Reconstruc*ng Human Tumor Histories By Comparing Genomes From Different Parts of the Same Cancer
|
|
- Edwin Briggs
- 5 years ago
- Views:
Transcription
1 Reconstruc*ng Human Tumor Histories By Comparing Genomes From Different Parts of the Same Cancer Darryl Shibata Professor of Pathology University of Southern California Keck School of Medicine
2 Soma*c Evolu*on in the Clinic Widely Accepted That Tumors Evolve Many Different Possible Pathways Serial Observa*ons Imprac*cal A Pa*ent Suddenly Has Cancer Clinical Ques*ons (Pa*ent Specific): How Did This Tumor Evolve? Do Different Evolu*onary Histories MaWer?
3 An Approach To Pa*ent Specific Tumor Histories Coalescent Theory Molecular Clocks Topography LeY Right tumor genomes Present Number of Differences ( *me or PWD) First Transformed Cell Time Past
4 2011 Basic Cancer Ancestry Reconstruc2on Cancer in a 70 YO Back In Time first transformed cell tumor mito2c age total mito2c age 1941 (birth) zygote
5 A Problem: The Evolu*on of Any Individual Human Cancer is Unknown st transformed cell Sequen*al or Clonal Evolu*on Big Bang (full malignant poten*al at transforma*on) Older Parts More Diverse Uniform Diversity
6 Colorectal Cancer: Adenocarcinoma (small glands or popula2ons or neighborhoods of adjacent cells)
7 How To Sample Tumor Diversity? EDTA Washout: Single Cancer Glands Isolate DNA PCR clock locus clone PCR products into bacteria sequence individual clones calculate PWD (pairwise distance)
8 How To Sample Tumor Diversity? Common Gland Ancestor young cancer older cancer start First Transformed Cell gland age tumor age gland age Common Gland Ancestor gland age tumor age gland age Time Or Diversity
9 Somatic Cell Molecular Clock Problems: --- Somatic Cell DNA Replication Fidelity Too High! Potential Solution: Epigenetic Molecular Clock 5 3 CGATCTGCATCGACTGCCGCG GCTAGACGTAGCTGACGGCGC Substitute the 5 to 3 Order of Bases With the 5 to 3 Order of CpG DNA Methylation
10 Replica2on Clock Molecular Clock: Informa*on Passed From Cell to Cell Epigene*c Fidelity is less than Gene*c Fidelity 10-9 Genome Replica2on versus 10-5
11 Human Colorectal Cancer ley side 5 3 six cancer glands six cancer glands right side
12 PWDs Between Cancer Sides Differ Between Cancers (N=12) BGN pairwise distance between sides es*mated divisions (mito*c age) ley tumor side Different human cancers have different ages first transformed cell right tumor side
13 Cancer Glands From LeX and Right Sides Are Similar For The 12 Human CRCs ley side intragland PWD A p=0.0007, r=0.84 BGN right side intragland PWD ley side intragland PWD p= , r=0.94 LOC right side intragland PWD Glands Within A Cancer Have Similar Ages
14 ley tumor side right tumor side first transformed cell Pairwise Distance Older Cancers Have older Glands younger cancer within gland left right between sides within gland left right between sides older cancer 0
15 Simple Models of Tumor Growth 1 intragland PWD 4 2 BGN 3 4 1st transformed cell Cancer 2 Cancer 12 glands differ in age or PWDs glands have similar ages or PWDs
16 Molecular Clocks: Different Speeds 1) DNA CpG Methyla*on (Epigene*c ) 2) Chromosomal Copy Number ( CIN ) 3) Loss of Heterozygosity (LOH) 4) DNA Sequence Muta*ons Challenge Is to Gather the Data And Then Interpret the Data Fast Slow Illumina 660 SNP Microarray
17 Chromosomal Changes 5 3 LOH 5 LeY Right..AGCTCGCA TCTTCAAGCCT ACCATTAAT...AGCTCGCA TCTTCAAGCCT ACCATTAAT AGCTCGCA TCTTCAAGCCT ACCATTAAT...AGCTCGCA TCTTCAAGCCT ACCATTAAT. 5 3
18 An Approach To Pa*ent Specific Tumor Histories Coalescent Theory Molecular Clocks Topography LeY Right Present Number of Differences ( *me ) Time First Transformed Cell Past
19 Genomes Are Historical Documents (almost perfect copies of copies) zygote (start) Acknowledgements Yasushi Yatabe Kyoung-Mee Kim Jung Yeon Kim Peter Calabrese Kim Siegmund Paul Marjoram Simon Tavare cancer cell (present day)
Missing Heritablility How to Analyze Your Own Genome Fall 2013
Missing Heritablility 02-223 How to Analyze Your Own Genome Fall 2013 Heritability Heritability: the propor>on of observed varia>on in a par>cular trait (as height) that can be agributed to inherited gene>c
More informationThe Mito,c Spindle: A Closer Look. The Mito,c Spindle. Aster. a radial array of short microtubules. extends from each centrosome
The Mito,c Spindle: A Closer Look Aster a radial array of short microtubules extends from each centrosome anchors centrosome to rest of cytoskeleton The spindle includes the centrosomes, the spindle microtubules,
More informationNicholas Chiorazzi The Feinstein Ins3tute for Medical Research Northwell Health Manhasset, NY
A Somewhat Different View of the Gene3c Portrait of Chronic Lymphocy3c Leukemia Nicholas Chiorazzi The Feinstein Ins3tute for Medical Research Northwell Health Manhasset, NY Acknowledgments Davide Bagnara
More informationAML Genomics 11/27/17. Normal neutrophil maturation. Acute Myeloid Leukemia (AML) = block in differentiation. Myelomonocy9c FAB M5
AML Genomics 1 Normal neutrophil maturation Acute Myeloid Leukemia (AML) = block in differentiation AML with minimal differen9a9on FAB M1 Promyelocy9c leukemia FAB M3 Myelomonocy9c FAB M5 2 1 Principle
More informationCell Division Mitosis Notes
Cellular Division Learning Goals I can understand and explain that every organism requires a set of instruc:ons that specifies its traits, that this hereditary informa:on (DNA) contains genes located in
More informationNew Fron)ers in Therapies for Autoimmunity
New Fron)ers in Therapies for Autoimmunity Preview Discuss spectrum of autoimmune research at MUSC Iden)fy some of the key inves)gators in basic and clinical research at MUSC Discuss specific areas of
More informationBMC Biology. Research article Human hair genealogies and stem cell latency Jung Yeon Kim 1,4, Simon Tavaré 2,3 and Darryl Shibata* 1.
BMC Biology BioMed Central Research article Human hair genealogies and stem cell latency Jung Yeon Kim 1,4, Simon Tavaré 2,3 and Darryl Shibata* 1 Open Access Address: 1 Department of Pathology, University
More informationProcess of Science and hypothesis tes2ng in Behavioral Ecology
Process of Science and hypothesis tes2ng in Behavioral Ecology Goal: understand the way that scien2fic hypotheses and methodologies are used to gain knowledge. What separates science from non- science?
More informationCharacteriza*on of Soma*c Muta*ons in Cancer Genomes
Characteriza*on of Soma*c Muta*ons in Cancer Genomes Ben Raphael Department of Computer Science Center for Computa*onal Molecular Biology Soma*c Muta*ons and Cancer Clonal Theory (Nowell 1976) Passenger
More informationGenetic Tests and Genetic Counseling How to Analyze Your Own Genome
Genetic Tests and Genetic Counseling 02-223 How to Analyze Your Own Genome Genetic Tests for Huntington Disease Hun7ngton Disease Incurable brain disorder that runs in families Movement, cogni7ve, and
More informationGlioblastoma mul,forme
Glioblastoma mul,forme Glioblastoma mul,forme (GBM), or Glioblastoma, or Grade IV Astrocytoma is the most common and most aggressive malignant primary brain tumor. GBM is usually involving glial cells,
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationCell Cycle and Mitosis
Ch 4 BIOL 100 Cell Cycle and Mitosis The Key Roles of Cell Division Cell division Cellular reproduc2on An ability of organisms that best dis2nguishes living things from nonliving ma:er Cell Division Unicellular
More informationEmerging gene)cs in schizophrenia: Real challenges for crea)ng animal models
Emerging gene)cs in schizophrenia: Real challenges for crea)ng animal models Steven A McCarroll, PhD Stanley Center for Psychiatric Research, Broad Ins7tute Department of Gene7cs, Harvard Medical School
More informationTargeted Treatments for Au0sm: from Genes to Pharmacology
Targeted Treatments for Au0sm: from Genes to Pharmacology Paul Wang, MD Associate Clinical Professor of Pediatrics, Yale University School of Medicine Vice President for Clinical Development, Seaside Therapeu0cs,
More informationThe Hierarchical Organization of Normal and Malignant Hematopoiesis
The Hierarchical Organization of Normal and Malignant Hematopoiesis NORMAL Hematopoie2c Stem Cell (HSC) Leukemia Stem Cells (LSC) MPP MLP CMP Leukemic Progenitors MEP GMP B/NK ETP Leukemic Blasts Erythrocytes
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationThe Cancer Genome Atlas
The Cancer Genome Atlas July 14, 2011 Kenna M. Shaw, Ph.D. Deputy Director The Cancer Genome Atlas Program TCGA: Core Objectives Launched in 2006 as a pilot and expanded in 2009, the goals of TCGA are
More informationSession 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016
Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators
More informationAssociation mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
More informationCancer Genomics and Personalized Oncology. Dirce M Carraro, PhD Scien0st, Head of Genomics and Biology Molecular Group
Cancer Genomics and Personalized Oncology Dirce M Carraro, PhD Scien0st, Head of Genomics and Biology Molecular Group Cancer in Brazil 600,000 new cases/year Popula0on: 210,867,959 Number of new cases:
More informationCopy Number Variations and Association Mapping Advanced Topics in Computa8onal Genomics
Copy Number Variations and Association Mapping 02-715 Advanced Topics in Computa8onal Genomics SNP and CNV Genotyping SNP genotyping assumes two copy numbers at each locus (i.e., no CNVs) CNV genotyping
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationConsidera*ons when undergoing personal genotyping
Considera*ons when undergoing personal genotyping Kelly Ormond, MS, CGC Louanne Hudgins, MD, FACMG January 19, 2011 GENE 210 Disclosures and introduc*ons Professor Ormond provided paid consulta*on for
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More informationEvolu+on of Disease genes
Evolu+on of Disease genes Many human diseases are caused by muta1ons in single genes 1 A synthe+c pathway and associated diseases Autosomal dominant condi+ons 2 Dominant Disorders A single mutant gene
More informationRNA- seq Introduc1on. Promises and pi7alls
RNA- seq Introduc1on Promises and pi7alls DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different func1onal RNAs Which RNAs (and some1mes
More informationRight Answers, Wrong Ques2ons. Ralph I Horwitz
Right Answers, Wrong Ques2ons Ralph I Horwitz Disclosures Employed by GlaxoSmithKline Views expressed reflect mine alone and not those of GSK Right Answer, Wrong Ques2on A young couple moves into an apartment
More informationMolEcular Taxonomy of BReast cancer International Consortium (METABRIC)
PERSPECTIVE 1 LARGE SCALE DATASET EXAMPLES MolEcular Taxonomy of BReast cancer International Consortium (METABRIC) BC Cancer Agency, Vancouver Samuel Aparicio, PhD FRCPath Nan and Lorraine Robertson Chair
More informationLearning Objec1ves. Study Design Strategies. Cohort Studies 9/28/15
9/28/15 Learning Objec1ves Describe the features, advantages and disadvantages of the observa1onal study designs Explain why the overall study design is important when evalua1ng studies & applying their
More informationIntegration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium
Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium Ulrike Peters Fred Hutchinson Cancer Research Center University of Washington U01-CA137088-05, PI: Peters
More informationCommon Data Elements: Making the Mass of NIH Measures More Useful
Common Data Elements WG Common Data Elements: Making the Mass of NIH Measures More Useful Jerry Sheehan Assistant Director for Policy Development Na?onal Library of Medicine Gene/c Alliance Webinar Series
More informationCellometer Image Cytometry for Cell Cycle Analysis
Cellometer Cytometry for Cell Cycle Analysis Importance of Cell Cycle Research Oncology: Since cancer cells often undergo abnormal cell division and proliferation, it is important to understand the cell
More informationCanadian Bioinforma1cs Workshops
5/12/16 Canadian Bioinforma1cs Workshops www.bioinforma1cs.ca Module #: Title of Module 2 1 Module 3 Introduc1on to WGBS and analysis Guillaume Bourque Learning Objec/ves of Module Know the different technologies
More informationGeneral Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
More informationBin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,
The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,
More informationEpigene.cs: What is it and how it effects our health? Overview. Dr. Bill Stanford, PhD OFawa Hospital Research Ins.tute University of OFawa
Epigene.cs: What is it and how it effects our health? Dr. Bill Stanford, PhD OFawa Hospital Research Ins.tute University of OFawa Overview Basic Background Epigene.cs in general Epigene.cs in cancer Epigene.cs
More informationVibration volleys. Standard repeating unit. crossed with. Chrysoperla johnsoni parent: Volley period RESULTS
Table 51 1 Regulatory Genes and Behavior A master regulatory gene can control many behaviors Example a single gene controls many behaviors of the male fruit fly courtship ritual Mul:ple independent genes
More informationLYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)!
LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)! Kathryn Singh, MPH, MS, LCGC Associate Clinical Professor Assistant Director, Graduate Program in Genetic Counseling Division of Genetic and Genomic
More informationSupplementary Note. Nature Genetics: doi: /ng.2928
Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped
More informationAssessment performed on Tuesday, July 29, 2014, at Lions Gate Hospital, North Vancouver
Assessors report for ciqc Run 37: BRAF V600E (April 2014) Assessors: B Gilks, R Wolber, K Ung, P Tavassoli, J Garratt and J Won (recorder) Assessment performed on Tuesday, July 29, 2014, at Lions Gate
More informationGenomic Instability. Kent Nastiuk, PhD Dept. Cancer Genetics Roswell Park Cancer Institute. RPN-530 Oncology for Scientist-I October 18, 2016
Genomic Instability Kent Nastiuk, PhD Dept. Cancer Genetics Roswell Park Cancer Institute RPN-530 Oncology for Scientist-I October 18, 2016 Previous lecturers supplying slides/notes/inspiration Daniel
More informationThe role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia
The role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia Adrian Zordan, Meaghan Wall, Ruth MacKinnon, Pina D Achille & Lynda Campbell Victorian Cancer Cytogenetics Service (VCCS)
More informationThe feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
More informationGeneral Session 7: Controversies in Screening and Surveillance in Colorectal Cancer
General Session 7: Controversies in Screening and Surveillance in Colorectal Cancer Complexities of Pathological Assessment: Serrated Polyps/Adenomas Carolyn Compton, MD, PhD Professor of Life Sciences,
More informationNovel treatments for SCC Andrés Felipe Cardona, MD MS PhD.
Novel treatments for SCC Andrés Felipe Cardona, MD MS PhD. Clinical and Transla,onal Oncology Group Ins,tute of Oncology, Fundación Santa fe de Bogotá Clinical Epidemiology Cochrane Colombian Branch /
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationWHO posi)on paper on influenza vaccines*
WHO posi)on paper on influenza vaccines* Geneva, Switzerland Published in the Weekly Epidemiological Record on 23 November 2012 * This posi(on paper is concerned mainly with vaccines and vaccina(on against
More informationApplication of Whole Genome Microarrays in Cancer: You should be doing this test!!
Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical
More informationA Transla)onal Framework for Methodological Rigor to Improve Pa)ent Centered Outcomes in End of Life Cancer Research
A Transla)onal Framework for Methodological Rigor to Improve Pa)ent Centered Outcomes in End of Life Cancer Research Francesca Dominici, PhD Senior Associate Dean for Research Professor of Biostatistics
More informationGenomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy
Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative
More informationCell Cycle and Mitosis
Ch 12 BIOL 221 Cell Cycle and Mitosis The Key Roles of Cell Division Cell division Cellular reproduc2on An ability of organisms that best dis2nguishes living things from nonliving ma:er Cell Division Unicellular
More informationBRAF Testing In The Elderly: Same As in Younger Patients?
EGFR, K-RAS, K BRAF Testing In The Elderly: Same As in Younger Patients? Nadine Jackson McCleary MD MPH Gastrointestinal Oncology Dana-Farber/Harvard Cancer Care Boston, MA, USA Outline Colorectal cancer
More informationAnatomic Molecular Pathology: An Emerging Field
Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty
More informationTo discuss. Predictive Value of BRCA Histology. Tumour morphology: BRCA-1. Hereditary breast-ovarian cancer (HBOC)
The role of histopathology in iden2fying gene2c condi2ons associated with gynaecological malignancies, with special a7en2on to pathological manifesta2ons of Lynch syndrome Dr Raji Ganesan Consultant Gynaecological
More informationChromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011
Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,
More informationGenes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
More informationRALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration
More informationEvolu&on of Disease genes
Evolu&on of Disease genes Many human diseases are caused by muta1ons in single genes A synthe&c pathway and associated diseases Autosomal dominant condi&ons Dominant Disorders A single mutant gene is sufficient
More informationFemale Reproduc.ve System. Kris.ne Kra7s, M.D.
Female Reproduc.ve System Kris.ne Kra7s, M.D. Female Reproduc.ve System Outline Cervix Uterus Ovaries Breast Female Reproduc.ve System Outline Cervix Cervical carcinoma Cervical Carcinoma Once the most
More informationMRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.
SALSA MLPA probemix P056-C1 TP53 Lot C1-0215 & lot C1-0214. As compared to version B1 (lot B1-1011) most of the reference and flanking probes have been replaced and several have been added. Furthermore,
More informationEpigenetic drift in aging twins
Epigenetic drift in aging twins Qihua Tan, MD, PhD Kaare Christensen, MD, PhD Lene Christiansen, PhD Epidemiology, Biostatistics and Biodemography, Institute of Public Health Unit of Human Genetics, Institute
More informationNo evidence of clonally selected somatic genomic alterations in cancer associated
Supplementary Data Resource No evidence of clonally selected somatic genomic alterations in cancer associated fibroblasts from human breast and ovarian carcinomas Wen Qiu, Min Hu, Anita Sridhar, Ken Opeskin,
More informationLESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
More informationLearning Objec1ves. Study Design Considera1ons in Clinical Pharmacy
9/28/15 Study Design Considera1ons in Clinical Pharmacy Ludmila Bakhireva, MD, PhD, MPH Pree Sarangarm, PharmD, BCPS Learning Objec1ves Describe the features, advantages and disadvantages of the observa1onal
More informationGene Expression with Chemical Modification Induced by SAT Imagery Therapy
Short Communication Gene Expression with Chemical Modification Induced by SAT Imagery Therapy Kei-Ichiro Kobayashi * and Tsunetsugu Munakata ** Counseling Room Vivid Life *, Chair, Institute of Health
More informationGenomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
More informationNGS, Cancer and Bioinforma;cs. 20/10/15 Yannick Boursin
NGS, Cancer and Bioinforma;cs 1 NGS and Clinical Oncology NGS in hereditary cancer genome tes;ng BRCA1/2 (breast/ovary cancer) XPC (melanoma) ERCC1 (colorectal cancer) NGS for personalized cancer treatment
More informationNature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
More informationSotos syndrome and the NSD1 gene. Jamie Masliah Gene4cs 564
Sotos syndrome and the NSD1 gene Jamie Masliah Gene4cs 564 What is Sotos syndrome? Impaired Learning (Turkmen, 2003) Euro J Hum Genet NSD1 is mutated in Sotos syndrome 2696 aa Molecular Func4on Zn 2+ GO
More informationThe following slides are provided as presented by the author during the live educa7onal ac7vity and are intended for reference purposes only.
The following slides are provided as presented by the author during the live educa7onal ac7vity and are intended for reference purposes only. If you have any ques7ons, please contact Imedex via email at:
More informationTaking a closer look at trio designs and unscreened controls in the GWAS era
Taking a closer look at trio designs and unscreened controls in the GWAS era PGC Sta8s8cal Analysis Call, November 4th 015 Wouter Peyrot, MD, Psychiatrist in training, PhD candidate Professors Brenda Penninx,
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationTumorNext-Lynch. genetic testing for hereditary colorectal or uterine cancer
TumorNet-Lynch genetic testing for hereditary colorectal or uterine cancer What Are the Causes of Hereditary Colorectal Cancer? sporadic 70% familial 20% hereditary 10% Lynch syndrome, up to 4% Familial
More informationEpigene'cs, Hygiene Theory & the Origins of Asthma. Molecular Basis for Health & Disease: We are our genes. Health Protein.
Epigene'cs, Hygiene Theory & the Origins of Asthma Andy Liu, MD Pulmonary Section The Breathing Institute Children s Hospital Colorado National Jewish Health University of Colorado Denver School of Medicine
More informationOncology 520 Epigene0cs and Cancer. February 16, 2011
Oncology 520 Epigene0cs and Cancer February 16, 2011 Outline What is epigene0cs? What are examples of epigene0c processes? What is the epigenome and how is it decoded? Are epigene0c mechanisms important
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationRisk-prediction modelling in cancer with multiple genomic data sets: a Bayesian variable selection approach
Risk-prediction modelling in cancer with multiple genomic data sets: a Bayesian variable selection approach Manuela Zucknick Division of Biostatistics, German Cancer Research Center Biometry Workshop,
More informationChi sono i candidati agli inibitori di JAK2
Chi sono i candidati agli inibitori di JAK2 Francesco Passamon, Hematology, University Hospital Varese, Italy Ruxoli8nib (US approved in MF; EAP study and compassionate use in Italy) SAR302503 (phase 3
More informationNa#onal Neutropenia Network Family Conference July 12, 2014
Na#onal Neutropenia Network Family Conference July 12, 2014 Jim Connelly, MD Assistant Professor of Pediatrics and Communicable Diseases Blood and Marrow Transplant Program University of Michigan Transplant
More informationMALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) The Power of One Adapted from Internet Single Cell Genomic Studies Ultra Low Sample Input Advances and applications of
More informationTITLE: Genetic and Epigenetic Differences in Monozygotic Twins with NF1
AD AWARD NUMBER: W81XWH-10-1-0867 TITLE: Genetic and Epigenetic Differences in Monozygotic Twins with NF1 PRINCIPAL INVESTIGATOR: Elizabeth K. Schorry, M.D. CONTRACTING ORGANIZATION: Cincinnati Children's
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationGametogenesis. To complete this worksheet, select: Module: Continuity Activity: Animations Title: Gametogenesis. Introduction
Gametogenesis To complete this worksheet, select: Module: Continuity Activity: Animations Title: Gametogenesis Introduction 1. a. Define gametogenesis. b. What cells are gametes? c. What are the two cell
More informationCell Division Mitosis Notes
Cell Division Mitosis Notes Cell Division process by which a cell divides into 2 new cells Why do cells need to divide? 1.Living things grow by producing more cells, NOT because each cell increases in
More informationCell Division Mitosis Notes
Cell Division Mitosis Notes Cell Division process by which a cell divides into 2 new cells Why do cells need to divide? 1.Living things grow by producing more cells, NOT because each cell increases in
More informationOperant Condi-oning. Cogni-on and Problem Solving. Cogni-on and Problem Solving. Cogni-on. a process of knowing
Operant condi-oning a type of associa,ve learning in which an animal learns to associate one of its behaviors with a reward or punishment It is also called trial- and- error learning Example a rat that
More informationa) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
1 2 APPENDIX Legends to figures 3 4 5 Figure A1: Distribution of perfect SSR along chromosome 1 of V. cholerae (El-Tor N191). a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
More informationDeveloping Better Medicine
SURF 2013 Marietta L. Harrison, PhD Director, Oncological Sciences Center in Discovery Park Professor, Medicinal Chemistry and Molecular Pharmacology How we do it today One size fits all Medicines aren
More informationEpigenetics and Autoimmune Disease
Epigenetics and Autoimmune Disease Lisa F. Barcellos, PhD, MPH Associate Professor UC Berkeley School of Public Health QB3 Genetic Epidemiology and Genomics Laboratory ACTRIMS, May 30, 2014 Dallas, TX
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationEpigenetic programming in chronic lymphocytic leukemia
Epigenetic programming in chronic lymphocytic leukemia Christopher Oakes 10 th Canadian CLL Research Meeting September 18-19 th, 2014 Epigenetics and DNA methylation programming in normal and tumor cells:
More informationCell Division. non-mitotic cell. Dividing (mitotic) cell. (This movie has been sped up.) These chromosomes have been marked with RED fluorescence.
Cell Division These chromosomes have been marked with RED fluorescence. DNA is found in the cell nucleus Dividing (mitotic) cell non-mitotic cell (This movie has been sped up.) Cell Division and Cancer
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationWhat All of Us Should Know About Cancer and Genetics
What All of Us Should Know About Cancer and Genetics Beth A. Pletcher, MD, FAAP, FACMG Associate Professor of Pediatrics UMDNJ- New Jersey Medical School Disclosures I have no relevant financial relationships
More informationBIOH122 Session 26 Gametogenesis. Introduction. 1. a. Define gametogenesis. b. What cells are gametes?
BIOH122 Session 26 Gametogenesis Introduction 1. a. Define gametogenesis. b. What cells are gametes? c. What are the two cell division processes that occur during the cell cycle? d. Define the cell cycle.
More informationDr. Pravin D. Potdar. M.Sc, Ph.D, D.M.L.T.,DHE, DMS
Molecular Profiling of Cancer Cells Strategies for Developing Biomarkers for Targeted Therapies of Cancer Dr. Pravin D. Potdar. M.Sc, Ph.D, D.M.L.T.,DHE, DMS Head, Department of Molecular Medicine and
More informationSec$on 8. Gene$c Muta$ons, Ribosome Structure and the Tetracyclines
Sec$on 8 Gene$c Muta$ons, Ribosome Structure and the Tetracyclines Explain the mechanism of ac$on of the transcrip$onal and transla$onal inhibitors Requires knowledge of: Sec$on 6 Sec$on 7 Sec$on 8 How
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More information