: a>g rs % 9.90 % % 3.27 % % 0.00 % chr17: t>c rs % 8.33 % % 5.68 % % 2.47 % chr17: g>a rs % 5.41 % % 7.90 % % 2.55 % chr17: g>a rs % 4.56 % % 3.33 % % 2.47 % chr13: c>t rs % 1.30 % % 1.33 % % 2.50 % chr13: a>g rs % 0.00 % % 0.63 % % 0.65 % chr13: a>g rs % 0.61 % % 0.63 % % 0.64 % Revision date: August 23, 2017 Page 8 of 15
9 Table 9: Reproducibility of BRCA MASTR Plus Dx assay. For each proficiency sample, the mean VAF and the CV are shown per variant. Variant Mix 1 Mix 2 Mix 3 Chrom pos rs number Mean VAF CV Mean VAF CV Mean VAF CV chr13: t>c rs % % 6.33 % % % 9.09 % chr13: a>g rs % % 7.00 % % % 9.09 % chr17: t>c rs % 7.69 % % % % 2.28 % chr17: a>g rs % 9.12 % % % % 0.00 % Table 10: Reproducibility of BRCA MASTR Plus Dx assay. For each proficiency sample, the mean VAF and the CV are shown per variant. (continued) Variant Mix 1 Mix 2 Mix 3 Chrom pos rs number Mean VAF CV Mean VAF CV Mean VAF CV chr17: t>c rs % 0.00 % % % % 2.55 % chr17: a>g rs % 5.09 % % % % 0.00 % chr17: t>c rs % 4.95 % % % % 2.44 % chr17: g>a rs % 5.09 % % % % 2.47 % chr17: g>a rs % 4.56 % % % % 2.55 % chr13: c>t rs % 3.85 % % 6.01 % % 0.00 % chr13: a>g rs % 0.00 % % 1.65 % % 1.29 % chr13: a>g rs % 1.22 % % 0.00 % % 1.12 % 2.7. Lot Equivalence The lot equivalence is described as the number of concordant bases over the total number of bases. Lot equivalence is determined based on a clinical sample processed in duplicate using BRCA MASTR Plus Dx kits from two lots at each site. Table 11: Lot equivalence at 5 % VAFsample SeqNext Sophia DDM Clinical sample Concordant bases Discordant bases Concordant bases Discordant bases S1 13, ,433 0 S2 14, ,796 0 S3 14, ,584 0 Lot equivalence 100 % [95 % CI %] 100 % [95 % CI %] Revision date: August 23, 2017 Page 9 of 15
10 2.8. Disclaimer The purchase of this product enables the purchaser to use it for the amplification of nucleic acid sequences for human genes (BRCA MASTR Plus Dx) and of BRCA MASTR Plus Dx-derived amplicons (drmid Dx for Illumina NGS systems kits). The purchaser has to take into account that information obtained from amplicons generated using this product may not be used in procedures that are protected by valid claims owned and/or controlled by a third party, unless prior written approval of such party has been obtained. IVD product performance claims apply only when combining BRCA MASTR Plus Dx and drmid Dx for Illumina NGS systems and when both CE-Mark kits are used according to this CE-IVD IFU. The BRCA MASTR Plus Dx has been designed for SNV, small indels and CNV analysis on high molecular weight (HMW) DNA and for SNV and small indels analysis on FFPE-derived DNA. The kit has been validated only for analysis of SNV and small indels using a VAFsample 5 % on FFPE-derived DNA in combination with Illumina MiSeq systems. Revision date: August 23, 2017 Page 10 of 15
11 3. PERFORMANCE CHARACTERISTICS OF BRCA MASTR PLUS DX WORKflOW (GERMLINE Application) 3.1. Samples The study population comprised 49 high-molecular weight (HMW)-derived DNA extracts from 45 blood clinical and 4 proficiency samples. Clinical samples were derived from 45 individuals selected to contain a pathogenic BRCA mutation. Different DNA extraction methods were used to obtain DNA from blood: Genomic Midi Kit AX (AA Biotechnology) and Phenol/chloroform extraction methods. DNA samples were measured using spectrophotometry (Nanodrop ND-1000) and fulfilled all requirements for DNA extracted from blood. The proficiency panel (NA10863, NA11993, NA10838, NA10838 and NA12005) was based on HMW samples from the Coriell Institute for Medical Research. These samples were used to determine the repeatability and reproducibility of the BRCA MASTR Plus Study Design The entire BRCA MASTR Plus Dx workflow was performed in one genetic center, on a total of 45 blood-derived samples and 4 proficiency samples. The PES assessed the performance of BRCA MASTR Plus to detect SNVs and small indels on bloodderived DNA on the Illumina MiSeq, NextSeq and MiniSeq sequencing platforms. Performance characteristics were determined for the BRCA MASTR Plus on Illumina MiSeq, NextSeq and MiniSeq. The same study design was used for all 3 Illumina sequencing platforms (Table 12, Table 13 and Table 14). The same sequencing libraries were processed on Illumina MiSeq, MiniSeq and NextSeq platforms. Table 12: PES design of the HMW samples assayed with BRCA MASTR Plus Dx in combination with Illumina MiSeq platform Run1 Run2 4 proficiency samples in triplicate 4 proficiency samples 45 clinical samples Illumina MiSeq platform Illumina MiSeq Reagent Kit v3 (600 cycles) Run at 2x251bp Minimum coverage per sample (73,000 read pairs) 1 lot BRCA MASTR Plus Dx 1 lot drmid 1-48 for Illumina NGS systems 1 lot drmid for Illumina NGS systems Revision date: August 23, 2017 Page 11 of 15
12 Table 13: PES design of the HMW samples assayed with BRCA MASTR Plus Dx in combination with Illumina MiniSeq platform Run1 4 proficiency samples in triplicate 45 clinical samples Illumina MiniSeq platform Illumina MiniSeq Mid-Output kit (300 cycles) Run at 2x151bp Minimum coverage per sample (73,000 read pairs) 1 lot BRCA MASTR Plus Dx 1 lot drmid 1-48 for Illumina NGS systems 1 lot drmid for Illumina NGS systems Run2 4 proficiency samples Table 14: PES design of the HMW samples assayed with BRCA MASTR Plus Dx in combination with Illumina NextSeq platform Run1 4 proficiency samples in triplicate 45 clinical samples Illumina NextSeq platform Run2 4 proficiency samples Illumina NextSeq 500/550 v2 Mid-Output kit (300 cycles) Run at 2x151bp Minimum coverage per sample (73,000 read pairs) 1 lot BRCA MASTR Plus Dx 1 lot drmid 1-48 for Illumina NGS systems 1 lot drmid for Illumina NGS systems The instruments used in the PES are described in Table 15. Table 15: Instrumentation used in the PES Instruments Thermal Cycler Fragment Analyzer Spectrophotometer NGS system Details Veriti (Applied Biosystems) 3130XL (Applied Biosystems) Dropsense (Trinean) MiSeq, NextSeq, MiniSeq (Illumina) Data analysis was performed with the Multiplicom MASTR Reporter software. The target region was defined as the BRCA1 and BRCA2 coding regions +/- 30 bp. FASTQ files were downsized to allow analysis at 50 % VAF. Revision date: August 23, 2017 Page 12 of 15
13 3.3. Success Rate and On-Target Read Counts The success rate of the BRCA MASTR Plus Dx is defined as the percentage of amplicons that show at least 0.2 x the mean amplicon coverage. The percentage of generated reads with a length of 60 bp or more that are correctly allocated to the amplicons determines the on-target read counts. The success rate was determined on all 45 blood-derived clinical samples and in the replicates of the 4 proficiency samples, included in MiSeq Run 1, NextSeq Run 1 and MiniSeq Run 1. The success rate and on-target read counts of BRCA MASTR Plus Dx on the Illumina platforms is described in Table 16. Table 16: Success rate and on-target read counts Illumina Platform Success Rate On-target read counts MiSeq % % MiniSeq % % NextSeq % % 3.4. Sensitivity, Specificity and Accuracy Sensitivity is calculated as TP / (TP + FN). Specificity is calculated as TN / (TN + FP). Accuracy is calculated as (TP + TN)/ (TP+FP+FN+TN) with: TP: variant call based on BRCA MASTR Plus Dx data and on reference data in case of sufficient coverage (at least 20/VAF) TN: no variant in BRCA MASTR Plus Dx data or reference data in case of sufficient coverage (at least 40x) FP: variant call based on BRCA MASTR Plus Dx data but absent in reference data, in case of sufficient coverage (at least 20/VAF) FN: no variant in BRCA MASTR Plus Dx data but variant called in reference data, in case of sufficient coverage (at least 40x) In total, 45 clinical samples contributed to the calculation of sensitivity, specificity and accuracy. BRCA MASTR Dx (Multiplicom) was used as targeted resequencing-based reference method. Revision date: August 23, 2017 Page 13 of 15
14 Table 17: Estimated sensitivity, specificity and accuracy of the BRCA MASTR Plus on the Illumina MiSeq, MiniSeq and Illumina Sequencing Platform MiSeq MiniSeq NextSeq TP FN FP 0 1* 0 TN 834, , ,709 Sensitivity % [95 % CI %] % [95 % CI %] % [95 % CI %] Specificity % [95 % CI %] % [95 % CI %] % [95 % CI %] Accuracy % [95 % CI %] % [95 % CI %] % [95 % CI %] * MASTR Reporter reported one FP in the evaluation of the MiniSeq data. The FP is a result of a PCR stutter pattern caused by a heteropolymer constituted by a repeat of the CA dinucleotide, with the FP variant called at the start of the heteropolymer Repeatability and Reproducibility Repeatability (intra-run variability) and reproducibility (inter-run variability) are defined as the number of concordant bases over the total number of bases. Only regions with a coverage of 20/VAFsample or higher are included. Repeatability was determined using four proficiency samples analyzed in triplicate in MiSeq Run 1, NextSeq Run 1 and MiniSeq Run 1 (Table 18). Reproducibility was determined using four proficiency samples analyzed in Runs 1 and 2. The analysis that generated the highest discordance results in MiSeq Run 1, NextSeq Run 1 and MiniSeq Run 1 was included in the determination of the reproducibility (Table 19). Table 18: Repeatability of the BRCA MASTR Plus on the Illumina MiSeq, MiniSeq and NextSeq Illumina Platform Concordant bases Discordant bases Repeatability MiSeq 75, % [95 % CI %] MiniSeq 74, % [95 % CI %] NextSeq 74, % [95 % CI %] Table 19: Reproducibility of the BRCA MASTR Plus on the Illumina MiSeq, MiniSeq and NextSeq Illumina Platform Concordant bases Discordant bases Repeatability MiSeq 74, % [95 % CI %] MiniSeq 74, % [95 % CI %] NextSeq 74, % [95 % CI %] 3.6. Lot Equivalence The lot equivalence is described as the number of concordant bases over the total number of bases. Please refer to section ( ) for details of the lot equivalence of the BRCA MASTR Plus Dx. Revision date: August 23, 2017 Page 14 of 15
15 3.7. Disclaimer The purchase of this product enables the customer to use it for the amplification of nucleic acid sequences for human genes (BRCA MASTR Plus Dx) and of BRCA MASTR Plus Dx-derived amplicons (drmid Dx for Illumina NGS systems kits). The customer has to take into account that information obtained from amplicons generated using this product may not be used in procedures that are protected by valid claims owned and/or controlled by a third party, unless prior written approval of such party has been obtained. IVD product performance claims are only applicable when BRCA MASTR Plus Dx is performed in combination with drmid Dx for Illumina NGS systems (MiSeq, NextSeq and MiniSeq) and MASTR Reporter Software and when both CE-Mark kits are used according to this CE-IVD IFU. The BRCA MASTR Plus Dx has been designed for SNV, small indels and CNV analysis on blood-derived DNA. The kit has been validated only for analysis of SNV and small indels on blood-derived DNA in combination with Illumina NGS systems (MiSeq, NextSeq and MiniSeq) and data-analysis with the MASTR Reporter. PUB NUMBER ENN PR NUMBER PR Revision date: August 23, 2017 Page 15 of 15
Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationAccel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationEnabling Personalized
Molecular Enabling Personalized Diagnostics Medicine- Targeted Sequencing: NGS-based solutions Silvia Dorn Roel Reinders- Andreas Diplas Friday, 19.06.2015 Company Overview Founded in April 2011 Development
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationNGS ONCOPANELS: FDA S PERSPECTIVE
NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationNGS IN ONCOLOGY: FDA S PERSPECTIVE
NGS IN ONCOLOGY: FDA S PERSPECTIVE ASQ Biomed/Biotech SIG Event April 26, 2018 Gaithersburg, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration (FDA) Center for
More informationTransform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
More informationImplementation of BRCA Oncomine panel for germline and somatic variant analysis
Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationNational Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant
National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The NSABP Foundation
More informationEnterprise Interest Thermo Fisher Scientific / Employee
Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationQIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
More informationEvaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More information2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationBelow, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology
ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationCase Study. Overview. Deleterious MLH1 mutation detected on sequencing 10/16/2014
The Role of Next Generation Sequencing for Hereditary Cancer Syndromes: A Focus on Endometrial Cancer Laura J. Tafe, MD Assistant Professor of Pathology Assistant Director, Molecular Pathology Dartmouth-Hitchcock
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationPlease Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationAssessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationSeptember 23, The Role of In Vitro Diagnostic Tests in Pediatric Master Protocol Development
The Role of In Vitro Diagnostic Tests in Pediatric Master Protocol Development September 23, 2016 Anand Pathak, MD, PhD, MPH Medical Officer Molecular Genetics Branch Division of Molecular Genetics and
More informationCirculating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications
Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications Martin Schlumpberger, Ass.Director R&D, QIAGEN GmbH IQNpath 2017 - Circulating
More informationPG-Seq NGS Kit for Preimplantation Genetic Screening
Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances
More informationAD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
More informationIntroduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
More informationSimple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
More informationSupplementary Figure 1. Estimation of tumour content
Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationSequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software
Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software C. Hussing, C. Huber, R. Bytyci, H.S. Mogensen, C. Børsting, and N. Morling Section
More informationSupplementary information to:
Supplementary information to: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin Embedded Tumors by Next Generation Sequencing Authors
More informationPerformance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded lung adenocarcinoma samples
Bonfiglio et al. BMC Cancer (2016) 16:692 DOI 10.1186/s12885-016-2720-4 RESEARCH ARTICLE Open Access Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded
More informationBRACAnalysis CDx Technical Information
Myriad Genetics Laboratories, Inc. 320 Wakara Way, Salt Lake City, UT 84108 Phone: 1-800-469-7423 www.myriad.com NOTE: Test results should be communicated to the patient in a setting that includes appropriate
More informationDeep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
More informationAmoyDx TM BRAF V600E Mutation Detection Kit
AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background
More informationThe Next Generation of Hereditary Cancer Testing
The Next Generation of Hereditary Cancer Testing Why Genetic Testing? Cancers can appear to run in families. Often this is due to shared environmental or lifestyle patterns, such as tobacco use. However,
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK NW Thames Regional Genetics Laboratory Northwick Park Hospital Watford Road Harrow HA1 3UJ United Kingdom Contact: Caroline Sullivan Tel:
More informationUtility of liquid biopsies EQA Program Naples, IT Sidney A. Scudder, MD Director, Clinical Science 13 May, 2017
Utility of liquid biopsies EQA Program Naples, IT Sidney A. Scudder, MD Director, Clinical Science 13 May, 2017 picture placeholder Agenda cobas EGFR Mutation Test v2 Ring Trial SQI Semi Quantitative Index
More informationFrequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R
Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB
More informationLiquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
More informationEXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)
Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationQIAsymphony DSP Circulating DNA Kit
QIAsymphony DSP Circulating DNA Kit February 2017 Performance Characteristics 937556 Sample to Insight Contents Performance Characteristics... 4 Basic performance... 4 Run precision... 6 Equivalent performance
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationNew: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
More informationInternal Validation Guide of Y-STR Systems for Forensic Laboratories Printed in USA. 11/12 Part# GE713
REFERENCE MANUAL Internal Validation Guide of Y-STR Systems for Forensic Laboratories 11/12 Internal Validation Guide of Y-STR Systems for Forensic Laboratories PLEASE DISCARD PREVIOUS VERSIONS. All technical
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationDetecting Oncogenic Mutations in Whole Blood
WHITE PAPER Detecting Oncogenic Mutations in Whole Blood Analytical validation of Cynvenio Biosystems LiquidBiopsy circulating tumor cell (CTC) capture and next-generation sequencing (NGS) September 2013
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationTransforming Oncology With Precision Medicine Solutions. Company Overview January 2017
Transforming Oncology With Precision Medicine Solutions Company Overview January 2017 FORWARD-LOOKING STATEMENTS Statements in this presentation about the Company's expectations, applications of its technology,
More informationImportance of Cell Stock Concentration for Accurate Target Cell Recovery
TECHNICAL NOTE Importance of Cell Stock Concentration for Accurate Target Cell Recovery INTRODUCTION 10x Genomics Single Cell Protocols require suspensions of viable, single cells (Single Cell Protocols
More informationSomatic cancer applications of NGS in in vitro Diagnostics.
Somatic cancer applications of NGS in in vitro Diagnostics. Nitin Udar PhD In Vitro Diagnsotics Division Illumina, Inc. 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray,
More informationMRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
More informationSureSelect Cancer All-In-One Custom and Catalog NGS Assays
SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis
More informationLiquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
More informationNature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.
Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationNon-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing
Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing April 11, 2014 By Tony Fong Non-profit diagnostics outfit Paradigm last month joined a growing list of entrants in the clinical
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationPersonalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients
Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs
More informationDetection of copy number variations in PCR-enriched targeted sequencing data
Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation
More informationNew technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationDr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory
Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific
More informationClinical Utility of Actionable Genome Information in Precision Oncology Clinic
Indian Ocean Rim 2017 Laboratory Haematology Congress 2017. 6.18-19, Singapore Clinical Utility of Actionable Genome Information in Precision Oncology Clinic Reimbursement program for NGS panel tests in
More informationCalling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017
1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read
More informationTumor mutational burden and its transition towards the clinic
Tumor mutational burden and its transition towards the clinic G C C A T C A C Wolfram Jochum Institute of Pathology Kantonsspital St.Gallen CH-9007 St.Gallen wolfram.jochum@kssg.ch 30th European Congress
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationDetection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
More informationADVANCED PGT SERVICES
Genomic Prediction ADVANCED PGT SERVICES with PGT-A using SEQ is a cost-effective, rigorously validated, unambiguous, and streamlined test for aneuploidy in blastocyst biopsies, and uses state of the art
More informationCase Studies, or Verification Vignettes
Case Studies, or Verification Vignettes 1 Vignette #1 Change from One Automated AST to Another Your lab is changing from one FDA-cleared automated AST to another Is a verification study required? 2 Yes
More informationVARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN
VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationNext generation diagnostics Bringing high-throughput sequencing into clinical application
Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no
More informationThe feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
More informationISOWN: accurate somatic mutation identification in the absence of normal tissue controls
Kalatskaya et al. Genome Medicine (2017) 9:59 DOI 10.1186/s13073-017-0446-9 SOFTWARE ISOWN: accurate somatic mutation identification in the absence of normal tissue controls Irina Kalatskaya 1*, Quang
More informationComprehensive genomic profiling for various solid tumors
Content Highlight Test Specification Test Content Performance Validation Test Report I II III IV V The NovoPM TM comprehensive cancer genomic profiling test Comprehensive genomic profiling for various
More informationLaboratory Service Report
Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic
More informationWhite Paper. Copy number variant detection. Sample to Insight. August 19, 2015
White Paper Copy number variant detection August 19, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com
More informationCancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16
Cancer Validation in the 100,000 genomes project Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer is a lesion of the Genome Diagnosis Cancer Molecular Lesions Prognosis Disease Monitoring Why is
More informationSupplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
More informationNext generation sequencing analysis - A UK perspective. Nicholas Lea
Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population
More informationPrecision Medicine Resource Guide
VERSION 2.0 ISSUE NO. 1 2016 Precision Medicine Resource Guide The Precision Medicine Resource Guide highlights resources that provide awareness and understanding of this technology. Opinions expressed
More information5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff
5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late
More informationQIAGEN: Sample-to-Insight Success factors for NGS analysis and accurate data interpretation
QIAGEN: Sample-to-Insight Success factors for NGS analysis and accurate data interpretation Dr. Anne Arens & Dr. Jens Winter QIAGEN GmbH Title, Location, Date 1 How to prevent false positives with NGS
More informationPolymer Technology Systems, Inc. CardioChek PA Comparison Study
Polymer Technology Systems, Inc. CardioChek PA Comparison Study Evaluation Protocol: Accuracy Precision Clinical Correlation PTS Panels Lipid Panel Test Strips For Use in Comparisons to a Reference Laboratory
More information