Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
|
|
- Victor Goodwin
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock during 2 consecutive days. Light and gray areas reflect subjective days and nights, respectively. B) Polar plot showing phases and daily fold changes (log2 FC) of Cirbp expression in different tissues. The red-blue gradient circle represents mouse CBT values around the clock, with red and blue symbolizing high and low temperatures, respectively. The data used for generating the diagrams shown in panels A) and B) were extracted from (Zhang et al., 2014). C) Temporal Cirbp mrna and pre-mrna accumulations (represented in RPKM) in liver samples collected around the clock from mice fed ad libitum (Atger et al., 2015). D) Autoradiograph of the Cirbp 5 UTR RPA with pooled T7 polymerase-amplified crna samples collected in 3 experiments from cells exposed to simulated amplified body temperature cycles (33.5⁰C ⁰C). The Cirbp RNA probe was designed to protect the bp (exon 1 - exon 3) of the major mrna transcript (and the remaining parts of the putative truncated isoforms) and the additional upstream sequence of 63 bp of the longer putative alternative isoform. ZT: Zeitgeber Time. Semiquantitative PCR analysis of Cirbp 5 RACE samples from NIH3T3 cells incubated at 37⁰C and 32⁰C for various time periods (E) and of Cirbp 3 RACE samples collected 6 h after the temperature shift (F). major Cirbp isoform; * Cirbp precursor with un-spliced intron 6. The seemingly higher expression of this transcript at 38⁰C was found to be insignificant by other more quantitative methods discussed in the main text. The apparently temperature-dependent levels of the shorter DNA fragments (within the brackets) were not reproducible and likely represent PCR artifacts. Images of 3 independent experiments are shown in each panel.
2 Supplemental Figure S2. CMV-LMLucR construct expression analysis. A) qpcr analysis of LMLucR mrna levels at minimum (35.5⁰C) and maximum (38.5⁰C) temperature values (lower panel, red arrows) in a NIH3T3 stable cell line expressing a CMV-LMLucR transgene. Data are normalized to Ppib levels and presented as FC between the sample and the 38.5⁰C sample. (1 to 3: biological replicates). B) Example of how bioluminescence background was removed from raw data. Upper panel: The raw bioluminescence count track (black) is fitted with its baseline curve (green). Lower panel: The red curve was obtained by calculating the ratios between measured photon counts (black in upper panel) and estimated background values (green in upper panel). Supplemental Figure S3. mrna stability cannot account for temperature-dependent Cirbp mrna accumulation. Representative images of RNase protection assays with T7- amplified crna samples collected at different time points after temperature down-shift (38⁰C 33⁰C) (A) and up-shift (33⁰C 38⁰C) (B). The probes used were the same Cirbp intron 6 - exon 7 and Ppib exon 6 probes as in Figure 1. C) Quantification of the RPA experiment. Black circles represent the measured Cirbp signals in two biological replicates, black lines the calculated fits and red dotted lines indicate the half-lives at the two temperatures. The shaded gray areas indicate two standard deviations (calculated from the raw data) around the fit. D) The simplest model describing pre-mrna and mrna dynamics. The transcription rate is denoted as k s, pre-mrnas decay with a rate k p and processing (splicing) of pre-mrnas into mature mrnas occurs at the rate ρ. Finally, the mrnas are degraded at the rate k m. E) A more complex model than that shown in (D). In model (E) pre-mrnas exist in two states: pre-mrnas prone to degradation and pre-mrnas prone to splicing. In the full form of the model (Supplemental Materials and Methods), shown on the upper part of the cartoon, a premrna molecule can reversibly switch between the two states. Assuming fast switching, the model reduces to the lower part of the cartoon, where a single parameter α controls the
3 fraction of splice-prone pre-mrnas in the total pool of pre-mrnas (Supplemental Materials and Methods). The rest of the reactions in this model are identical to those of model (D). F) Graphs show the measured qpcr values for the Cirbp intron 1 amplicon (green symbols). The green lines show the prediction from the mathematical model (independently fitted to the RNA-seq experiment in Figure 4). The shaded green areas represent the estimated uncertainty of the fit. G) qpcr analysis of the LMlucR amplicon levels in 3T3 Flp-In stable cell lines expressing gcirbp-lmlucr and Cirbp-cDNA-LMLucR transgenes. Cells were seeded and kept for 24 h at 37⁰C to avoid the potential confounding response of the CMV promoter to the serum change. The cells were then incubated at 33⁰C or 38⁰C for 13 h and shifted to the opposite temperature for 9 h. n 3 biological replicates for each. Data are normalized to endogenous Ppib levels and presented as FCs between a particular sample at 38⁰C and 33⁰C. Bars represent SDs. (*) p<0.05, t-test assuming unequal variances. Supplemental Figure S4. Temperature-dependent Cirbp degradation pathways do not involve the usual degradation machinery. A) qpcr analysis (left panels) of Cirbp and Lgals1 transcripts in AMO-treated (2.5 nmol of Cirbp intron 4 - exon 5 and Lgals1 intron 1 - exon 2 AMO oligonucleotide each) and control (5 nmol of Standard control oligo) samples 16 h after temperature shift/transfection. n=2 series of 3 biological replicates; data were normalized to endogenous Ppib mrna levels and presented as FCs between a particular sample and a control 38⁰C sample of the same series; (*) p<0.05, t-test assuming unequal variances. (Right panel) Gel image of semiq. PCR analysis of Cirbp transcripts in AMOtreated and control samples. * constitutive Cirbp mrna ( ); shorter splice isoform accumulating in AMO-treated cells. qpcr analysis of Cirbp mrna and pre-mrna levels in cells transfected with sirnas directed against Xrn2 (B), Dom3z (C), Exosc9 (D), Exosc10 (E) and Xrn1 (F) transcripts. n 3 biological replicates for each. Data are normalized to
4 endogenous Ppib levels and presented as FCs between a particular sample and the average value of 38⁰C control samples. Bars represent SDs. Supplemental Figure S5. Splicing-dependent regulatory element in Cirbp intron 1 enables temperature-mediated Cirbp expression. (A) Schematic representation of Cirbpluciferase reporter constructs with (+) or without (-) temperature-dependent expression. (B) Bioluminescence tracks of the gcirp-lmlucr (construct A) and LMLucR-gCirbp (E) reporter constructs in transiently transfected cells. Representative image of n 3 experiments. C) Representative semi-qpcr gel image of LMLucR-Cirbp amplicons in samples collected from cells transiently transfected with LMLucR-gCirbp construct (E) incubated at 33⁰C and 38⁰C. Arrow - full length LMLucR F + Cirbp 5 UTR R amplicon; arrowhead & asterisk - amplicons stemming from transcripts arisen through alternative use of splice donor sites in the LMLucR gene. Supplemental Figure S6. Genome-wide analysis by RNA-seq reveals a role of temperature in regulating pre-mrna splicing efficiency and mrna stability. A) Identification of thermo-sensitive genes. Number of identified thermo-sensitive genes as a function of the cutoff value for the minimum mrna (log2 FC relative to time zero), and a p- value cutoff (marked on the different columns, calculated by edger). In this study we used 0.5 as the minimum allowed mrna log2 FC cutoff and p<0.05, which resulted in the identification of 201 thermo-sensitive genes. B) Examples of mrna and pre-mrna expression profiles at the two temperatures for cold-inducible (Nxpe4) and heat-inducible (Rnf151) genes, both of which reached a new steady-state. The black circles and green triangles denote the mrna and pre-mrna measurements, respectively. The solid lines show the best fit and the shaded area its uncertainty range. C) Among the thermo-sensitive genes we identified a subset of transiently responding genes (Supplemental Table S5, details in
5 Supplemental Materials and Methods). Here we show the temporal mrna and pre-mrna accumulation profiles for two transiently induced genes, with Txnrd3 and Hsp90 representing a cold- and heat-inducible gene, respectively. The description of the symbols is the same as that used in B). Supplemental Figure S7. RNA-seq data analysis. A) Normalization of RNA-seq data at 38⁰C and 33⁰C to the total number of exon-exon junction reads in each library for the two biological replicates (rep1 and rep2). Fold changes (FC) of pre-mrna (green boxes) and mrna (violet boxes) transcripts at each time point (t1-9h) were normalized to the time point 0. As expected, for the large majority of genes temperature did not affect mrna and premrna accumulation. Hence, the mean FC for mrna and pre-mrna is centered near zero, marked by the horizontal dashed line. B) DNase I hypersensitivity site profiles (black) from the modencode project (Celniker et al., 2009) for six mouse tissues at the Cirbp locus shown with its RNA expression track in blue. The reads from the DNase I hypersensitive site (DHS) within the first intron of Cirbp (red-shaded area) were omitted for the quantification of pre-mrna transcripts (see Supplemental Materials and Methods). Supplemental Table Legends for Excel Files Supplemental Table S4. Splice site and functional RNA motif analysis of the Cirbp premrna sequence by the ASSP and RegRNA.2 algorithms. Supplemental Table S5. Lists of temperature-dependent transcripts and RNA processing steps identified by the ATSS RNA-seq analysis. Tabs 1-6: Relative abundances of mrnas and pre-mrnas for cold-inducible (C-IN), heat inducible (H-IN) and transiently temperature-responsive transcripts. Tabs 7 and 8: Probabilities that the indicated model
6 parameters are changed following the temperature shifts for cold- and heat-inducible CIRBPbinding and non-binding transcripts. Supplemental Table S6. Gene ontology analysis for the set of cold-inducible and heatinducible genes performed by the DAVID Bioinformatics Resources algorithm. Supplemental Table S8. List of oligonucleotide sequences. Supplemental Table S9. List of reporter constructs and cloning strategies.
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationEffects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More informationRASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
More informationMODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
More informationMODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
More informationSupplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationSupplemental Figure 1. Small RNA size distribution from different soybean tissues.
Supplemental Figure 1. Small RNA size distribution from different soybean tissues. The size of small RNAs was plotted versus frequency (percentage) among total sequences (A, C, E and G) or distinct sequences
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationLecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford
Lecture 8 Understanding Transcription RNA-seq analysis Foundations of Computational Systems Biology David K. Gifford 1 Lecture 8 RNA-seq Analysis RNA-seq principles How can we characterize mrna isoform
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationRNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationIntroduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationSupplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationBreeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
More informationSUPPLEMENTARY INFORMATION
Supplementary text Collectively, we were able to detect ~14,000 expressed genes with RPKM (reads per kilobase per million) > 1 or ~16,000 with RPKM > 0.1 in at least one cell type from oocyte to the morula
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationSUPPLEMENTARY MATERIAL
SYPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY MATERIAL Figure S1. Phylogenic studies of the mir-183/96/182 cluster and 3 -UTR of Casp2. (A) Genomic arrangement of the mir-183/96/182 cluster in vertebrates.
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationSupplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationChapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/305/ra106/dc1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationFigure mouse globin mrna PRECURSOR RNA hybridized to cloned gene (genomic). mouse globin MATURE mrna hybridized to cloned gene (genomic).
Splicing Figure 14.3 mouse globin mrna PRECURSOR RNA hybridized to cloned gene (genomic). mouse globin MATURE mrna hybridized to cloned gene (genomic). mrna Splicing rrna and trna are also sometimes spliced;
More informationSupplemental Methods RNA sequencing experiment
Supplemental Methods RNA sequencing experiment Mice were euthanized as described in the Methods and the right lung was removed, placed in a sterile eppendorf tube, and snap frozen in liquid nitrogen. RNA
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Histogram showing hybridization signals for chicken (left) and quail (right) genomic DNA analyzed by Chicken GeneChip (n=3). www.nature.com/nature 1 Supplementary Figure 2. Independent
More informationComputational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationSupplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,
More informationSupplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression.
Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. (a) Characterization of c-independent SP8 cells. Stainings for maturation markers (top)
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationSupplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
More informationSupplementary Figure 1: Experimental design. DISCOVERY PHASE VALIDATION PHASE (N = 88) (N = 20) Healthy = 20. Healthy = 6. Endometriosis = 33
DISCOVERY PHASE (N = 20) Healthy = 6 Endometriosis = 7 EAOC = 7 Quantitative PCR (mirnas = 1113) a Quantitative PCR Verification of Candidate mirnas (N = 24) VALIDATION PHASE (N = 88) Healthy = 20 Endometriosis
More informationREGULATED SPLICING AND THE UNSOLVED MYSTERY OF SPLICEOSOME MUTATIONS IN CANCER
REGULATED SPLICING AND THE UNSOLVED MYSTERY OF SPLICEOSOME MUTATIONS IN CANCER RNA Splicing Lecture 3, Biological Regulatory Mechanisms, H. Madhani Dept. of Biochemistry and Biophysics MAJOR MESSAGES Splice
More informationReceived 26 January 1996/Returned for modification 28 February 1996/Accepted 15 March 1996
MOLECULAR AND CELLULAR BIOLOGY, June 1996, p. 3012 3022 Vol. 16, No. 6 0270-7306/96/$04.00 0 Copyright 1996, American Society for Microbiology Base Pairing at the 5 Splice Site with U1 Small Nuclear RNA
More informationChapter II. Functional selection of intronic splicing elements provides insight into their regulatory mechanism
23 Chapter II. Functional selection of intronic splicing elements provides insight into their regulatory mechanism Abstract Despite the critical role of alternative splicing in generating proteomic diversity
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationSelective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
More informationAbSeq on the BD Rhapsody system: Exploration of single-cell gene regulation by simultaneous digital mrna and protein quantification
BD AbSeq on the BD Rhapsody system: Exploration of single-cell gene regulation by simultaneous digital mrna and protein quantification Overview of BD AbSeq antibody-oligonucleotide conjugates. High-throughput
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationIn vitro DNase I foot printing. In vitro DNase I footprinting was performed as described
Supplemental Methods In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described previously 1 2 using 32P-labeled 211 bp fragment from 3 HS1. Footprinting reaction mixes contained
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationSupplement to SCnorm: robust normalization of single-cell RNA-seq data
Supplement to SCnorm: robust normalization of single-cell RNA-seq data Supplementary Note 1: SCnorm does not require spike-ins, since we find that the performance of spike-ins in scrna-seq is often compromised,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts
More informationDoctor of Philosophy
Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationSupplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 SNARE Probes for FRET/2pFLIM Analysis Used in the Present Study. mturquoise (mtq) and Venus (Ven) are in blue and yellow, respectively. The soluble N-ethylmaleimide-sensitive
More information4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
More informationDOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationSupplemental Material for:
Supplemental Material for: Transcriptional silencing of γ-globin by BCL11A involves long-range interactions and cooperation with SOX6 Jian Xu, Vijay G. Sankaran, Min Ni, Tobias F. Menne, Rishi V. Puram,
More informationProtein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
More informationSimple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationSUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Formation of the AA5x. a, Camera lucida drawing of embryo at 48 hours post fertilization (hpf, modified from Kimmel et al. Dev Dyn. 1995 203:253-310). b, Confocal microangiogram
More informationSupplementary Information
Supplementary Information Precursors of trnas are stabilized by methylguanosine cap structures Takayuki Ohira and Tsutomu Suzuki Department of Chemistry and Biotechnology, Graduate School of Engineering,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationThe Emergence of Alternative 39 and 59 Splice Site Exons from Constitutive Exons
The Emergence of Alternative 39 and 59 Splice Site Exons from Constitutive Exons Eli Koren, Galit Lev-Maor, Gil Ast * Department of Human Molecular Genetics, Sackler Faculty of Medicine, Tel Aviv University,
More informationTITLE: The Role Of Alternative Splicing In Breast Cancer Progression
AD Award Number: W81XWH-06-1-0598 TITLE: The Role Of Alternative Splicing In Breast Cancer Progression PRINCIPAL INVESTIGATOR: Klemens J. Hertel, Ph.D. CONTRACTING ORGANIZATION: University of California,
More informationRNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationMicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
More informationncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
More information