Normal Skin. Tissue Samples and Melanoma Cell Lines. BRAF Mut. RAS Mut RAS WT /BRAF WT
|
|
|
- Irene Potter
- 6 years ago
- Views:
Transcription
1 Supplemental Figure 1. MERTK gene expression in melanoma cell line panel from Cancer Cell Line Encyclopedia. A. Microarray analysis of melanoma cell lines from UNC collection grouped by oncogenic mutation. (ns=not significant) B. Microarray analysis of normal human skin and melanoma cell lines from CCLE collection for MERTK transcript levels. Melanoma cell lines were grouped by oncogenic mutation status. Dotted line represents average MERTK expression in normal skin. C. CCLE collection was analyzed for MERTK expression with respect to oncogenic mutations in RAS and BRAF. A Relative MERTK Gene Expression RAS WT /BRAF WT ns ns RAS Mut BRAF Mut B Relative MERTK Gene Expression (log 2, RMA normalized) Normal Skin RAS WT /BRAF WT RAS Mut BRAF Mut C Relative MERTK Gene Expression (log 2, RMA normalized) RAS WT /BRAF WT ns ns RAS Mut BRAF Mut 0 Tissue Samples and Melanoma Cell Lines
2 Supplemental Figure 2. MERTK is heavily glycosylated at Asn residues. Western blot of melanoma cell lysates treated with control buffer or PNGase F. Actin was detected as a loading control. 250kD- 150kD- 100kD- 50kD- 37kD- HMCB SKMEL119 G361 SKMEL MERTK Actin
3 Supplemental Figure 3. GAS6 activation of SKMEL119 and SKMEL5. Western blot of phospho- and total STAT6, AKT and ERK. Cell cultures were stimulated with GAS6 and whole cell lysates were evaluated by western blot analysis. Actin was probed as a loading control. GAS6: SKMEL119 SKMEL p-stat6 STAT6 p-akt AKT p-erk ERK Actin
4 Supplemental Figure 4. SKMEL119 MERTK knockdown cell lines and migration. A. MERTK protein expression in SKMEL119 cell lines stably expressing shrna against MERTK. Whole cell lysates from indicated cell lines were analyzed via western blot for MERTK protein expression. Actin was detected as a loading control. B. Migration of SKMEL119. Live-cell imaging of shcontrol and shmertk4 cells plated on a fibronectin surface was performed for 16 hours and migration distance per unit time was determined. Mean values and standard errors were determined for 22 cells (*p<0.05, Student s two-tailed t-test). A SKMEL119 B SKMEL119 Migration shcontrol shmer4 MERTK Actin Velocity (microns/sec) * 0 shcontrol shmertk4
5 Supplementary Information Supplemental Table 1. MERTK mrna expression in patient tissues. Tissue Category Sample Description Normal Skin GSM Normal Skin GSM Normal Skin GSM Normal Skin GSM Normal Skin GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Primary Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Relative MERTK Gene Expression (log 2, RMA Normalized)
6 Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM Metastatic Melanoma GSM
7 Supplemental Table 2. MERTK mrna expression in melanoma cell lines from the UNC collection. Mutation Status Sample Description Relative MERTK Gene Expression NHM NHM 13 PMA NHM NHM 17 PMA NHM NHM 11 PMA WT HMCB WT WM WT MALME WT SKMEL 88/ SKMEL WT SKMEL WT PMWK WT MEL WT MEL WT SKMEL WT WM 1361a WT SBC RAS SKMEL RAS VMM RAS SKMEL RAS SKMEL RAS SKMEL RAS SKMEL RAS SKMEL BRAF SKMEL BRAF UACC BRAF SKMEL BRAF SKMEL BRAF A BRAF SKMEL BRAF SKMEL BRAF WM BRAF SKMEL BRAF SKMEL BRAF WM BRAF SKMEL BRAF WM BRAF A BRAF RPMI BRAF SKMEL BRAF SKMEL BRAF SKMEL 130/ SKMEL
8 Supplemental Table 3. MERTK gene expression in normal skin and melanoma cell lines from CCLE database. Tissue Category/ Sample Mutation Status Description Normal Skin GSM Normal Skin GSM Normal Skin GSM Normal Skin GSM Normal Skin GSM WT HMCB/CHL WT COLO WT MEWO WT HS895T WT HS839T WT HS600T WT HS940T WT HS834T WT HS688AT WT IPC WT HS934T RAS SKMEL RAS HS944T RAS HS936T RAS CJM RAS SKMEL RAS MELJUSO RAS HS852T BRAF SKMEL BRAF G BRAF K029AX BRAF MALME3M BRAF SKMEL BRAF UACC BRAF SH BRAF COLO829/ COLO849 BRAF SKMEL BRAF IGR BRAF WM BRAF SKMEL BRAF COLO BRAF COLO BRAF A101D BRAF UACC BRAF MELHO BRAF COLO818/ Relative MERTK Gene Expression (log 2, RMA Normalized)
9 COLO800 BRAF HT BRAF C BRAF A BRAF RPMI BRAF LOXIMVI BRAF WM BRAF MDAMB435S BRAF WM BRAF WM BRAF WM BRAF WM983B BRAF COLO BRAF A BRAF SKMEL BRAF HS695T BRAF IGR Supplemental Table 4. Antibodies utilized for western blot. Antibody Company Product Number MERTK Epitomics/UNC / N14 Actin Santa Cruz SC-1616 TYRO3 Cell Signaling 5585 AXL R&D Systems AF154 GAPDH Cell Signaling 2118 p-stat6 Cell Signaling 9364 STAT6 Cell Signaling 9362 p-akt Cell Signaling 9271 AKT Cell Signaling 9272 p-erk Cell Signaling 9106 ERK Cell Signaling 9102 PARP Cell Signaling 9542
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
MERTK receptor tyrosine kinase is a therapeutic target in melanoma
Research article MERTK receptor tyrosine kinase is a therapeutic target in melanoma Jennifer Schlegel, 1 Maria J. Sambade, 2 Susan Sather, 1 Stergios J. Moschos, 2,3 Aik-Choon Tan, 4 Amanda Winges, 1 Deborah
Melanoma-specific MHC-II expression represents a tumour-autonomous phenotype and predicts response to anti-pd-1/pd-l1 therapy
Received 8 Oct 215 Accepted 31 Dec 215 Published 29 Jan 216 DOI: 1.138/ncomms1582 OPEN Melanoma-specific MHC-II expression represents a tumour-autonomous phenotype and predicts response to anti-pd-1/pd-l1
Systematic approaches to. overcoming limitations of MAPK pathway inhibition in melanoma.
Systematic approaches to overcoming limitations of MAPK pathway inhibition in melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
SUPPLEMENTARY INFORMATION
sirna pool: Control Tetherin -HA-GFP HA-Tetherin -Tubulin Supplementary Figure S1. Knockdown of HA-tagged tetherin expression by tetherin specific sirnas. HeLa cells were cotransfected with plasmids expressing
Relative Rates. SUM159 CB- 839-Resistant *** n.s Intracellular % Labeled by U- 13 C-Asn 0.
A Relative Growth Rates 1.2 1.8.6.4.2 B Relative Rates 1.6 1.4 1.2 1.8.6.4.2 LPS2 Parental LPS2 Q-Independent SUM159 Parental SUM159 CB-839-Resistant LPS2 Parental LPS2 Q- Independent SUM159 Parental SUM159
Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors
Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,
Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative
condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
CAN Resubmission SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION CAN-5-686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
Pushing the boundaries-targeted therapies
Pushing the boundaries-targeted therapies Professor Grant McArthur MB BS PhD Director Melanoma and Skin Cancer VCCC Parkville, Peter MacCallum Cancer Centre Lorenzo Galli Chair of Melanoma & Skin Cancers,
Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer
S1 of S6 Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer Shang-Gin Wu, Tzu-Hua Chang, Meng-Feng Tsai, Yi-Nan Liu, Chia-Lang
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
P-Rex1 is required for efficient melanoblast migration and. melanoma metastasis
P-Rex1 is required for efficient melanoblast migration and melanoma metastasis Colin R. Lindsay 1*, Samuel Lawn 1*, Andrew D. Campbell 1*, William J. Faller 1, Florian Rambow 2, Richard L. Mort 3, Paul
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Nature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
Supplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
F-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
Supplementary Figure 1
CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by
Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells
Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental
SUPPLEMENTARY INFORMATION
doi:10.1038/nature23291 Supplementary discussion part 1 Our model suggests that, in tumours that express Class 3 BRAF mutants and activated RAS, both BRAF MUT /RAF WT heterodimers and WT RAF dimers are
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Supplemental figures
Supplemental figures Supplemental Figure 1. Impact of immunogenic-llc tumors (LLC-OVA) on peripheral OVA-specific CD8 T cells. Tetramer analysis showing percent OVA-specific CD8 T cells in peripheral blood
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
Supplementary Figure 1
Supplementary Figure 1 60 HRAS G12V 40 * 55 35 Percent BRDU Positive 50 45 40 30 20 NS Percent BRDU Positive 30 25 20 15 10 NS 10 5 0 -dox dox doxkt5720 -doxkt5720 Treatment TSHKT5720 0 -dox dox doxkt5720
MERTK: A NOVEL TARGET IN NON-SMALL CELL LUNG CANCER CHRISTOPHER T. CUMMINGS. B.S., University of Nebraska, Lincoln, 2009
MERTK: A NOVEL TARGET IN NON-SMALL CELL LUNG CANCER by CHRISTOPHER T. CUMMINGS B.S., University of Nebraska, Lincoln, 2009 A thesis submitted to the Faculty of the Graduate School of the University of
Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes
Supplemental Tables Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes NOTCH1 or NOTCH2 Basal Immune Luminal AR Mesenchymal Stem Like WT 27 (87%) 24 (100%) 4 (66%)
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells
Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells Jae Won Choi, Mark A. Schroeder, Jann N. Sarkaria, and Richard J. Bram 1 Figure S1. Pharmacological
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Table 1. Clinicopathological features of melanoma samples (shown in Fig. 2) exhibiting higher XYZ mrna levels.
Sheikh MS et al., Privileged communication. Probe: N T N T N T N T N T N T Table 1. Clinicopathological features of melanoma samples (shown in Fig. 2) exhibiting higher mrna levels. Patient No. Age (yrs)
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors
CORRECTION NOTICE Nat. Med. 22, 194 21 (216) Blocking mediated phosphorylation enhances anti-tumor effects of PARP inhibitors Yi Du, Hirohito Yamaguchi, Yongkun Wei, Jennifer L Hsu, Hung-Ling Wang, Yi-Hsin
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Supporting Information
Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly