Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer
|
|
|
- Ronald Payne
- 5 years ago
- Views:
Transcription
1 Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Kyle Nakatsuka David Takeda, MD, PhD Lab of William Hahn, M.D., Ph.D. Broad Institute Summer Research Program in Genomics
2 TMPRSS2-ERG in Prostate Cancer TMPRSS2-ERG translocation causes ERG overexpression Expressed in 50% of prostate cancers Invasion, proliferation, survival Targets for prostate cancer therapy
3 Kinase Screen Identifies Potential ERG Modulators Kinase Inhibition High-throughput screen identifies 40 kinases likely to affect ERG Potential upstream modulators of ERG Mechanisms unknown Several are targets of existing kinase-inhibiting drugs
4 Methods Kinase Inhibition Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype
5 PP242 mtor Inhibition Reduces ERG Protein Expression Kinase Inhibition Control PP242 JX401 DMSO 0.1uM 1uM 10uM 1uM 10uM 50uM Reduced protein expression with mtor inhibition by PP242 No significant change in protein expression with other drugs
6 Downstream ERG Targets ARHGDIB mrna Expression 1.2 PLA1A mrna Expression Fold Change kk control pp242 1uM pp242 10uM Treatment Fold Change control pp242 1uM pp242 10uM Treatment
7 PP242 mtor inhibition downregulates ERG downstream target transcription Kinase Inhibition ARHGDIB mrna Expression Fold Change control pp242 1uM pp242 10uM Treatment PLA1A mrna Expression Fold Change control pp242 1uM pp242 10uM Treatment
8 PP242 mtor Inhibition Reduces ERG mrna Expression Kinase Inhibition 2.5 mtor Inhibition and ERG mrna Expression 2 Fold Change control pp242 1uM pp242 10uM Treatment
9 mtor Inhibition Reduces Downstream ERG Target Expression mtor Inhibition and ERG mrna Expression Fold Change control pp242 1 pp Treatment ARHGDIB mrna Expression Downstream ERG Targets 1.2 PLA1A mrna Expression Fold Change Fold Change control pp242 1uM pp242 10uM Treatment 0 control pp242 1uM pp242 10uM Treatment
10 Viability Phenotype Kinase Inhibition Viability (% of initial) PP log(drug concentration) Viability (% of initial) Torin log(drug concentration)
11 Conclusions mtor inhibition reduces ERG protein levels, increases ERG transcription Post-transcriptional ERG modification mtor is an upstream regulator of ERG Potential therapeutic target for ERG overexpressing tumors
12 Future Directions Determine other phenotypic effects Invasion, serum deprivation Confirm result in other mtor inhibitor drugs Mechanism Apply to other transcription factors
13 Acknowledgements Hahn Lab David Takeda William Kim Xiaoxing Wang Diane Shao Elizabeth Dwinell Elsa Beyer Mik Rinne Leo Yao Luo Yaara Zwang William Hahn SRPG Program Bruce Birren Eboney Smith Francie Latour SRPG Students
14 Questions?
15 Results Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Toxicity by kinase inhibition is not specific to ERG PP242 mtor inhibition downregulates ERG protein expression PP242 mtor inhibition upregulates ERG mrna expression PP242 mtor inhibition downregulates ERG downstream target transcription
16 Methods Kinase Inhibition Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype
17 Methods Kinase Inhibition Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype
18 Methods Kinase Inhibition Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype
19
20
21
22 Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Viability by cell titer-glo ATP assay
23 Methods Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype
24 Methods HT kinase screen identifies 40 ERG modulators
25 Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs
26 Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay
27 Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot
28 Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr
29 Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression
30 Methods Hypothesis: If the kinases identified by the shrna screen are involved in the ERG pathway, then their inhibition by drugs will reduce downstream signaling and phenotype
31 Kinase Inhibition and Viabilty IC50 Across Cell types LNCaP VCaP (ERG) PC3 BIX Olaparib JX SB PP Torin nilotnib BX
32 Kinase Inhibition and Viabilty IC50 Across Cell types LNCaP VCaP (ERG) PC3 BIX Olaparib JX SB PP Torin nilotnib BX Kinase inhibition viability phenotype (toxicity) not specific to ERG
33 Kinase Inhibition and Viabilty Kinase inhibition viability phenotype (toxicity) not specific to ERG LNCaP VCaP PC3 BIX Olaparib JX SB PP Torin nilotnib BX
34 Results Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Toxicity by kinase inhibition is not specific to ERG
35 Results Reduced protein expression at 12, 24 hours
36 Results Reduced protein expression at 12, 24 hours
37 Results Reduced protein expression at 12, 24 hours Quantification? Incluir todo con actin?
38 Results Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Toxicity by kinase inhibition is not specific to ERG PP242 mtor inhibition downregulates ERG protein expression
39 PP242 Increases ERG Transcription Kinase Inhibition and ERG mrna Expression Percent Change (%) bix 10 bix 50 jx jx pp242 1 pp SB 10 SB Treatment Drug Inhibits PP242 mtor Measured Effect Increased ERG mrna levels
40 Results Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Toxicity by kinase inhibition is not specific to ERG PP242 mtor inhibition downregulates ERG protein expression PP242 mtor inhibition upregulates ERG mrna expression
41 Kinase Inhibition and ERG Target Transcription PLA1A and ARGHD1B are downstream targets of ERG Kinase Inhibition and ARGHDIB Transcription Kinase Inhibition and PLA1A Transcription Percent Change (%) bix 10uM bix 50uM pp242 1uM pp242 10uM jx401 10uM Treatment jx401 50uM SB 10uM SB 50uM Percent Change (%) bix 10 bix 50 jx jx pp242 1 Treatment pp SB 10 SB 50 Drug Inhibits Measured Effect PP242 mtor Reduced ERG target mrna BIX MEK Increased ERG target mrna
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-14-1-0505 TITLE: Targeting the Neural Microenvironment in Prostate Cancer PRINCIPAL INVESTIGATOR: Michael Ittmann MD PhD CONTRACTING ORGANIZATION: BAYLOR COLLEGE OF MEDICINE HOUSTON,
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine
CANCER THERAPEUTICS: A NOVEL APPROACH
CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
Molecular Heterogeneity of High Gleason Prostate Cancer
Molecular Heterogeneity of High Gleason Prostate Cancer Aliccia Bollig-Fischer, PhD Assistant Professor Department of Oncology Karmanos Cancer Institute Wayne State University Detroit, Michigan, USA Disclosure
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
BIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
CONTRACTING ORGANIZATION: Sloan Kettering Institute for Cancer Research New York, NY 10065
AWARD NUMBER: W81XWH-15-1-0277 TITLE: ERF is a Potential ERK-Modulated Tumor Suppressor in Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Rohit Bose CONTRACTING ORGANIZATION: Sloan Kettering Institute for
ISOGENIC CELL LINES. ATCC No. Designation Mutation Parental Cell Line Disease Cancer Model
THE ESSENTILS OF LIFE SCIENCE RESERCH GLOLLY DELIVERED ISOGENIC CELL LINES TCC CRISPR/CS9 GENE-EDITED ISOGENIC CELL LINES Clinically relevant cell models are critical for studies of molecular and cellular
MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
Figure S1. Figure S2. Figure S3.
Figure S1. PSA expression in VCaP was not dependent on the residual androgens in hormonedepleted medium. VCaP or LNCaP cells grown in CSS medium or SFM (serum-free medium) were treated with ethanol (-)
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Hunk is required for HER2/neu-induced mammary tumorigenesis
Research article Hunk is required for HER2/neu-induced mammary tumorigenesis Elizabeth S. Yeh, 1 Thomas W. Yang, 1 Jason J. Jung, 1 Heather P. Gardner, 1 Robert D. Cardiff, 2 and Lewis A. Chodosh 1 1 Department
Megan S. Lim MD PhD. Translating Mass Spectrometry-Based Proteomics of Malignant Lymphoma into Clinical Application
Translating Mass Spectrometry-Based Proteomics of Malignant Lymphoma into Clinical Application Megan S. Lim MD PhD FRCPC Department of Pathology, University of Michigan, Ann Arbor, MI Proteomics is a multi-faceted
Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Supplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
SUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Phospho-MED1-enhanced UBE2C locus looping drives castration-resistant prostate cancer growth
The EMBO Journal (2011) 30, 2405 2419 & 2011 European Molecular Biology Organization All Rights Reserved 0261-4189/11 www.embojournal.org Phospho-MED1-enhanced UBE2C locus looping drives castration-resistant
Functional genomics reveal that the serine synthesis pathway is essential in breast cancer
Functional genomics reveal that the serine synthesis pathway is essential in breast cancer Results Presented by Stacey Lin Lloyd Lab http://www.amsbio.com/expression-ready-lentiviral-particles.aspx Overview
Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines
Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines Dra Martha Robles Flores Department of Biochemistry Facultad de Medicina Universidad Nacional Autónoma de México Tissue anatomy of the
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines
In Vitro Studies of the Aurora-Kinase Inhibitor MLN837 in Prostate Cancer Cell Lines Nicole V. Julian Mentor: Ana Aparicio, M.D. Special Thanks to Brittany Kleb Department of Genitourinary Medical Oncology
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
ALM301: Allosteric Isoform selective Akt inhibitor
ALM301: Allosteric Isoform selective Akt inhibitor Background Akt1/2 selective inhibitors ALM301 Back-up compounds Akt2 selective inhibitors Approaches to Akt Inhibition Both ATP competitive and allosteric
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
TITLE: Small Molecule Inhibitors of ERG and ETV1 in Prostate Cancer
AD Award Number: W81XWH-12-1-0399 TITLE: Small Molecule Inhibitors of ERG and ETV1 in Prostate Cancer PRINCIPAL INVESTIGATOR: Colm Morrissey CONTRACTING ORGANIZATION: University of Washington Seattle WA
Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
TITLE: Targeting Sulfotransferase (SULT) 2B1b as a regulator of Cholesterol Metabolism in Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0588 TITLE: Targeting Sulfotransferase (SULT) 2B1b as a regulator of Cholesterol Metabolism in Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Timothy Ratliff CONTRACTING ORGANIZATION:
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells
Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental
Clasificación Molecular del Cáncer de Próstata. JM Piulats
Clasificación Molecular del Cáncer de Próstata JM Piulats Introduction The Gleason score is the major method for prostate cancer tissue grading and the most important prognostic factor in this disease.
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
ALK inhibitor resistance in ALKF1174Ldriven neuroblastoma is associated with AXL activation and induction of EMT
ALK inhibitor resistance in ALKF1174Ldriven neuroblastoma is associated with AXL activation and induction of EMT The Harvard community has made this article openly available. Please share how this access
EFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL MIGRATION IN PANCREATIC CANCER CELLS
EFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL MIGRATION IN PANCREATIC CANCER CELLS VIDYA MEDEPALLI ADVISOR: Maria Eugenia Sabbatini, PhD PHI KAPPA PHI RESEARCH CONFERENCE MARCH 8 th, 2017 Pancreatic
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease Linda Xiaoyan Li,, Julien Sage, Xiaogang Li J Clin Invest. 2017;127(7):2751-2764. https://doi.org/10.1172/jci90921.
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Transcriptional and Epigenetic Mechanisms of Addiction
Transcriptional and Epigenetic Mechanisms of Addiction Eric J. Nestler Mount Sinai School of Medicine New York, NY Dr. Ray Fuller There is every reason to be optimistic that in the future we will find
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
PSA and the Future. Axel Heidenreich, Department of Urology
PSA and the Future Axel Heidenreich, Department of Urology PSA and Prostate Cancer EAU Guideline 2011 PSA is a continuous variable PSA value (ng/ml) risk of PCa, % 0 0.5 6.6 0.6 1 10.1 1.1 2 17.0 2.1 3
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center
AD Award Number: W81XWH-10-1-0771 TITLE: Characterizing and Targeting Androgen Receptor Pathway-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Peter S. Nelson, MD CONTRACTING ORGANIZATION: Fred Hutchinson
MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.
WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors
Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AWARD NUMBER: W81XWH-16-1-0394 TITLE: Cotargeting of Androgen Synthesis and Androgen Receptor Expression as a Novel Treatment for Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Chang-Deng
C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is
' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various
BIK BIM NOXA PUMA MCL-1. p53
HT116 cells A IK IM NOXA PUMA ML-1 p53 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 Procaspase 3 PARP leaved Product 12 8 4 24 hr 48 hr Figure S1. HT116 cell death by different proteasome inhibitors.
High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA
High Throughput Screening as a Research Tool Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA Structure of this seminar Applications of High Throughput Screening
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/Beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan
Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin
ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer
Research article ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer Changmeng Cai, 1 Hongyun Wang, 1 Housheng Hansen He, 2,3 Sen Chen, 1 Lingfeng He, 1 Fen Ma, 1 Lorelei Mucci,
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-07-1-0441 TITLE: A Novel Approach to Identify Genes that Modulate Response of Human Ovarian Cancer Cells to Chemotherapeutic Agents Using High-Throughput RNA Interference PRINCIPAL
TITLE: Oncogenicity and Selective Inhibition of ERG Splicing Variants in Prostate Cancer
AD Award Number: W81XWH-09-1-0546 TITLE: Oncogenicity and Selective Inhibition of ERG Splicing Variants in Prostate Cancer PRINCIPAL INVESTIGATOR: Luca Cartegni, Ph.D. CONTRACTING ORGANIZATION: Memorial