No evidence of clonally selected somatic genomic alterations in cancer associated
|
|
|
- Denis Johnston
- 5 years ago
- Views:
Transcription
1 Supplementary Data Resource No evidence of clonally selected somatic genomic alterations in cancer associated fibroblasts from human breast and ovarian carcinomas Wen Qiu, Min Hu, Anita Sridhar, Ken Opeskin, Stephen Fox, Michail Shipitsin, Melanie Trivett, Ella R. Thompson, Manasa Ramakrishna, Kylie L. Gorringe, Kornelia Polyak, Izhak Haviv and Ian G. Campbell
2
3 Supplementary Figure 1. Copy number and LOH plot of ovarian tumor IC257 containing varying ratios of normal DNA contamination. The copy number and LOH plots for chromosome 17 and 18 are shown in (a) and (b), respectively. Tumor DNA for IC257 was mixed with corresponding normal DNA, in ratio of its matching normal DNA (extracted from peripheral blood lymphocytes) to prepare samples with 100%, 75%, 70%, 60%, 50% and 25% tumor DNA. The DNA was then analyzed with 250K StyI mapping array. As shown, tumor IC257 shows a complex pattern of LOH and copy number changes on chromosome 17 comprising a region of LOH coupled with copy number loss (region A), low level copy number gain (region B), high level copy number gain (arrows in region C) and copy number neutral LOH (region D). The log 2 copy number value across region A is shown for each sample. The copy number and LOH plot for chromosome 18 is shown for comparison as this chromosome shows no evidence of copy number loss or LOH. As expected, the mean log 2 copy number value across the chromosome 18 is close to zero for all tumor mixtures. Overall, the copy number and LOH changes on chromosome 17 observable with the 100% tumor sample are discernable at least down to 70% tumor content. For example, the high level amplification (region C) is easily observable even down to 25% tumor DNA. The copy number loss at region A is visible at 70% with a log 2 value of compared to the log 2 value of for the control chromosome 18. LOH across regions A and D are also discernable down to 70% tumor as evidence by the divergence of the allele specific copy number plots relative to the control chromosome 18. Purple line: 40-SNP moving average; Blue and red lines: allele-specific moving average.
4
5 Supplementary Figure 2. qmsp and qrt-pcr analyses of three CAFs cultures that were tested in xenograft assays. (a) qmsp analysis of Cxorf12 using bisulfate treated genomic DNA from the indicated samples. Each sample was analyzed in triplicate in one single experiment. Relative methylation levels normalized to ACTB (β-actin) are indicated on the y-axis. The error bar represents the variation of Cxorf12 methylation between the triplicates of each sample, normalized to the average ACTB expression. (b) qrt-pcr analysis of Cxorf12 in RNA prepared from the indicated samples. Each sample was analyzed in triplicate in one single experiment. Relative expression levels normalized to RPL39 are indicated on the y-axis in logarithmic scale. The error bar represents the variation of Cxorf12 expression between the triplicates of each sample, normalized to the average RPL39 expression. N: Normal bulk breast tissue; CAF: Cancer associated fibroblast culture; NF: Normal fibroblast culture. The qmsp and qrt-pcr results of each indicated sample is summarized in Supplementary Table 3.
6 Supplementary Table 1. Clinicopathological characteristics of ovarian cancers analyzed Sample Tumor subtype Age Grade Stage % of fibroblasts 32 serous mucinous endometrioid c serous serous mucinous a serous c endometrioid c serous c serous b mucinous endometrioid endometrioid endometrioid serous serous serous endometrioid mucinous serous serous serous endometrioid serous serous Number of samples average age Grade 1/2/3 Stage 1/2/3/4/unknown Number of samples with 70% Fibroblasts serous /5/8 0/3/8/0/3 10 endometrioid /3/4 2/1/2/1/1 7 mucinous /1/0 1/0/3/0/0 3 All types /9/12 3/4/13/1/4 20
7 Supplementary Table 2. Clinicopathological characteristics of breast cancers analyzed Sample Morphology Age Grade Stage % of fibroblasts RMH Infiltrating duct carcinoma DCIS Infiltrating duct carcinoma b Medullary carcinoma a Infiltrating duct carcinoma a Ductal carcinoma a Ductal carcinoma b Infiltrating duct carcinoma a Mucinous adenocarcinoma a Infiltrating duct carcinoma b 75 Number of samples average age Grade 2/3/9unknown Stage 2/unknown Number of samples with 75% Fibroblasts All types /6/1/1 8/2 10
8 Supplementary Table 3. Source and relevant properties of CAF cultures analyzed in the paper CAF ID tissue source xenograft assay results cultured stroma Cxorf12 qmsp of hypermethylated invasive ductal breast carcinoma, tested twice, promoted compared to matched CAF IDC-14 ER+/PR+/HER2- tumor growth normal bulk breast CAF IDC-16 CAF IDC-1819 CAF IDC-22 invasive ductal breast carcinoma, ER-/PR- /HER2+ invasive ductal breast carcinoma, ER+/PR+/HER2- invasive ductal breast carcinoma, ER-/PR- /HER2- tested twice, promoted tumor growth-but less efficiently than the other two not tested CAF IDC-24 invasive ductal breast carcinoma not tested CAF IDC-34 invasive lobular breast carcinoma, ER+/PR- /HER2- tested twice, promoted tumor growth not tested hypermethylated compared to matched normal bulk breast hypomethylated, but no matching normal to compare hypomethylated compared to matched normal bulk breast, no significant difference to matched normal stroma slightly hypomethylated compared to matched normal stroma, no significant difference to matched blood hypomethylated compared to matched normal bulk breast Cxorf12 qrt-pcr of cultured stroma lower level compared to matched normal bulk breast low level, but no matching normal fibroblast to compare, Little expression in normal bulk breast modest level, but no matching normal to compare lower level compared to matched normal stroma lower level compared to matched normal stroma lower level compared to matched normal bulk breast NR-1 invasive ductal breast carcinoma tested four times, promoted tumor growth four to five fold over normal fibroblast culture not tested not tested
9 Full details of the xenograft assay for CAF IDC 14, 16, 1819, 22, 24 and 34 are reported in M. Hu et al. REGULATION OF IN SITU TO INVASIVE BREAST CARCINOMA TRANSITION Min Hu, Jun Yao, Danielle K. Carroll, Stanislawa Weremowicz, Haiyan Chen, Daniel Carrasco, Andrea Richardson, Shelia Violette, Tatiana Nikolskaya, Yuri Nikolsky, Erica L. Bauerlein, William C. Hahn, Rebecca S. Gelman, Craig Allred, Mina J. Bissell, Stuart Schnitt, Kornelia Polyak. (Cancer Cell, In press) Xenograft assay data for NR-1 are from unpublished observation, by I. Haviv et al.
10 Supplementary Table 4. Primer sequences used in the paper Chromosome 22 microsatellite markers (MSMs) (Figure 4d) MSM Primer sequence 5'-3' Annealing C D22S1169 s GCACACACATGCACATAATC 49 as AACAACTTCCAGCAGACG D22S1174 s GAATCACTAGGGGCCTTCA 49 as TGAGGCTATGTGCCCAG MSMs (Figure 6) MSM Primer sequence 5'-3' Annealing C D3S1613 s TGTGATAAGGACCAAGGC 55 as GAGCAAATTGCAGAATGAG D3S3640 s GATCGCGTGACATTCC 55 as TGCTACTTGCTATTTATCAGACC D3S1744 s TTTAAGCGGAAGGAAGTGTG 55 as CTGGCCCCATCTCTCTCTAT D11S1999 s TACATGGCAGCAGGCATATA 55 as GAGTAAACAAGATTGCTAGATAGGC D11S2365 s TTCACATGCATATGTCTTTATGG 55 as CTGTCTAGTGTCCTGAGCTGC D11S2002 s CATGGCCCTTCTTTTCATAG 55 as AATGAGGTCTTACTTTGTTGCC qmsp primer (Supplementary Figure 2a) Gene Primer sequence 5'-3' Annealing C Cxorf12 s GTCGGCGTTGTCGCGC 61 as CGAAAACGTAAAAACTCGCCCG 57.1 RT-PCR primer (Supplementary Figure 2b) Gene Primer sequence 5'-3' Annealing C Cxorf12 s ACCTGCTGAAAACCGATGAC 55.5 as CTCAGGAAAGGGCAGTCTTG 55.6
CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
Clonal evolution of human cancers
Clonal evolution of human cancers -Pathology-based microdissection and genetic analysis precisely demonstrates molecular evolution of neoplastic clones- Hiroaki Fujii, MD Ageo Medical Laboratories, Yashio
Histological Type. Morphological and Molecular Typing of breast Cancer. Nottingham Tenovus Primary Breast Cancer Study. Survival (%) Ian Ellis
Morphological and Molecular Typing of breast Cancer Ian Ellis Molecular Medical Sciences, University of Nottingham Department of Histopathology, Nottingham University Hospitals NHS Trust Histological Type
CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN
AWARD NUMBER: W81XWH-14-1-0110 TITLE: A Molecular Framework for Understanding DCIS PRINCIPAL INVESTIGATOR: Gregory Hannon CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
Session 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20
Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ
Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5
Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,
The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,
Recent advances in breast cancers
Recent advances in breast cancers Breast cancer is a hetrogenous disease due to distinct genetic alterations. Similar morphological subtypes show variation in clinical behaviour especially in response
RNA preparation from extracted paraffin cores:
Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.
Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray
Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Hui Chen, Aysegul A Sahin, Xinyan Lu, Lei Huo, Rajesh R Singh, Ronald Abraham, Shumaila Virani, Bal Mukund Mishra, Russell Broaddus,
Supplementary Note. Nature Genetics: doi: /ng.2928
Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped
Molecular and genetic analysis of stromal fibroblasts in prostate cancer
Final report ESMO Translational Research Fellowship 2010-2011 Molecular and genetic analysis of stromal fibroblasts in prostate cancer Michalis Karamouzis Host Institute Department of Biological Chemistry,
Nature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
List of Available TMAs in the PRN
TMA RPCI_BrainCa01 RPCI_BrCa03 RPCI_BrCa04 RPCI_BrCa05 RPCI_BrCa0 RPCI_BrCa07 RPCI_BrCa08 RPCI_BrCa15 RPCI_BrCa1 RPCI_BrCa17 RPCI_BrCa18 RPCI_BrCa19 RPCI_BrCa20 RPCI_BrCa21 RPCI_BrCa24 RPCI_BrCa25 RPCI_BrCa2
Session 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
DNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing
Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Female Genital Tract Lab. Dr. Nisreen Abu Shahin Assistant Professor of Pathology University of Jordan
Female Genital Tract Lab Dr. Nisreen Abu Shahin Assistant Professor of Pathology University of Jordan Ovarian Pathology A 20-year-old female presented with vague left pelvic pain. Pelvic exam revealed
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN
AWARD NUMBER: W81XWH-14-1-0110 TITLE: A Molecular Framework for Understanding DCIS PRINCIPAL INVESTIGATOR: Gregory Hannon CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University
Basement membrane in lobule.
Bahram Memar, MD Basement membrane in lobule. Normal lobule-luteal phase Normal lobule-follicular phase Lactating breast Greater than 95% are adenocarcinomas in situ carcinomas and invasive carcinomas.
Cancer cells in vitro
Supplementary Figure S1 Cancer cells in vitro Pretreatment with Control IgG (18h) Pretreatment with anti-u-par (18h) Acid Wash/Pretreatment with Control IgG (18h) Acid Wash/Pretreatment with anti-u-par
My Personalized Breast Cancer Worksheet
My Personalized Breast Cancer Worksheet KNOW For Early-Stage Breast Cancer. No Questions. Only Results. No two tumors are alike. What are the characteristics of your breast cancer and how will that effect
The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN
AWARD NUMBER: W81XWH-14-1-0110 TITLE: A Molecular Framework for Understanding DCIS PRINCIPAL INVESTIGATOR: Gregory Hannon CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University
So how much of breast and ovarian cancer is hereditary? A). 5 to 10 percent. B). 20 to 30 percent. C). 50 percent. Or D). 65 to 70 percent.
Welcome. My name is Amanda Brandt. I am one of the Cancer Genetic Counselors at the University of Texas MD Anderson Cancer Center. Today, we are going to be discussing how to identify patients at high
Flat Epithelial Atypia
Flat Epithelial Atypia Richard Owings, M.D. University of Arkansas for Medical Sciences Department of Pathology Flat epithelial atypia can be a difficult lesion May be a subtle diagnosis Lots of changes
FISH mcgh Karyotyping ISH RT-PCR. Expression arrays RNA. Tissue microarrays Protein arrays MS. Protein IHC
Classification of Breast Cancer in the Molecular Era Susan J. Done University Health Network, Toronto Why classify? Prognosis Prediction of response to therapy Pathogenesis Invasive breast cancer can have
K. M. Sorensen Utah State University, Logan, Utah
K. M. Sorensen Utah State University, Logan, Utah T. E. Doyle, B. D. Borget, M. Cervantes, J. A. Chappell, B. J. Curtis, M. A. Grover, J. E. Roring, J. E. Stiles, and L. A. Thompson Utah Valley University,
Exploring TCGA Pan-Cancer Data at the UCSC Cancer Genomics Browser
Exploring TCGA Pan-Cancer Data at the UCSC Cancer Genomics Browser Melissa S. Cline 1*, Brian Craft 1, Teresa Swatloski 1, Mary Goldman 1, Singer Ma 1, David Haussler 1, Jingchun Zhu 1 1 Center for Biomolecular
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Research Article Stromal Expression of CD10 in Invasive Breast Carcinoma and Its Correlation with ER, PR, HER2-neu, and Ki67
SAGE-Hindawi Access to Research International Breast Cancer Volume 20, Article ID 47957, 4 pages doi:0.406/20/47957 Research Article Stromal Expression of CD0 in Invasive Breast Carcinoma and Its Correlation
Morphological and Molecular Typing of breast Cancer
Morphological and Molecular Typing of breast Cancer Ian Ellis Molecular Medical Sciences, University of Nottingham Department of Histopathology, Nottingham University Hospitals NHS Trust Histological
Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine
Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine The most common non-skin malignancy of women 2 nd most common cause of cancer deaths in women, following
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Using SNOMED CT subset for pathology data retrieval
Using subset for pathology data retrieval Mr Barry Fong, Mr Kent Tsui, Mr John Mok, Ms Vicky Fung Information Technology and Health Informatics Division, Head Office, Hospital Authority, HKSAR Introduction
Triple Negative Breast Cancer
Triple Negative Breast Cancer Prof. Dr. Pornchai O-charoenrat Division of Head-Neck & Breast Surgery Department of Surgery Faculty of Medicine Siriraj Hospital Breast Cancer Classification Traditional
The molecular genetics of endometrial cancer
The molecular genetics of endometrial cancer Lora Hedrick Ellenson, M.D. Department of Pathology and Laboratory Medicine Weill Medical College of Cornell University Introduction Classification of endometrial
Regulation of In Situ to Invasive Breast Carcinoma Transition
Article Regulation of In Situ to Invasive Breast Carcinoma Transition Min Hu, 1,4 Jun Yao, 1,4 Danielle K. Carroll, 4 Stanislawa Weremowicz, 3,4 Haiyan Chen, 2,5 Daniel Carrasco, 1 Andrea Richardson, 3,4
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide
Supplemental Information. Integrated Genomic Analysis of the Ubiquitin. Pathway across Cancer Types
Cell Reports, Volume 23 Supplemental Information Integrated Genomic Analysis of the Ubiquitin Pathway across Zhongqi Ge, Jake S. Leighton, Yumeng Wang, Xinxin Peng, Zhongyuan Chen, Hu Chen, Yutong Sun,
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
04/10/2018 HIGH RISK BREAST LESIONS. Pathology Perspectives of High Risk Breast Lesions ELEVATED RISK OF BREAST CANCER HISTORICAL PERSPECTIVES
Pathology Perspectives of High Risk Breast Lesions Savitri Krishnamurthy MD Professor of Pathology Deputy Division Head Director of Clinical Trials, Research and Development The University of Texas MD
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
7th Annual Symposium on Gastrointestinal Cancers " St. Louis, Mo, 9/20/08
Molecular markers to aid in early diagnosis of pancreatic cancer Michael Goggins, MD Professor of Pathology, Medicine and Oncology Johns Hopkins Medical Institutions, Baltimore, MD 7th Annual Symposium
Evaluation of BRCA1/2 and homologous recombination defects in ovarian cancer and impact on clinical outcomes
Evaluation of BRCA1/2 and homologous recombination defects in ovarian cancer and impact on clinical outcomes Melinda S. Yates, PhD Department of Gynecologic Oncology & Reproductive Medicine University
Diagnosis and Treatment of Patients with Primary and Metastatic Breast Cancer. Pathology. AGO e. V. in der DGGG e.v. sowie in der DKG e.v.
Diagnosis and Treatment of Patients with Primary and Metastatic Breast Cancer Pathology Pathology Versions 2004 2017: Blohmer / Costa / Fehm / Friedrichs / Huober / Kreipe / Lück / Schneeweis / Sinn /
Invited Re vie W. Molecular genetics of ovarian carcinomas. Histology and Histo pathology
Histol Histopathol (1 999) 14: 269-277 http://www.ehu.es/histol-histopathol Histology and Histo pathology Invited Re vie W Molecular genetics of ovarian carcinomas J. Diebold Pathological Institute, Ludwig-Maximilians-University
Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection
Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection Anne Piantadosi 1,2[, Bhavna Chohan 1,2[, Vrasha Chohan 3, R. Scott McClelland 3,4,5, Julie Overbaugh 1,2* 1 Division of Human
10/15/2012. Biologic Subtypes of TNBC. Topics. Topics. Histopathology Molecular pathology Clinical relevance
Biologic Subtypes of TNBC Andrea L. Richardson M.D. Ph.D. Brigham and Women s Hospital Dana-Farber Cancer Institute Harvard Medical School Boston, MA Topics Histopathology Molecular pathology Clinical
Serrated Polyps and a Classification of Colorectal Cancer
Serrated Polyps and a Classification of Colorectal Cancer Ian Chandler June 2011 Structure Serrated polyps and cancer Molecular biology The Jass classification The familiar but oversimplified Vogelsteingram
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin
Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification
Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue
Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to
Breast Cancer. Dr. Andres Wiernik 2017
Breast Cancer Dr. Andres Wiernik 2017 Agenda: The Facts! (Epidemiology/Risk Factors) Biological Classification/Phenotypes of Breast Cancer Treatment approach Local Systemic Agenda: The Facts! (Epidemiology/Risk
Breast Cancer. Most common cancer among women in the US. 2nd leading cause of death in women. Mortality rates though have declined
Breast Cancer Most common cancer among women in the US 2nd leading cause of death in women Mortality rates though have declined 1 in 8 women will develop breast cancer Breast Cancer Breast cancer increases
Enterprise Interest None
Enterprise Interest None What are triple negative breast cancers? A synopsis of their histological patterns Ian Ellis Molecular Medical Sciences, University of Nottingham Department of Histopathology,
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Molecular Subtyping of Endometrial Cancer: A ProMisE ing Change
Molecular Subtyping of Endometrial Cancer: A ProMisE ing Change Charles Matthew Quick, M.D. Associate Professor of Pathology Director of Gynecologic Pathology University of Arkansas for Medical Sciences
AP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
Breast Cancer. Saima Saeed MD
Breast Cancer Saima Saeed MD Breast Cancer Most common cancer among women in the US 2nd leading cause of death in women 1 in 8 women will develop breast cancer Incidence/mortality rates have declined Breast
202002, India Author affiliations
Copy number variation and microdeletions of the Y chromosome linked genes and loci across different categories of Indian infertile males Anju Kumari 1, Sandeep Kumar Yadav 1, M.M. Misro 2, Jamal Ahmad
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Your Guide to the Breast Cancer Pathology. Report. Key Questions. Here are important questions to be sure you understand, with your doctor s help:
Your Guide to the Breast Cancer Pathology Report Key Questions Here are important questions to be sure you understand, with your doctor s help: Your Guide to the Breast Cancer Pathology Report 1. Is this
SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
Disclosures 5/27/2012. Outline of Talk. Outline of Talk. When Is LCIS Clinically Significant? Classic LCIS. Classic LCIS
When Is LCIS Clinically Significant? Disclosures I have nothing to disclose Yunn-Yi Chen, MD, PhD Professor Outline of Talk Outline of Talk Classic LCIS Classic LCIS Definition of lobular differentiation
Introduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
Carcinome du sein Biologie moléculaire. Thomas McKee Service de Pathologie Clinique Genève
Carcinome du sein Biologie moléculaire Thomas McKee Service de Pathologie Clinique Genève Pathology Diagnostic Prognostic information Predictive information The information provided depends on the available
Ovarian cancer: 2012 Update Srini Prasad MD Univ Texas MD Anderson Cancer Center
Ovarian cancer: 2012 Update Srini Prasad MD Univ Texas MD Anderson Cancer Center Ovarian cancer is not a single disease Ovarian Epithelial Tumors: Histological Spectrum* Type Frequency Histology High-Grade
Pancreatic intraepithelial
Pancreatic intraepithelial neoplasia (PanIN) Markéta Hermanová St. Anne s University Hospital Brno Faculty of Medicine, Masaryk University Precursor lesions of invasive pancreatic cancer Pancreatic intraepithelial
Supplementary Data for:
Supplementary Data for: Tumour sampling method can significantly influence gene expression profiles derived from neoadjuvant window studies Dominic A. Pearce 1, Laura M. Arthur 1, Arran K. Turnbull 1,
04/10/2018. Intraductal Papillary Neoplasms Of Breast INTRADUCTAL PAPILLOMA
Intraductal Papillary Neoplasms Of Breast Savitri Krishnamurthy MD Professor of Pathology Deputy Division Head The University of Texas MD Anderson Cancer Center 25 th Annual Seminar in Pathology Pittsburgh,
Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in
Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya
Nature Genetics: doi: /ng Supplementary Figure 1. Mutational signatures in BCC compared to melanoma.
Supplementary Figure 1 Mutational signatures in BCC compared to melanoma. (a) The effect of transcription-coupled repair as a function of gene expression in BCC. Tumor type specific gene expression levels
Breast pathology. 2nd Department of Pathology Semmelweis University
Breast pathology 2nd Department of Pathology Semmelweis University Breast pathology - Summary - Benign lesions - Acute mastitis - Plasma cell mastitis / duct ectasia - Fat necrosis - Fibrocystic change/
Diseases of the breast (2 of 2) Breast cancer
Diseases of the breast (2 of 2) Breast cancer Epidemiology & etiology The most common type of cancer & the 2 nd most common cause of cancer death in women 1 of 8 women in USA Affects 7% of women Peak at
Phenotypic Diversity in the Evolution of Breast Cancer Metastasis
Phenotypic Diversity in the Evolution of Breast Cancer Metastasis Peter Simpson, PhD. The University of Queensland, Brisbane, Australia UQ Centre for Clinical Research Molecular Breast Pathology Cancer
Plasma-Seq conducted with blood from male individuals without cancer.
Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer
SEROUS TUMORS. Dr. Jaime Prat. Hospital de la Santa Creu i Sant Pau. Universitat Autònoma de Barcelona
SEROUS TUMORS Dr. Jaime Prat Hospital de la Santa Creu i Sant Pau Universitat Autònoma de Barcelona Serous Borderline Tumors (SBTs) Somatic genetics Clonality studies have attempted to dilucidate whether
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Update on BRCA testing thresholds NICE guidance changes
Update on BRCA testing thresholds NICE guidance changes D Gareth R Evans Christie and St Mary s Hospital Manchester UK London July 2014 Guideline Development Group Familial Breast Cancer Any woman with
The Cancer Genome Atlas & International Cancer Genome Consortium
The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
OPTO-ACOUSTIC BREAST IMAGING
OPTO-ACOUSTIC BREAST IMAGING A Novel Fusion of Functional and Morphologic Imaging Reni S. Butler, MD A. Thomas Stavros, MD F. Lee Tucker, MD Michael J. Ulissey, MD PURPOSE 1. Explain opto-acoustic (OA)
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplementary information to:
Supplementary information to: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin Embedded Tumors by Next Generation Sequencing Authors
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured