Supporting Information: Enhanced Therapeutic Effects of MSC-derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment

Size: px
Start display at page:

Download "Supporting Information: Enhanced Therapeutic Effects of MSC-derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment"

Transcription

1 Supporting Information: Enhanced Therapeutic Effects of MSC-derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment Kaiyue Zhang 1,2, Xiangnan Zhao 1, Xiaoniao Chen 3, Yongzhen Wei 2, Wei Du 1, Yuebing Wang 1, Linan Liu 4, Weian Zhao 4, Zhibo Han 5,6, Deling Kong 2, Qiang Zhao 2, Zhikun Guo 7, Zhongchao Han 5, Na Liu 1, Fengxia Ma 6* 1,,2, 8*, Zongjin Li 1 Nankai University School of Medicine, Tianjin, China; 2 The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, the College of Life Science, Tianjin, China; 3 Department of Ophthalmology, Chinese PLA General Hospital, Beijing, China; 4 Department of Pharmaceutical Sciences, Department of Biomedical Engineering, Sue and Bill Gross Stem Cell Research Center, Chao Family Comprehensive Cancer Center & Edwards Lifesciences Center for Advanced Cardiovascular Technology, and Department of Biological Chemistry University of California, Irvine, USA; 5 Beijing Engineering Laboratory of Perinatal Stem Cells, Beijing Institute of Health and Stem Cells, Health & Biotech Co., Beijing, China; 6 State Key Lab of Experimental Hematology, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China; 7 Henan Key Laboratory of Medical Tissue Regeneration, Xinxiang Medical University, Xinxiang, China; 8 State Key Laboratory of Kidney Diseases, Chinese PLA General Hospital, Beijing, China Corresponding Author * Zongjin Li, zongjinli@nankai.edu.cn * Fengxia Ma, mafengxia1978@163.com S-1

2 Table S-1. Primers used in the qpcr assay Gene Forward primer sequence, 5-3 Reverse primer sequence, 5-3 VEGFA TGTCTAATGCCCTGGAGCCT GTCACATCTGCAAGTACGTTCG VEGFR2 CAAGTGGCTAAGGGCATGGA ATTTCAAAGGGAGGCGAGCA ANG1 CGCCGAAGTCCAGAAAACAG GGGAAGAGAAATCCGGTTCCA ANG2 GCTCGAATACGATGACTCGGT GTTTGCTCCGCTGTTTGGTT enos ATCTTCAGCCCCAAACGGAG CTGGAACATCTTCCGCCTGT BCL2 GGTCATGTGTGTGGAGAGCG GGTGCCGGTTCAGGTACTCA BAX GATGCGTCCACCAAGAAGCT CGGCCCCAGTTGAAGTTG CASP3 TGGTTCATCCAGTCGCTTTG CATTCTGTTGCCACCTTTCG CASP8 CTGCTGGGGATGGCCACTGTG TCGCCTCGAGGACACGCTCTC CASP9 CGAACTAACAGGCAAGCAGC ACCTCACCAAATCCTCCAGAAC GAPDH AGGGCTGCTTTTAACTCTGGT CCCCACTTGATTTTGGAGGGA Shown is the sequences of primers in 5-3 orientation for real-time qpcr used in this study. S-2

3 Supporting Figures and Captions Figure S-1 Figure S-1. Identification of exosomes labeled with Gluc-lactadherin fusion proteins. (A) Schematic representation of plv-gluc and plv-gluc-lactadherin plasmids. (B) BLI images of exosomes and exosome-free proteins isolated from hp-mscs transfected with plv-gluc or plv-gluc-lactadherin plasmid. (C) Internalization of exosomes and exosome-free proteins detected by Gluc signals. Data were expressed as the mean ± SEM. All experiments were performed in three independent experiments triplicate and were shown as the mean ± SEM. (n=3; ** P < 0.01) S-3

4 Figure S-2 Figure S-2. Characterization of thermo-sensitive chitosan hydrogel. (A) Dynamic rheological properties of chitosan hydrogel including frequency sweep and strain sweep at 37 C. (B) Swelling and degradation ratio of chitosan hydrogel at 37 C. All experiments were performed in three independent experiments triplicate and were shown as the mean ± SEM. S-4

5 Figure S-3 Figure S-3. The expression of apoptosis-related genes following administrating exosomes to HUVECs under challenge from H 2 O 2 -induced stress. Real-time qpcr analysis of apoptosis relative genes in HUVECs treated with 100 μg/ml exosomes upon exposure to 400 μm H 2 O 2 for 12 h. Relative gene expression was normalized to GAPDH, and data were analyzed via the 2 - ΔΔ Ct method. All experiments were performed in three independent experiments and were shown as the mean ± SEM. (n=3; * P < 0.05). S-5

6 Figure S-4 Figure S-4. The expression of apoptosis-related genes following administrating exosomes or CS-Exo to HUVECs under challenge from H 2 O 2 -induced stress. All experiments were performed in three independent experiments and were shown as the mean ± SEM. (n=3; * P < 0.05). S-6

7 Figure S-5 Figure S-5. The total length and meshes number of capillary-like tubes structure in tube formation assay. The data were measured in 3 random fields in each group. All experiments were performed in three independent experiments triplicate and were shown as the mean ± SEM. (n=3; * P < 0.05; ** P < 0.01 versus PBS; # P < 0.05 versus Exo). S-7

8 Figure S-6 Figure S-6. Pathological status of ischemic hindlimbs. Pathological status of ischemic hindlimbs 28 days after treatments. S-8

Mechanical Stress-Dependent Autophagy Components Release via Extracellular

Mechanical Stress-Dependent Autophagy Components Release via Extracellular Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,

More information

Photoswitchable micelles for the control of singlet-oxygen generation in. photodynamic therapies

Photoswitchable micelles for the control of singlet-oxygen generation in. photodynamic therapies Supporting Information for Photoswitchable micelles for the control of singlet-oxygen generation in photodynamic therapies Yan Zhai, Henk J. Busscher,,* Yong Liu, Zhenkun Zhang, Theo G. van Kooten, Linzhu

More information

University of Miami Miller School of Medicine, Miami, FL 33136, USA, 3 State Key Laboratory

University of Miami Miller School of Medicine, Miami, FL 33136, USA, 3 State Key Laboratory Supplementary File ASXL1 plays an important role in erythropoiesis Hui Shi 1,2,3, Shohei Yamamoto 1,2,4, Mengyao Sheng 3, Jie Bai 3, Peng Zhang 1,2, Runze Chen 1,2, Shi Chen 1,2, Lihong Shi 3, Omar Abdel-Wahab

More information

Joint Department of Biomedical Engineering

Joint Department of Biomedical Engineering Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for

More information

Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced

Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis implicating regulation of energy metabolism Xu-Guang Jiang 1,2,, Kai Sun 1,3,4,5,, Yu-Ying Liu 1,4,5, Li Yan 1,4,5,

More information

Supporting Information

Supporting Information Supporting Information Natural small molecule FMHM inhibits lipopolysaccharide-induced inflammatory response by promoting TRAF6 degradation via K48-linked polyubiquitination Ke-Wu Zeng 1, Li-Xi Liao 1,

More information

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad

More information

Electrospun Micropatterned Nanocomposites Incorporated with Cu 2 S Nanoflowers for Skin Tumor Therapy and Wound Healing

Electrospun Micropatterned Nanocomposites Incorporated with Cu 2 S Nanoflowers for Skin Tumor Therapy and Wound Healing Supporting Information for Electrospun Micropatterned Nanocomposites Incorporated with Cu 2 S Nanoflowers for Skin Tumor Therapy and Wound Healing Xiaocheng Wang 1, 2, Fang lv 3, Tian Li 1, 2, Yiming Han

More information

This article is downloaded from.

This article is downloaded from. This article is downloaded from http://researchoutput.csu.edu.au It is the paper published as: Author: G.-Y. Li, J.-Z. Liu, S.-G. Chen, C.-B. Wang, B. Zhang and L. Wang Title: Effect of a seashell protein

More information

Screening of Monacolin K-high-yielding Monascus strain by combinative mutation treatment

Screening of Monacolin K-high-yielding Monascus strain by combinative mutation treatment 264507~5162007 Mycosystema 1 550002 2 100039 3 550002 4 550000 Monascus purpureus 45s 1.0 Monacolin K Monascus purpureus ZT32 5 Monacolin K 219.9µg/mL 2 Monacolin K 8.33mg/g 3.3 Q939.5 A 1672-6472200704-0507-0516

More information

Supporting Information

Supporting Information Supporting Information Discovery of Pentacyclic Triterpenes as Potential Entry Inhibitors of Influenza Viruses Maorong Yu*,,, Longlong Si,, Yufei Wang, Yiming Wu, Fei Yu,, Pingxuan Jiao, Yongying Shi,

More information

Supplementary Information

Supplementary Information Supplementary Information New Highly Oxygenated Germacranolides from Carpesium divaricatum and their Cytotoxic Activity Tao Zhang, 1 Jin-Guang Si, 1, 2 Qiu-Bo Zhang, 1 Gang Ding, 1 and Zhong-Mei Zou 1*

More information

Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway

Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Jieyuan Zhang, Xiaolin Liu, Haiyan Li, Chunyuan Chen, Bin Hu, Xin Niu, Qing

More information

Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection

Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection Supplemental Materials Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic hepatitis B infection Cai-Feng Chen 1#, Xia Feng 2#, Hui-Yu Liao 2#, Wen-Jing Jin 1, Jian Zhang 3, Yu Wang

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Supporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity

Supporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity Supporting Information Design of LVFFARK and LVFFARK-Functionalized Nanoparticles for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity Neng Xiong, Xiao-Yan Dong, Jie Zheng, Fu-Feng Liu, * and

More information

Protein-Mediated Anti-Adhesion Surface against Oral Bacteria

Protein-Mediated Anti-Adhesion Surface against Oral Bacteria Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 Supporting Information Protein-Mediated Anti-Adhesion Surface against Oral Bacteria Xi Liu a,b,

More information

Secreted AGR2 Helps Tumor Cells to Establish Its Microenvironment

Secreted AGR2 Helps Tumor Cells to Establish Its Microenvironment SJTU-School of Pharmacy Secreted AGR2 Helps Tumor Cells to Establish Its Microenvironment Dawei Li, Prof. Center For Cell Engineering And Antibody Medicine Shanghai Jiao Tong University 1 Tumor Microenvironment:

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

International Journal of Food Nutrition and Safety, 2012, 1(2): International Journal of Food Nutrition and Safety

International Journal of Food Nutrition and Safety, 2012, 1(2): International Journal of Food Nutrition and Safety International Journal of Food Nutrition and Safety, 2012, 1(2): 54-59 International Journal of Food Nutrition and Safety Journal homepage: www.modernscientificpress.com/journals/ijfns.aspx ISSN: 2165-896X

More information

Supporting Information For

Supporting Information For Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li

More information

PREPARATION OF POLYSTYRENE HOLLOW MICROSPHERES FROM WASTE FOAMED POLYSTYRENE PLASTICS BY MICROENCAPSULATION METHOD

PREPARATION OF POLYSTYRENE HOLLOW MICROSPHERES FROM WASTE FOAMED POLYSTYRENE PLASTICS BY MICROENCAPSULATION METHOD PREPARATION OF POLYSTYRENE HOLLOW MICROSPHERES FROM WASTE FOAMED POLYSTYRENE PLASTICS BY MICROENCAPSULATION METHOD Wei Bin* 1, Wang Shujun 1, Liu Hongyan 2, Liu Ning 1 1 State Key Laboratory of Heavy Oil

More information

St. Gallen 2011 Symposium Highlights in China

St. Gallen 2011 Symposium Highlights in China May 2011 Shanghai St. Gallen 2011 Symposium Highlights in China Chang Hai Hospital of Shanghai Fudan University Shanghai Cancer Center Guangzhou Sun Yat-Sen University Cancer Center Beijing 307 Hospital

More information

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,

More information

BGI. Jinquan,Cheng;Renli,Zhang;Shisong,Fang 2014-Jan- Bing,Xu;Tao,Zhang;Xiaowen,Li BGI /2013

BGI. Jinquan,Cheng;Renli,Zhang;Shisong,Fang 2014-Jan- Bing,Xu;Tao,Zhang;Xiaowen,Li BGI /2013 Suppementary Tabe S2 A sequences used from GISAID s EpiFu database in this study We acknowedge the authors, originating submitting aboratories the sequences from GISAID s EpiFu Database on which this research

More information

Cancer incidence and mortality in China in 2013: an analysis based on urbanization level

Cancer incidence and mortality in China in 2013: an analysis based on urbanization level Original Article Cancer incidence and mortality in China in 203: an analysis based on urbanization level Wanqing Chen, Rongshou Zheng, Siwei Zhang, Hongmei Zeng, Tingting Zuo, Changfa Xia, Zhixun Yang,

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information MnO 2 -induced synthesis of fluorescent polydopamine nanparticles

More information

Supporting Information

Supporting Information Supporting Information Cancer Cell Membrane-Biomimetic Nanoprobes with Two-Photon Excitation and Near-Infrared Emission for Intravital Tumor Fluorescence Imaging Yanlin Lv 1,2,, Ming Liu 3,4,, Yong Zhang

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

Research on Microscopic Pore Structure and Permeability of Air-Entrained Fly Ash Concrete Subjected to Freezing and Thawing Action

Research on Microscopic Pore Structure and Permeability of Air-Entrained Fly Ash Concrete Subjected to Freezing and Thawing Action 4 th International Conference on the Durability of Concrete Structures 26 July 14 Purdue University, West Lafayette, IN, USA Research on Microscopic Pore Structure and Permeability of Air-Entrained Fly

More information

Pharmacokinetic Study on Hyperoside in Beagle s Dogs

Pharmacokinetic Study on Hyperoside in Beagle s Dogs Ai G et al. Chinese Herbal Medicines, 0, 4(3): 3-7 3 Pharmacokinetic Study on Hyperoside in Beagle s Dogs AI Guo,, HUANG Zheng-ming *, LIU Chang-xiao 3. Institute of Radiation Medicine, Academy of Military

More information

Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility. in mice

Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility. in mice Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility in mice Xiaopeng Hu 1 *, Zhenzhou Tang 1,2 *, Yang Li 2 *, Wensheng Liu 2, Shuang Zhang 3, Bingyan Wang 3, Yingpu Tian 2, Yinan

More information

Supporting Information. Dichloroimidazolidinedione-Activated Beckmann Rearrangement of. Ketoximes for Accessing Amides and Lactams

Supporting Information. Dichloroimidazolidinedione-Activated Beckmann Rearrangement of. Ketoximes for Accessing Amides and Lactams Supporting Information Dichloroimidazolidinedione-Activated Beckmann Rearrangement of Ketoximes for Accessing Amides and Lactams Yu Gao, Jingjing Liu, Zhenjiang Li, Tianfo Guo, Songquan Xu, Hui Zhu, Fulan

More information

Long term stability of isolated human serum derived exosomes

Long term stability of isolated human serum derived exosomes Long term stability of isolated human serum derived exosomes Candice de Boer (PhD student) Regenerative Medicine Laboratory Supervisor: Associate Professor Neil Davies Exosomes First discovered during

More information

P53 Gene Therapy for Pulmonary Metastasis Tumor from Hepatocellular Carcinoma

P53 Gene Therapy for Pulmonary Metastasis Tumor from Hepatocellular Carcinoma P53 Gene Therapy for Pulmonary Metastasis Tumor from Hepatocellular Carcinoma Anti-Cancer Drugs, 2010,21(9):882-884 Miao Yu, Wei Chen, Jinshan Zhang Miao Yu: Department of Department of Interventional

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Cancer Incidence and Mortality in China, 2007

Cancer Incidence and Mortality in China, 2007 www.springerlink.com Chin J Cancer Res 24(1):1-8, 2012 1 Original Article Cancer Incidence and Mortality in China, 2007 Wan-qing Chen *, Hong-mei Zeng, Rong-shou Zheng, Si-wei Zhang, Jie He National Office

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

Serum mirna expression profile as a prognostic biomarker of stage II/III

Serum mirna expression profile as a prognostic biomarker of stage II/III Serum mirna expression profile as a prognostic biomarker of stage II/III colorectal adenocarcinoma Jialu Li a,b,, Yang Liu c,, Cheng Wang d,, Ting Deng a,, Hongwei Liang b, Yifei Wang e, Dingzhi Huang

More information

CURRICULUM VITAE. Post Address: West China Second University Hospital, Section 3, 20S, Renmin Road, Chengdu, Sichuan , China

CURRICULUM VITAE. Post Address: West China Second University Hospital, Section 3, 20S, Renmin Road, Chengdu, Sichuan , China General Information: Name: Ling Gu Gender: Female Citizenship: P. R. China CURRICULUM VITAE Post Address: West China Second University Hospital, Section 3, 20S, Renmin Road, Phone Number: 86-13568818956(mobile),

More information

Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat. synovial cells

Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat. synovial cells Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat synovial cells Zhen Li 1,2,3,4, Xiaofu Li 4, Yi Wang 4, Qingjun Wei 1,2,3,* 1 Orthopaedic Department, the First Affiliated Hospital of Guangxi

More information

The subcortical maternal complex controls symmetric division of mouse zygotes by

The subcortical maternal complex controls symmetric division of mouse zygotes by The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,

More information

AIDS-related Knowledge, Condom Usage Among Medical Postgraduates

AIDS-related Knowledge, Condom Usage Among Medical Postgraduates BIOMEDICAL AND ENVIRONMENTAL SCIENCES 1, -1 () AIDS-related Knowledge, Condom Usage Among Medical Postgraduates WANG LI * AND ZHANG KONG-LAI + * Department of Epidemiology, Institute of Basic Medical Science,

More information

Glioma cells enhance angiogenesis and inhibit endothelial cell apoptosis through the release of exosomes that contain long non-coding RNA CCAT2

Glioma cells enhance angiogenesis and inhibit endothelial cell apoptosis through the release of exosomes that contain long non-coding RNA CCAT2 ONCOLOGY REPORTS 38: 785-798, 2017 Glioma cells enhance angiogenesis and inhibit endothelial cell apoptosis through the release of exosomes that contain long non-coding RNA CCAT2 Hai-li Lang 1*, Guo-wen

More information

Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers

Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Supporting information Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Yulei Chang 1, Xiaodan Li 1,3, Li zhang 1,3, Lu Xia 1, Xiaomin

More information

162 Biomed Environ Sci, 2014; 27(3):

162 Biomed Environ Sci, 2014; 27(3): 162 Biomed Environ Sci, 2014; 27(3): 162-168 Original Article Impact of Cardiovascular Disease Deaths on Life Expectancy in Chinese Population * FAN Jie, LI Guo Qi, LIU Jing, WANG Wei, WANG Miao, QI Yue,

More information

Isoginkgetin inhibits lipopolysaccharide induced PI3K/AKT pathway through mirna210 in vascular endothelial cells

Isoginkgetin inhibits lipopolysaccharide induced PI3K/AKT pathway through mirna210 in vascular endothelial cells Pharmaceutical Isoginkgetin inhibits lipopolysaccharide induced PI3K/AKT pathway through mirna210 in vascular endothelial cells Objective: To investigate whether isoginkgetin can inhibit lipopolysaccharide

More information

New Drug (Chemical Drug) Application Materials (13th) Zhongzhou Ointment

New Drug (Chemical Drug) Application Materials (13th) Zhongzhou Ointment New Drug (Chemical Drug) Application Materials (13th) Zhongzhou Ointment Experiment & Literature Materials of General Pharmacology Research Application Unit: Developer Zhao Zhongzhou Yunnan Zhongzhou Pharmaceutical

More information

Electronic Supplementary Information. Chemical inhibitors and stable knock-down of efflux transport leads to reduced

Electronic Supplementary Information. Chemical inhibitors and stable knock-down of efflux transport leads to reduced Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Chemical inhibitors and stable knock-down of efflux

More information

ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation

ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Supporting Information ROS scavenging Mn 3 O 4 nanozymes for in vivo anti-inflammation

More information

CURRICULUM VITAE. August, PROFESSIONAL POSITION present Assistant Professor of School of Social Work, The University of Iowa

CURRICULUM VITAE. August, PROFESSIONAL POSITION present Assistant Professor of School of Social Work, The University of Iowa CURRICULUM VITAE Man (May) Guo, Ph.D. Assistant Professor School of Social Work University of Iowa 354 North Hall Iowa City, Iowa 52242 Tel: 319-335-0513 (Office) Email: man-guo@uiowa.edu August, 2013

More information

Influence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis

Influence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis Influence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis G.-C. Shi and L.-G. Zhang Department of Tuberculosis, The First Affiliated Hospital of Xinxiang Medical University,

More information

Supplementary Information

Supplementary Information Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang

More information

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,

More information

CURRICULUM VITAE. Keming Yang, MD, MS

CURRICULUM VITAE. Keming Yang, MD, MS CURRICULUM VITAE Keming Yang, MD, MS Department of Epidemiology Richard M. Fairbanks School of Public Health, Indiana University 1050 Wishard Blvd, RG 5129, Indianapolis, IN 46202-2872. Email: kemyang@iu.edu

More information

Etiology, Prognosis and Intervention Related Researches of ICH in China

Etiology, Prognosis and Intervention Related Researches of ICH in China Etiology, Prognosis and Intervention Related Researches of ICH in China Dandan Wang, Zeyu Ding, Kehui Dong, Jing Wang, Junping Guo, Xingquan Zhao, Yongjun Wang Department of Neurology, Beijing Tiantan

More information

ASIAN JOURNAL OF CHEMISTRY

ASIAN JOURNAL OF CHEMISTRY Asian Journal of Chemistry; Vol. 27, No. 8 (2015), 2801-2805 ASIAN JOURNAL OF CHEMISTRY http://dx.doi.org/10.14233/ajchem.2015.18058 Study on Enhancing Zinc Dusts with Direct Sulphuric Acid Leaching H.Y.

More information

Surface-Enhanced Raman Scattering Active Gold Nanoparticles. with Enzyme-Mimicking Activities for Measuring Glucose and

Surface-Enhanced Raman Scattering Active Gold Nanoparticles. with Enzyme-Mimicking Activities for Measuring Glucose and Surface-Enhanced Raman Scattering Active Gold Nanoparticles with Enzyme-Mimicking Activities for Measuring Glucose and Lactate in Living Tissues Yihui Hu, Hanjun Cheng, Xiaozhi Zhao, Jiangjiexing Wu, Faheem

More information

IDENTIFICATION OF QTLS FOR STARCH CONTENT IN SWEETPOTATO (IPOMOEA BATATAS (L.) LAM.)

IDENTIFICATION OF QTLS FOR STARCH CONTENT IN SWEETPOTATO (IPOMOEA BATATAS (L.) LAM.) Journal of Integrative Agriculture Advanced Online Publication: 2013 Doi: 10.1016/S2095-3119(13)60357-3 IDENTIFICATION OF QTLS FOR STARCH CONTENT IN SWEETPOTATO (IPOMOEA BATATAS (L.) LAM.) YU Xiao-xia

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

A 4-year study of Red Yeast Rice extract known as Xuezhikang which lowers cholesterol... Monday, July 27, 2009

A 4-year study of Red Yeast Rice extract known as Xuezhikang which lowers cholesterol... Monday, July 27, 2009 A 4-year study of Red Yeast Rice extract known as Xuezhikang which lowers cholesterol... 1 At a dose of 600 mg twice a day... 2 Reduced coronary events by 37%... 3 Reduced death from coronary heart disease

More information

Amino acids-incorporated nanoflowers with an

Amino acids-incorporated nanoflowers with an Amino acids-incorporated nanoflowers with an intrinsic peroxidase-like activity Zhuo-Fu Wu 1,2,+, Zhi Wang 1,+, Ye Zhang 3, Ya-Li Ma 3, Cheng-Yan He 4, Heng Li 1, Lei Chen 1, Qi-Sheng Huo 3, Lei Wang 1,*

More information

Peking University People's Hospital, Peking University Institute of Hematology

Peking University People's Hospital, Peking University Institute of Hematology Qian Jiang, M.D. Peking University People's Hospital, Peking University Institute of Hematology No. 11 Xizhimen South Street, Beijing, 100044, China. Phone number: 86-10-66583802 Mobile: 86-13611115100

More information

Determination of Sedative Component in Chinese Medicines by High Resolution Chromatography-Electron Impact-Mass Spectrometry

Determination of Sedative Component in Chinese Medicines by High Resolution Chromatography-Electron Impact-Mass Spectrometry Journal of Analytical Sciences, Methods and Instrumentation, 2012, 2, 13-17 http://dx.doi.org/10.4236/jasmi.2012.21003 Published Online March 2012 (http://www.scirp.org/journal/jasmi) 13 Determination

More information

Electronic Supporting Information

Electronic Supporting Information Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2018 Electronic Supporting Information Two-phase systems developed with hydrophilic and hydrophobic

More information

[DOI] /j.issn , China

[DOI] /j.issn , China Med J Chin PLA, Vol. 41, No. 5, May 1, 2016 351 HBsAg HBs S N- [ ] (HBV)HBsAg+ HBs S (MHR) N- HBsAg+ HBs 284 HBsAg+ HBs 314 HBsAg HBV S 1 MHR N- N- S/S HepG2 HBsAg+ HBs MHR N- 11.3%(32/284) HBsAg 2.9%(9/314)(P

More information

Web-based: A data warehouse on osteoporosis data warehouse in the osteoporosis community health information management system

Web-based: A data warehouse on osteoporosis data warehouse in the osteoporosis community health information management system J. Biomedical Science and Engineering, 2013, 6, 1072-1076 JBiSE http://dx.doi.org/10.4236/jbise.2013.611134 Published Online November 2013 (http://www.scirp.org/journal/jbise/) Web-based: A data warehouse

More information

Chinese Pharmacological Bulletin 2012 Sep ~ 6. http / /www. cnki. net /kcms /detail / R html

Chinese Pharmacological Bulletin 2012 Sep ~ 6. http / /www. cnki. net /kcms /detail / R html 1262 1262 ~ 6 2012-8 - 14 17 19 http / /www. cnki. net /kcms /detail /34. 1086. R. 20120814. 1719. 018. html MG - 63 1 1 2 2 1. 453003 2. 361005 doi 10. 3969 /j. issn. 1001-1978. 2012. 09. 018 A 1001-1978

More information

The 8th National Gastric Cancer Academic Conference: focus on specification, translational research, and plan

The 8th National Gastric Cancer Academic Conference: focus on specification, translational research, and plan Meeting Report The 8th National Gastric Cancer Academic Conference: focus on specification, translational research, and plan Ni Dai Beijing Cancer Hospital and Institute, Peking University School of Oncology,

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

TIPE2 expression is increased in peripheral blood mononuclear cells from patients with rheumatoid arthritis

TIPE2 expression is increased in peripheral blood mononuclear cells from patients with rheumatoid arthritis /, 2017, Vol. 8, (No.50), pp: 87472-87479 TIPE2 expression is increased in peripheral blood mononuclear cells from patients with rheumatoid arthritis Zhu Shi-Bai 1, Liu Rui-Min 2, Sun Ying-Chuan 2, Zhai

More information

Diagnostic value of fluorine-18 fluorodeoxyglucose positron emission tomography / computed tomography in fever of unknown origin

Diagnostic value of fluorine-18 fluorodeoxyglucose positron emission tomography / computed tomography in fever of unknown origin 175 18 F-FDG PET /CT 1* 2* 1 1 1 1 1 1 1. 100034 2. 100850 18 F-FDG PET /CT fever of unknown origin FUO 2010 8 2013 4 51 FUO FDG PET /CT 3 FDG PET /CT t 51 FUO 32 9 7 3 FDG PET FUO 27 52. 9% 14 27. 5%

More information

HOXC6 and HOXC8 are potentially novel prognosis predictors of esophageal squamous cell carcinoma

HOXC6 and HOXC8 are potentially novel prognosis predictors of esophageal squamous cell carcinoma HOXC6 and HOXC8 are potentially novel prognosis predictors of esophageal squamous cell carcinoma Keneng Chen, M.D., PhD, RCSF Luyan Shen, M.D., PhD 2015/4/28 Department of Thoracic Surgery I, Key Laboratory

More information

Mesenchymal Stem Cells and Cancer: Their Interplay

Mesenchymal Stem Cells and Cancer: Their Interplay Mesenchymal Stem Cells and Cancer: Their Interplay Gang Li, MBBS, DPhil (Oxon) Stem Cell and Regeneration Program School of Biomedical Sciences Li Ka Shing Institute of Health Sciences Department of Orthopaedics

More information

Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for. High-Efficiency Tracking Orthotopic Colorectal Tumor in

Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for. High-Efficiency Tracking Orthotopic Colorectal Tumor in Supporting Information (SI) for: Renal Clearable Peptide Functionalized NaGdF 4 Nanodots for High-Efficiency Tracking Orthotopic Colorectal Tumor in Mouse Hongda Chen, a,c Xiaodong Li, b Fuyao Liu, a Huimao

More information

Targeted disruption of influenza A virus hemagglutinin in genetically modified. mice reduces viral replication and improves disease outcome

Targeted disruption of influenza A virus hemagglutinin in genetically modified. mice reduces viral replication and improves disease outcome Supplementary Information Targeted disruption of influenza A virus hemagglutinin in genetically modified mice reduces viral replication and improves disease outcome Song Wang 1#, Chao Chen 1#, Zhou Yang

More information

Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery

Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery Supporting Information for Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery Dongjian Shi a*, Maoshuang Ran a, Li Zhang a, He Huang a, Xiaojie

More information

Content Analysis of Shikimic Acid in the Masson Pine Needles and Antiplateletaggregating

Content Analysis of Shikimic Acid in the Masson Pine Needles and Antiplateletaggregating doi: 10.14355/ijast.2014.0204.03 Content Analysis of Shikimic Acid in the Masson Pine Needles and Antiplateletaggregating Activity Xiao-yi Chen, Li Yuan, Lian Wei, Min Wang, Yi-xiong Lei* School of Public

More information

Robotic thoracic surgery: S 1+2 segmentectomy of left upper lobe

Robotic thoracic surgery: S 1+2 segmentectomy of left upper lobe Case Report Page 1 of 5 Robotic thoracic surgery: S 1+2 segmentectomy of left upper lobe Hailei Du, Su Yang, Wei Guo, Runsen Jin, Yajie Zhang, Xingshi Chen, Han Wu, Dingpei Han, Kai Chen, Jie Xiang, Hecheng

More information

Study on the Pharmacokinetics of Fasudil, a selective Rho kinase inhibitor

Study on the Pharmacokinetics of Fasudil, a selective Rho kinase inhibitor Asian Journal of Pharmacodynamics and Pharmacokinetics ISSN 1608-2281 Copyright by Hong Kong Medical Publisher Publisher Homepage: www.hktmc.com Study on the Pharmacokinetics of Fasudil, a selective Rho

More information

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel

More information

CURRICULUM VITAE. Professional Employment and Teaching Experience:

CURRICULUM VITAE. Professional Employment and Teaching Experience: CURRICULUM VITAE Name: Current Address: Hong Chen American Academy of Acupuncture and Oriental Medicine 1925 West County Road B2 Roseville, MN 55113 Tel: (651) 631-0204 Fax: (651) 631-0361 E-mail: hongyu1229@hotmail.com

More information

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima

More information

Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis

Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis Cell Reports, Volume 21 Supplemental Information Differential Effects of EGFL6 on Tumor versus Wound Angiogenesis Kyunghee Noh, Lingegowda S. Mangala, Hee-Dong Han, Ningyan Zhang, Sunila Pradeep, Sherry

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

Supporting Information for

Supporting Information for Supporting Information for Stable Li Plating/Stripping Electrochemistry Realized by a Hybrid Li Reservoir in Spherical Carbon Granules with 3D Conducting Skeletons Huan Ye,, Sen Xin, Ya-Xia Yin,, Jin-Yi

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2018 Supplementary Information Spying on Protein Interactions in Living Cells with Reconstituted Scarlet

More information

Journal of Chemical and Pharmaceutical Research, 2015, 7(8): Research Article

Journal of Chemical and Pharmaceutical Research, 2015, 7(8): Research Article Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 215, 7(8):257-261 Research Article ISSN : 975-7384 CODEN(USA) : JCPRC5 Pulping process for rice straw in basic ionic liquid

More information

Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis

Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis Mesenchymal stem cells release exosomes that transfer mirnas to endothelial cells and promote angiogenesis Tanja Wagner 1 Introduction 2 Mesenchymal stem cells (MSCs) non-haematopoietic, multipotent stem

More information

Avian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences

Avian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus H7N9 Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus RNA virus, Orthomyxoviruses Influenza A virus Eight Gene segments

More information

A Facile Method for Enhancing the Sensing Performance of Zinc Oxide. Nanofibers Gas Sensors

A Facile Method for Enhancing the Sensing Performance of Zinc Oxide. Nanofibers Gas Sensors Electronic Supplementary Information (ESI): A Facile Method for Enhancing the Sensing Performance of Zinc Oxide Nanofibers Gas Sensors Pei-Pei Wang a, Qi Qi a, Rui-Fei Xuan a,b, Jun Zhao a, Li-Jing Zhou

More information

Sign Linguistics Training: An Alternative Approach to Deaf Education

Sign Linguistics Training: An Alternative Approach to Deaf Education Sign Linguistics Training: An Alternative Approach to Deaf Education Gladys Tang Director, Centre for Sign Linguistics and Deaf Studies (CSLDS) Chairperson, Department of Linguistics and Modern Languages

More information

Supplementary Materials for

Supplementary Materials for www.advances.sciencemag.org/cgi/content/full/1/3/e1400244/dc1 Supplementary Materials for PlGF-induced VEGFR1-dependent vascular remodeling determines opposing antitumor effects and drug resistance to

More information

Evaluative Implicit Aggression in College Students: Effects of Classroom Interpersonal Relationships

Evaluative Implicit Aggression in College Students: Effects of Classroom Interpersonal Relationships Canadian Social Science Vol. 11, No. 3, 2015, pp. 172-179 DOI: 10.3968/6587 ISSN 1712-8056[Print] ISSN 1923-6697[Online] www.cscanada.net www.cscanada.org Evaluative Implicit Aggression in College Students:

More information

CURRICULUM VITAE Shanshan Zhou. Shanshan Zhou. Department of Cardiology. Tel: Feb 25, 1982, China. Chinese.

CURRICULUM VITAE Shanshan Zhou. Shanshan Zhou. Department of Cardiology. Tel: Feb 25, 1982, China. Chinese. CURRICULUM VITAE Shanshan Zhou PERSONAL DETAILS Name: Work address: Shanshan Zhou Department of Cardiology The General Hospital of the People's Liberation Army 28 Fuxing Road, Haidian District, Beijing,

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SYPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY MATERIAL Figure S1. Phylogenic studies of the mir-183/96/182 cluster and 3 -UTR of Casp2. (A) Genomic arrangement of the mir-183/96/182 cluster in vertebrates.

More information

ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3*

ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3* ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3* 1 Department of Microbiology, Li Ka Shing Faculty of Medicine, University

More information

Original Article Vascular endothelial growth factor polymorphisms and lung cancer risk

Original Article Vascular endothelial growth factor polymorphisms and lung cancer risk Int J Clin Exp Med 2015;8(4):6406-6411 www.ijcem.com /ISSN:1940-5901/IJCEM0003921 Original Article Vascular endothelial growth factor polymorphisms and lung cancer risk Junli Fan 1, Weiguo Zhang 1, Caipeng

More information