SC-L-H shared(37) Specific (1)

Benchmark study: Exiqon mircury LNA microrna arrays vs. Supplier A s DNA based capture probes. Includes comparison of:

Benchmark study: Exiqon mircury LNA microrna arrays vs. Supplier A s DNA based capture probes Includes comparison of: I. II. III. Signal levels Relative quantification False differences For complete experimental

Synthetic microrna Reference Standards Genomics Research Group ABRF 2015

Synthetic microrna Reference Standards Genomics Research Group ABRF 2015 Don A. Baldwin, Ph.D. support@signalbiology.com Reference samples for Platform evaluation Protocol development Assay service improvement

sirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome

Qi et al. 26-3-2564C Qi et al., Figure S1 sirna count per 5 kb small RNAs matching the direct strand sirna count per 5 kb small RNAs matching the complementary strand Repeat length (bp) per 5 kb repeats

Supplementary Figure 1

Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

Cross species analysis of genomics data. Computational Prediction of mirnas and their targets

02-716 Cross species analysis of genomics data Computational Prediction of mirnas and their targets Outline Introduction Brief history mirna Biogenesis Why Computational Methods? Computational Methods

Supplementary materials and methods.

Supplementary materials and methods. Microarray printing and data analysis. The LNA-modified oligonucleotide probe set for all annotated mirnas from mouse (Mus musculus) and human (Homo sapiens) in the

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)

Supplementary Figure 1

Supplementary Figure 1 a Location of GUUUCA motif relative to RNA position 4e+05 3e+05 Reads 2e+05 1e+05 0e+00 35 40 45 50 55 60 65 Distance upstream b 1: Egg 2: L3 3: Adult 4: HES 4e+05 3e+05 2e+05 start

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)

MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science

P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,

Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco

Bi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016

Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

Supplementary information

Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

Circulating Microrna Expression As A Biomarker For Early Diagnosis Of Severity In Spinal Cord Injury

Circulating Microrna Expression As A Biomarker For Early Diagnosis Of Severity In Spinal Cord Injury Susumu Hachisuka 1, Naosuke Kamei, MD, PhD 2, Satoshi Ujigo 3, Shigeru Miyaki 3, Mitsuo Ochi 3. 1 Hiroshima

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes

mirna-guided regulation at the molecular level

molecular level Hervé Seitz IGH du CNRS, Montpellier, France March 3, 2016 microrna target prediction . microrna target prediction mirna: target: 2 7 5 N NNNNNNNNNNNNNN 3 NNNNNN the seed microrna target

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033

AD Award Number: W81XWH-07-01-0264 TITLE: Function of Klotho and is MicroRNA in Prostate Cancer and Aging PRINCIPAL INVESTIGATOR: Shao-Yao Ying, Ph.D. CONTRACTING ORGANIZATION: University of Southern California

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

Cancer Problems in Indonesia

mirna and Cancer : mirna as a Key Regulator in Cancer Sofia Mubarika 2 nd Symposium Biomolecular Update in Cancer PERABOI Padang 18 Mei 2013 Cancer Problems in Indonesia 1. Chemoresistency / recurrency

Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit

15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional

Adenosine triphosphate (ATP)

Adenosine triphosphate (ATP) 1 High energy bonds ATP adenosine triphosphate N NH 2 N -O O P O O P O- O- O O P O- O CH 2 H O H N N adenine phosphoanhydride bonds (~) H OH ribose H OH Phosphoanhydride bonds

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains

Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

Supplementary figure legends

Supplementary figure legends SUPPLEMENTRY FIGURE S1. Lentiviral construct. Schematic representation of the PCR fragment encompassing the genomic locus of mir-33a that was introduced in the lentiviral construct.

Prediction of micrornas and their targets

Prediction of micrornas and their targets Introduction Brief history mirna Biogenesis Computational Methods Mature and precursor mirna prediction mirna target gene prediction Summary micrornas? RNA can

Over the past decade, it has become progressively more

Reviews Methodological Reviews discuss methods that are of broad interest to the community of cardiovascular investigators and that enable a better understanding of cardiovascular biology, particularly

A sensitive non-radioactive northern blot method to detect small RNAs

Published online 15 January 2010 Nucleic Acids Research, 2010, Vol. 38, No. 7 e98 doi:10.1093/nar/gkp1235 A sensitive non-radioactive northern blot method to detect small RNAs Sang Woo Kim 1,2, Zhihua

Supplementary Information

Supplementary Information Precursors of trnas are stabilized by methylguanosine cap structures Takayuki Ohira and Tsutomu Suzuki Department of Chemistry and Biotechnology, Graduate School of Engineering,

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

Supporting Information

Supporting Information Stegbauer et al. 10.1073/pnas.0903602106 SI Methods Analysis of Plasma Renin Activity (PRA) and ACE Activity. PRA and serum ACE activity levels were determined by RIA (RENCTK, DiaSorin;

Doctor of Philosophy

Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of

Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note

Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin

An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival

An Epstein-Barr virus-encoded microrna targets to promote host cell survival The Journal of Experimental Medicine 205(11): 2551-2560, 2008. 1 Elizabeth Yee-Wai Choy, Kam-Leung Siu, Kin-Hang Kok, Raymond

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

Santosh Patnaik, MD, PhD! Assistant Member! Department of Thoracic Surgery! Roswell Park Cancer Institute!

Santosh Patnaik, MD, PhD Assistant Member Department of Thoracic Surgery Roswell Park Cancer Institute MicroRNA biology, techniques and applications History Biogenesis Nomenclature Tissue specificity Mechanisms

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells

CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin

Selective filtering defect at the axon initial segment in Alzheimer s disease mouse models. Yu Wu

Selective filtering defect at the axon initial segment in Alzheimer s disease mouse models Yu Wu Alzheimer s Disease (AD) Mouse models: APP/PS1, PS1δE9, APPswe, hps1 Wirths, O. et al, Acta neuropathologica

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

Obstacles and challenges in the analysis of microrna sequencing data

Obstacles and challenges in the analysis of microrna sequencing data (mirna-seq) David Humphreys Genomics core Dr Victor Chang AC 1936-1991, Pioneering Cardiothoracic Surgeon and Humanitarian The ABCs

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4

Intrinsic cellular defenses against virus infection

Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses

Figure mouse globin mrna PRECURSOR RNA hybridized to cloned gene (genomic). mouse globin MATURE mrna hybridized to cloned gene (genomic).

Splicing Figure 14.3 mouse globin mrna PRECURSOR RNA hybridized to cloned gene (genomic). mouse globin MATURE mrna hybridized to cloned gene (genomic). mrna Splicing rrna and trna are also sometimes spliced;

Neurotransmitter Systems I Identification and Distribution. Reading: BCP Chapter 6

Neurotransmitter Systems I Identification and Distribution Reading: BCP Chapter 6 Neurotransmitter Systems Normal function of the human brain requires an orderly set of chemical reactions. Some of the

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

mirna Whole Transcriptome Assay

mirna Whole Transcriptome Assay HTG EdgeSeq mirna Whole Transciptome Assay The HTG EdgeSeq mirna Whole Transcriptome Assay (WTA) is a next generation sequencing (NGS) application that measures the expression

Utility of Circulating micrornas in Cardiovascular Disease

Utility of Circulating micrornas in Cardiovascular Disease Pil-Ki Min, MD, PhD Cardiology Division, Gangnam Severance Hospital, Yonsei University College of Medicine Introduction Biology of micrornas Circulating

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

High-Throughput Sequencing Course

High-Throughput Sequencing Course Introduction Biostatistics and Bioinformatics Summer 2017 From Raw Unaligned Reads To Aligned Reads To Counts Differential Expression Differential Expression 3 2 1 0 1

reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express

Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

Supplementary methods:

Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

XV Encuentro de Cooperación Farma-Biotech. mir-acle (mirna mimic) to treat Non-Hodgkin lymphomas

XV Encuentro de Cooperación Farma-Biotech mir-acle (mirna mimic) to treat Non-Hodgkin lymphomas Dr Antonio Quesada, PhD R&D Manager On behalf of Prof. Almudena R. Ramiro, Head of the B Cell Biology Laboratory

Molecular Diagnosis Future Directions

Molecular Diagnosis Future Directions Philip Cunningham NSW State Reference Laboratory for HIV/AIDS & Molecular Diagnostic Medicine Laboratory, SydPath St Vincent s Hospital Sydney Update on Molecular

Computational and Experimental Identification of C. elegans micrornas

Molecular Cell, Vol. 11, 1253 1263, May, 2003, Copyright 2003 by Cell Press Computational and Experimental Identification of C. elegans micrornas Yonatan Grad, 1,3 John Aach, 1,3 Gabriel D. Hayes, 2,3

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

On the Reproducibility of TCGA Ovarian Cancer MicroRNA Profiles

On the Reproducibility of TCGA Ovarian Cancer MicroRNA Profiles Ying-Wooi Wan 1,2,4, Claire M. Mach 2,3, Genevera I. Allen 1,7,8, Matthew L. Anderson 2,4,5 *, Zhandong Liu 1,5,6,7 * 1 Departments of Pediatrics

MicroRNA and Male Infertility: A Potential for Diagnosis

Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing

Minutes Figure S1. HPLC separation of nucleosides from LC/ESI-MS analysis of a total enzymatic Trp

100 A % Relative Abundance m m Ø acp 5 m Øm 5 m m 7 m s * 6 ia m * 0 5 10 15 0 5 0 5 40 Minutes Figure S1. HPL separation of nucleosides from L/ESI-MS analysis of a total enzymatic digest of mt trna. V

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

Solid-Phase Purification of Synthetic DNA Sequences. Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER

Solid-Phase Purification of Synthetic DNA Sequences Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER The one who follows the crowd will usually go no further than the crowd.

Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination

Yoon et al, page Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination Je-Hyun Yoon,, Kotb Abdelmohsen, Jiyoung Kim, Xiaoling Yang, Jennifer L. Martindale, Kumiko Tominaga-Yamanaka,

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

CONTRACTING ORGANIZATION: Rutgers University Piscataway, NJ

AD Award Number: W81XWH-05-1-0483 TITLE: Role of microrna Genes in Breast Cancer Progression PRINCIPAL INVESTIGATOR: Richard W. Padgett, Ph.D. CONTRACTING ORGANIZATION: Rutgers University Piscataway, NJ

Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data

Instructions for Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data (Form 2114) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the Myelodysplasia/Myeloproliferative

AP Biology Summer Assignment Chapter 3 Quiz

AP Biology Summer Assignment Chapter 3 Quiz 2016-17 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. All of the following are found in a DNA nucleotide

Identification of mirnas in Eucalyptus globulus Plant by Computational Methods

International Journal of Pharmaceutical Science Invention ISSN (Online): 2319 6718, ISSN (Print): 2319 670X Volume 2 Issue 5 May 2013 PP.70-74 Identification of mirnas in Eucalyptus globulus Plant by Computational

MicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee

MicroRNA dysregulation in cancer Systems Plant Microbiology Hyun-Hee Lee Contents 1 What is MicroRNA? 2 mirna dysregulation in cancer 3 Summary What is MicroRNA? What is MicroRNA? MicroRNAs (mirnas) -

Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305

Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4

Supplemental Figure 1. Small RNA size distribution from different soybean tissues.

Supplemental Figure 1. Small RNA size distribution from different soybean tissues. The size of small RNAs was plotted versus frequency (percentage) among total sequences (A, C, E and G) or distinct sequences

Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microrna

ORIGINAL ARTICLE Cell Research (2012) 22:107-126. 2012 IBCB, SIBS, CAS All rights reserved 1001-0602/12 $ 32.00 www.nature.com/cr npg Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence

BIOCHEMISTRY & MEDICINE:

BIOCHEMISTRY & MEDICINE: INTRODUCTION Biochemistry can be defined as the science of the chemical basis of life (Gk bios "life"). The cell is the structural unit of living systems. Thus, biochemistry can

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral

MicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM

MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer

Genome-wide microrna profiling in human fetal nervous tissues by oligonucleotide microarray

Childs Nerv Syst (2006) 22:1419 1425 DOI 10.1007/s00381-006-0173-9 ORIGINAL PAPER Genome-wide microrna profiling in human fetal nervous tissues by oligonucleotide microarray Jian-Jun Zhao & You-Jia Hua

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

UNIT 1: Introduction to metabolic regulation

UNIT 1: Introduction to metabolic regulation Prof K Syed Department of Biochemistry & Microbiology University of Zululand Room no. 247 SyedK@unizulu.ac.za Topics Metabolism Metabolism: Categories Important

Assaying micrornas in biofluids for detection of drug induced cardiac injury. HESI Annual Meeting State of the Science Session June 8, 2011

Assaying micrornas in biofluids for detection of drug induced cardiac injury HESI Annual Meeting State of the Science Session June 8, 2011 Karol Thompson, PhD Center for Drug Evaluation & Research US Food

The U1 snrnp Base Pairs with the 5 Splice Site within a Penta-snRNP Complex

MOLECULAR AND CELLULAR BIOLOGY, May 2003, p. 3442 3455 Vol. 23, No. 10 0270-7306/03/$08.00 0 DOI: 10.1128/MCB.23.10.3442 3455.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.

MEK1 Assay Kit 1 Catalog # Lot # 16875

MEK1 Assay Kit 1 Kit Components Assay Dilution Buffer (ADB), Catalog # 20-108. Three vials, each containing 1.0ml of assay dilution buffer (20mM MOPS, ph 7.2, 25mM ß-glycerol phosphate, 5mM EGTA, 1mM sodium

DSB. Double-Strand Breaks causate da radiazioni stress ossidativo farmaci

DSB Double-Strand Breaks causate da radiazioni stress ossidativo farmaci DSB e CROMATINA Higher-order chromatin packaging is a barrier to the detection and repair of DNA damage DSBs induce a local decrease

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

Supplementary information

Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies

Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies. 2014. Supplemental Digital Content 1. Appendix 1. External data-sets used for associating microrna expression with lung squamous cell

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

Kinex Reverse Lysate Microarray KRLM-1.0. Case Study

Kinex Reverse Lysate Microarray KRLM-1. Case Study Probing with an Anti-phospho-ERK1/2 Antibody The Kinex Reverse Lysate Microarray (KRLM) is a powerful tool for rapid characterization of a protein for