Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and
|
|
- Hillary Gibbs
- 6 years ago
- Views:
Transcription
1 Supplementary Materials Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS Daryl A. Bosco, Gerardo Morfini, Murat Karabacak, Yuyu Song, Francois Gros-Louis, Piera Pasinelli, Holly Goolsby, Benjamin A. Fontaine, Nathan Lemay, Diane McKenna-Yasek, Matthew P. Frosch, Jeffery Agar, Jean-Pierre Julien, Scott Brady, and Robert H. Brown, Jr.
2 Supplementary Figure 1. The hydrogen peroxide-treated AS-SOD1 mutant is not recognized by the C4F6 antibody. The AS-SOD1 mutant, which contains both the C6A and C111S point-mutations, was exposed to hydrogen peroxide (H 2 O 2 ) as described for WT-SOD1 (Methods). (a) In contrast to WT- SOD1 (Fig. 1), there is no evidence of AS-SOD1 oxidation as a result of H 2 O 2 treatment in the mass spectra. The predominate species in the respective mass spectrum for untreated AS-SOD1 and AS-SOD1 exposed to H 2 O 2 (AS-SOD1ox) have similar masses (15,752.5 and 15,753.5 m/z). (b) The indicated recombinant human SOD1 proteins (10 µg/lane) were subjected to a native Western analysis as described in Figure 3. SOD1ox (formed by oxidation of WT- SOD1) and G93A are detected by the C4F6 monoclonal antibody (+C4F6), in agreement with Figure 3, whereas neither AS-SOD1 nor AS-SOD1ox are detected by C4F6 using Western-developing techniques with short (5 seconds) and relatively long (8.5 seconds) exposures. The low molecular weight band in the SOD1 G93A lane is likely a degradation product, which was also detected in the denaturing Western analysis in (d). In the absence of C4F6 antibody (- C4F6), there is no signal detected in the identical duplicate blots, thus demonstrating the lack of non-specific artifacts of the Western blotting techniques employed herein. (c) The native Western analysis described in (b) was performed with a rabbit anti-sod1 polyclonal antibody (Biodesign; 1:500), and demonstrates that the indicated proteins (3.75 µg/lane) are present in similar quantities. (d) The samples analyzed in b-c were diluted identically in SDSloading buffer and subjected to a denaturing Western analysis with a sheep anti- SOD1 polyclonal antibody (Calbiochem; 1:1,000), thus further demonstrating that the indicated proteins (10 ng/lane) are present in similar quantities.
3 Supplementary Figure 2. Extraction of insoluble SOD1 from mouse and human spinal cord tissue lysates. SOD1 G93A transgenic mice, which reportedly form SOD1 G93A aggregates, naïve mice, and human spinal cord (SpC) tissue samples were homogenized in detergent-free lysis buffer. The resulting insoluble-pellet was extensively washed and then extracted with SDS (see Methods). (a) An SDS-Western analysis for the final wash ( W ) of the insoluble pellet before extraction, and the extracted pellet ( Pel ) for SOD1 G93A transgenic (n=3; age=98 days) and naïve (n=3; age=110 days) mice. SOD1 is not detected in the wash samples, demonstrating that the SOD1 detected in the
4 extracted samples is due to the extraction process and not from insufficient washing. SOD1 G93A is extracted from the SpC tissue of the corresponding mouse model, whereas insoluble SOD is not detected from the extracted pellets derived from the naïve mice, indicating that this extraction procedure is capable of extracting insoluble SOD1 from animal tissues. (b) The same extraction protocol described in (a) was applied to insoluble pellets derived from frozen, end-stage human tissues from the indicated control and ALS cases. All cases contain some insoluble SOD1. Because the end-stage human tissues were frozen prior to the homogenation, and the resulting lysate pellets were frozen prior to the extraction, we cannot exclude that some level of insoluble protein may have resulted from the multiple freeze-thaw cycles. In contrast, the mouse tissue was isolated and immediately homogenized (Methods). (c) An independent experiment that is the same as (b) for the indicated cases. Note that the SALS1 and SALS4 cases are represented in both (a) and (b). (d) Densitometry of the insoluble SOD1 band is shown for the extractions performed in panels (b; solid bars) and (c; hatched bars). The results for SALS1 and SALS4 illustrate that the extraction protocol is reproducible between independent experiments. Although SALS1 and FALS2 cases contain the highest levels of insoluble SOD1, there is not a significant difference in the levels of insoluble SOD1 for the ALS versus control cases (n=4 cases for controls (C3,4,5,6) and SALS(SALS1,2,3,4); P=0.5 by the T-test, two-tailed).
5 Supplementary Figure 3. Immunohistochemistry of human spinal cord tissues with a commercial, polyclonal anti-sod1 antibody. Human paraffin spinal cord tissues (see Supplementary tables 2 and 3 for clinical and demographic information) from Figure 6 were stained with a commercial polyclonal antibody (Calbiochem; Methods). Dark arrows denote SOD1-positive cells.
6 Supplementary Table 1: Mass spectrometry analysis of SOD1 fragments resulting from electron capture dissociation (EDC) SOD1 amino acid sequence Modification status SOD1 residue at EDC cleaveage site Theoretical +1 mass of the peptide (z+1 ion) (monoisotopic) 1 Theoretical +1 mass +48Da (z+1 ion) (monoisotopic) 2 Observed mass (monoisotopic) Deviation of observedtheoretical ox N ox T ox A ox D ox D ox G ox A ox D ox S ox S * +3 ox C * none L none V none V none E none K The theoretical mass of the indicated SOD1 peptide fragment, assuming there is no oxidation of the SOD1 amino acid side chains. 2 The theoretical mass of the indicated SOD1 peptide fragment, taking into account a potential 48Da increase in mass, which is observed in the FT-MS spectrum of SOD1ox (Fig. 1b). 1,2 Those masses in bold italics correspond to the actual observed mass detected in the experiment, within 1-2 Da. *The overlapping sequence in these peptides is 111-CIIGRTL-117, in which only C111 can undergo oxidation of +48 Da, thus forming sulfonic acid.
7 Supplementary Table 2: Clinical information pertaining to ALS patient tissues used in this study. Case number Sex Diagnosis Age at onset (years) Age at death (years) Duration of disease (months) Site of onset 1 Tissue source (analysis) 3 SALS1 M SALS LE Paraffin (IHC); frozen (pellet extraction, motility assay) SALS2 M SALS LE Paraffin (IHC); frozen (pellet extraction, motility assay) SALS3 M SALS LE Paraffin (IHC); frozen (pellet extraction) SALS4 F SALS NA 2 65 NA NA Paraffin (IHC); frozen (pellet extraction, motility assay) SALS5 F SALS UE Paraffin (IHC) SALS6 M SALS UE Paraffin (IHC) SALS7 M SALS UE Paraffin (IHC) SALS8 F SALS LE Paraffin (IHC) SALS9 M SALS UE Paraffin (IHC) FALS1 F FALS/ (SOD1 negative) FALS2 M FALS/ (SOD A4V) NA 54 NA NA Paraffin (IHC) B & LE frozen (pellet extraction) 1 LE=lower extremity; UE=upper extremity; B=bulbar. 2 NA=information not available. 3 The indicated cases were used for immunohistochemistry analysis (IHC; Figure 6), extraction of insoluble SOD1 from tissue pellets (Supplementary Figure 2), and/or the squid motility assay (Figure 7).
8 Supplementary Table 3: Clinical information for control tissues used in this study. Case number Sex Age at death (years) Cause of death Control 1 F 60 End-stage renal disease; systemic lupus erythematosus (SLE) Tissue source (analysis) 3 Paraffin (IHC) Control 2 M 52 Hepatocellular carcinoma Paraffin (IHC) Control 3 M 93 NA 1 frozen (pellet extraction) Control 4 M 34 NA frozen (pellet extraction) Control 5 F 76 NA frozen (pellet extraction) Control 6 M 65 NA frozen (pellet extraction, motility assay) Control 7 M 24 NA Paraffin (IHC) Control 8 NA 42 Spinal cord tumor, Paraffin (IHC) pulmonary illness Control 9 NA 63 Heart illness Paraffin (IHC) Control 10 M 75 Gastrointestinal tumor Paraffin (IHC) Control 11 M 56 Heart illness Paraffin (IHC) Control 12 M 66 Heart illness Paraffin (IHC) Control 13 F 86 Pulmonary infection Paraffin (IHC) Control 14 M 68 Pulmonary infection, Paraffin (IHC) cancer, heart illness Control 15 F 64 Post-transplant Paraffin (IHC) lymphoproliferative disorder Control 16 F 44 Chronic obstructive Paraffin (IHC) pulmonary isease Control 17 M 9 months Krabbe s disease Paraffin (IHC) Control 18 F 50 Pneumonia Paraffin (IHC) Control 19 NA 49 Pneumonia Paraffin (IHC) Control 20 NA 56 Sarcoma of unknown Paraffin (IHC) origin Control 21 NA NA NA Paraffin (IHC) 1 NA=information not available. 2 The indicated cases were used for immunohistochemistry analysis (IHC; Figure 6), extraction of insoluble SOD1 from tissue pellets (Supplementary Figure 2), and/or the squid motility assay (Figure 7).
B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.
Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1
More informationStructural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB
Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10353 Supplementary Figure 1. Mutations of UBQLN2 in patients with ALS and ALS/dementia. (a) A mutation, c.1489c>t (p.p497s), was identified in F#9975. The pedigree is shown on the left
More informationSupporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells
Supporting Information Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells David Salom,, Benlian Wang,, Zhiqian Dong, Wenyu Sun, Pius Padayatti, Steven
More informationWDR62 is associated with the spindle pole and mutated in human microcephaly
WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad
More informationSupplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationProduct Datasheet. Endothelin-1 Antibody (TR.ET.48.5) NB Unit Size: 100 ul. Store at -20C. Avoid freeze-thaw cycles.
Product Datasheet Endothelin-1 Antibody (TR.ET.48.5) NB300-526 Unit Size: 100 ul Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 2 Protocols, Publications, Related Products, Reviews,
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
More informationElectronic Supplementary Information (ESI) for the article entitled:
Electronic Supplementary Information (ESI) for the article entitled: ICP-S-assisted nanohplc-electrospray /time-of-flight S/S selenopeptide mapping in Brazil nuts by ihaly Dernovics, Pierre Giusti and
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationAnti-Lamin B1/LMNB1 Picoband Antibody
Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationAmyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease in which
ABSTRACT Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease in which progressive motor neuron degeneration causes paralysis and, ultimately, death. A subset of ALS cases are caused
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationProduct Datasheet. CD133 Antibody NB Unit Size: 0.1 mg
Product Datasheet CD133 Antibody NB120-16518 Unit Size: 0.1 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 8 Protocols, Publications, Related Products,
More informationTivadar Orban, Beata Jastrzebska, Sayan Gupta, Benlian Wang, Masaru Miyagi, Mark R. Chance, and Krzysztof Palczewski
Structure, Volume Supplemental Information Conformational Dynamics of Activation for the Pentameric Complex of Dimeric G Protein-Coupled Receptor and Heterotrimeric G Protein Tivadar Orban, Beata Jastrzebska,
More informationSupplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
More informationAtg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
More informationSupplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationTECHNICAL BULLETIN. R 2 GlcNAcβ1 4GlcNAcβ1 Asn
GlycoProfile II Enzymatic In-Solution N-Deglycosylation Kit Product Code PP0201 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description Glycosylation is one of the most common posttranslational
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically
Supplementary Figures Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically synthesized polyubiquitin chains of different length. a, Differential scanning calorimetry traces
More informationSupplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
More informationSolution oxygen-17 NMR application for observing a peroxidized cysteine residue in oxidized human SOD1
Hyperfine Interact (2016) 237:114 DOI 10.1007/s10751-016-1320-7 Solution oxygen-17 NMR application for observing a peroxidized cysteine residue in oxidized human SOD1 Noriko Fujiwara 1 Daisaku Yoshihara
More informationHuman Apolipoprotein A1 EIA Kit
A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationSupporting Information
Supporting Information Chen et al. 10.1073/pnas.0807991106 SI Methods Sucrose Gradient Fractionation. Fractionation by sucrose gradient was performed as described by Gasparini et al. [(2001) J Neurosci
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Design of isolated protein and RNC constructs, and homogeneity of purified RNCs. (a) Schematic depicting the design and nomenclature used for all the isolated proteins and RNCs used
More informationProcaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
More informationPearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
More informationAn immunological epitope selective for pathological monomer/misfolded SOD1 in
Rakhit et al, 2007 An immunological epitope selective for pathological monomer/misfolded SOD1 in ALS Rishi Rakhit 1, Janice Robertson 2, Christine Vande Velde 3, Patrick Horne 2, Deborah M. Ruth 2, Jennifer
More informationImprove Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant
Improve Protein Analysis with the New, Mass Spectrometry- Compatible Surfactant ABSTRACT Incomplete solubilization and digestion and poor peptide recovery are frequent limitations in protein sample preparation
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationAccurate determination of protein methionine oxidation by stable isotope labeling and LC-MS analysis
Accurate determination of protein methionine oxidation by stable isotope labeling and LC-MS analysis Hongcheng Liu*, Gomathinayagam Ponniah, Alyssa Neil, Rekha Patel, Bruce Andrien Protein Characterization,
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationSupporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for
Supporting Information Lysine Propionylation to Boost Proteome Sequence Coverage and Enable a Silent SILAC Strategy for Relative Protein Quantification Christoph U. Schräder 1, Shaun Moore 1,2, Aaron A.
More informationIntegrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1
Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More informationHuman SH-SY5Y neuroblastoma cells (A.T.C.C., Manassas, VA) were cultured in DMEM, F-12
SUPPLEMENTARY METHODS Cell cultures Human SH-SY5Y neuroblastoma cells (A.T.C.C., Manassas, VA) were cultured in DMEM, F-12 Ham with 25 mm HEPES and NaHCO 3 (1:1) and supplemented with 10% (v/v) FBS, 1.0
More informationSUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
More informationProduct Datasheet. IGF-I R Antibody (3G5C1) NB Unit Size: 0.1 ml
Product Datasheet IGF-I R Antibody (3G5C1) NB110-87052 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 2 Publications: 8 Protocols, Publications,
More informationInfluenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set
Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay
More informationRat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN
YK050 Rat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418-0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationInnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024
User Protocol CBA024 Rev. 23 May 2005 RFH Page 1 of 6 InnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024 Table of Contents Page Storage 1 Intended Use 1 Background 1 Principle of the Assay 2 Materials
More informationLack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationProduct Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5
Product Datasheet DARC Antibody NB100-2421 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb100-2421
More informationA. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype
Supplementary Table 1. Location of lens opacification in Aldh1a1(-/-), Aldh3a1(-/-) single and Aldh1a1(-/-)/Aldh3a1(-/-) double knockout mice (DKO) at different ages. A. One to three months of age Genotype
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationProduct Datasheet. SERCA2 ATPase Antibody (IID8) NB Unit Size: 100uL. Store at -20C. Avoid freeze-thaw cycles.
Product Datasheet SERCA2 ATPase Antibody (IID8) NB300-529 Unit Size: 100uL Store at -20C. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products, Reviews, Research Tools and
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More information293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationProduct Datasheet. DC-LAMP Antibody (104G4) DDX0190P-100. Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles.
Product Datasheet DC-LAMP Antibody (104G4) DDX0190P-100 Unit Size: 0.1 mg Store at -20C. Avoid freeze-thaw cycles. Publications: 18 Protocols, Publications, Related Products, Reviews, Research Tools and
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationProduct Datasheet. HLA ABC Antibody (W6/32) NB Unit Size: 0.25 mg. Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 22
Product Datasheet HLA ABC Antibody (W6/32) NB100-64775 Unit Size: 0.25 mg Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 22 Protocols, Publications, Related Products, Reviews, Research
More informationThe Mycobacterium tuberculosis MmpL11 cell wall lipid transporter is important for
Supplemental materials The Mycobacterium tuberculosis MmpL11 cell wall lipid transporter is important for biofilm formation, intracellular growth and non-replicating persistence Catherine C. Wright, 1
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
More informationProtein Identification and Phosphorylation Site Determination by de novo sequencing using PepFrag TM MALDI-Sequencing kit
Application Note Tel: +82-54-223-2463 Fax : +82-54-223-2460 http://www.genomine.com venture ldg 306 Pohang techno park Pohang, kyungbuk, Korea(ROK) Protein Identification and Phosphorylation Site Determination
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationab Human Citrate Synthase (CS) Activity Assay Kit
ab119692 Human Citrate Synthase (CS) Activity Assay Kit Instructions for Use For the measurement of mitochondrial citrate synthase (CS) activity in Human samples This product is for research use only and
More informationReviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author):
Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author): This study shows that the inducible camp early repressor (ICER) is involved in development of Th17 cells that are pathogenic
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationRayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit
RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit Catalog #: PEL-NFKBP65-S536-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information
More informationProduct Datasheet. Caspase-8 Antibody - (active/cleaved) NB Unit Size: 0.05 ml. Store at -20C. Avoid freeze-thaw cycles.
Product Datasheet Caspase-8 Antibody - (active/cleaved) NB100-56116 Unit Size: 0.05 ml Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 38 Protocols, Publications, Related Products, Reviews,
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationRat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN
YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes
More informationSoluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationAggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
More informationsupplementary information
DOI: 1.138/ncb1 Control Atg7 / NAC 1 1 1 1 (mm) Control Atg7 / NAC 1 1 1 1 (mm) Lamin B Gstm1 Figure S1 Neither the translocation of into the nucleus nor the induction of antioxidant proteins in autophagydeficient
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationI. Introduction. II. Characteristics
YK050 Rat Leptin ELISA I. Introduction Leptin, which is a product of ob gene, is a protein consisting of 167 amino acids and it is secreted from white adipose tissue. It is known that leptin acts on hypothalamus
More informationSupplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular weight markers (M). Supplementary Figure-2. Overlay of
More informationDissecting the role of H3K64me3 in mouse pericentromeric heterochromatin.
Supplementary Information Dissecting the role of H3K64me3 in mouse pericentromeric heterochromatin. Ulrike C. Lange 1, Stéphanie Siebert 2, Mark Wossidlo 3,4, Thomas Weiss 1, Céline Ziegler- Birling 2,
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationPractical application of analytical tools for characterization of an impurity-related particle formation mechanism
Practical application of analytical tools for characterization of an impurity-related particle formation mechanism Jared S. Bee, Ph.D. Protein aggregation measurement in biotherapeutics Maryland Center
More informationDouble charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146
Abstract The 2008 ABRF Proteomics Research Group Study offers participants the chance to participate in an anonymous study to identify qualitative differences between two protein preparations. We used
More informationFor the rapid, sensitive and accurate quantification of Ras in various samples
ab128504 Ras Assay Kit Instructions for Use For the rapid, sensitive and accurate quantification of Ras in various samples This product is for research use only and is not intended for diagnostic use.
More informationMagCapture Exosome Isolation Kit PS Q&A
MagCapture Exosome Isolation Kit PS Q&A Specifications and performance P.1 Comparison of the conventional method P.2 Operation methods and composition P.4 Amount of starting sample P.5 Analysis after exosomes
More information