Tumor stage : I II III IV. well differentiated. moderately differentiated. adenocarcinoma. normal colon (adjacent to cancer) Log (T/H) SLAP mrna level

Transcription

1 moderately differentiated well differentiated Log (T/H) mrna level a Tumor stage : I II III IV N # patient b normal colon (adjacent to cancer) adenocarcinoma Supplementary Figure 1. Downregulation of expression in CRC (a) The mrna level in microdissected tumors from 17 patients with CRC classified according to the tumor stage (stage II to IV) was expressed relative to the amount found in the matching healthy tissue samples. The relative mrna expression in each patient was presented as the Log 1 T (tumor) / H (healthy tissue) ratio. (b) Paraffinembedded sectio of colonic tumor samples were examined for expression by immunohistochemistry using the anti IMG6322A antibody. Representative examples showing a decrease of immunostaining in well or moderately differentiated adenocarcinomas (right part) compared to the adjacent normal colon (left part) of the same patient. Scale bar, 4µm. Magnification iet: x2. 1

2 Relative cell migration Relative cell migration Relative cell migration OD 49nm OD 49nm OD 49nm a sh2 sh1 shluc Time (days) Time (days) Time (days) b 2. shluc sh1 sh2 Supplementary Figure 2. controls CRC cell tumorigenicity (a) affects growth of CRC cells in standard culture conditio. The optical deity (OD) at 49nm indicating the relative cell number is plotted as a function of time (mea ± SEM; n=3). (b) affects cell migration in Boyden chamber assays. Histograms show the cell migration values expressed relative to the control ( or shluc) value, arbitrarily set at 1 (mea ± SEM; n=3; p<5 Student s t test). 2

3 pcdna3 mrna level a HEK293T m b 1.2 NIH3T si sim1 sim2 Supplementary Figure 3. Efficiency of the different antimouse Slap sirnas (a) HEK293T cells were trafected with a vector expressing mouse (m) or vector alone (pcdna3). 24h after trafection, cells were trafected with various sirna sequences, listed in Supplementary Table 2, that target mouse Slap (sim) or with a nontargeting sirna sequence (si). 72h after sirna trafection, mouse protein level in cell lysates was analyzed by immunoblotting. was used as loading control. (b) NIH3T3 mouse embryonic fibroblasts were trafected with the indicated sirnas. 72h after sirna trafection, Slap mrna level was measured by qpcr (mea ± SEM; n=3). Primers used for qpcr are listed in Supplementary Table 3. 3

4 py : GST pulldown GST 28 GST Coomassie blue Supplementary Figure 4. The interaction between and in vitro requires an intact SH3 domain Indicated GSTfusion protei were incubated with recombinant that has been prephosphorylated by in vitro as shown in Figure 8c (py). The levels of precipitated were analyzed by immunoblotting. Coomassie blue staining shows the amount of precipitated GSTfusion protei. 4

5 protein level mrna level mrna level mrna level mrna level a b H T c #3 N T #4 N T #5 N T #6 N T #8 N T #9 N T #1 N T #11 N T #14 N T #15 N T #16 N T #17 N T d Tumor xenograft : #1 #2 #3 #4 #5 #6 #1 #2 #3 #4 #5 # Supplementary Figure 5. affects the protein level in experimental CRC tumors (a) does not affect tracript level in CRC cells. mrna level was measured by qpcr in the indicated cell lines (mea ± SEM; n=3). (b) tracript level is not modified in CRC samples compared to matched normal colon tissue. mrna level was measured by qpcr in the tumor (T) and adjacent healthy tissue (H) samples of 12 patients with CRC (mea ± SEM; : not significant Student s t test). (c) The levels of and in tissue lysates obtained from the tumor (T) and adjacent healthy tissue (H) samples of 12 patients with CRC were assessed by immunoblotting. (d) expression decreases protein level but does not affect mrna level in tumor xenografts. cells that express or not () were inoculated s.c. in nude mice. After 35 days, tumors were removed. Upper panel: Immunoblot analysis of and levels in tumor lysates. Lower panels: the left graph shows the quantification of the immunoblot analysis showed in the upper panel using the ImageJ software. The middle and right graphs show and mrna levels measured by qpcr (mea ± SEM; n=6 mice/group; : not significant, p<5, p<1 Student s t test). 5

6 protein level (%) protein level (%) MG132 E64 Leupeptin Pepstatin NH4Cl Chloroquine MG132 E64 Leupeptin Pepstatin NH4Cl Chloroquine NH4Cl NH4Cl Chloroquine Chloroquine NH4Cl NH4Cl Chloroquine Chloroquine MG132 E64 Leupeptin Pepstatin MG132 E64 Leupeptin Pepstatin MG132 E64 Leupeptin Pepstatin MG132 E64 Leupeptin Pepstatin Inhibitor : Inhibitor : Inhibitor : Inhibitor : Inhibitor : Inhibitor : 51% 5% 44% 42% 43% 46% 44% 43% % 48% 45% 43% 49% 43% : : Supplementary Figure 6. induced degradation in CRC cells is independent from the lysosomal activity CRC cells expressing or not () were incubated for 24h () or 12h () in the absence () or presence of the proteasome inhibitor MG132 (5µM) or lysosome inhibitors E64 (1µM), Leupeptin (1µM), Pepstatin A (2µM), NH 4 Cl (1mM) and Chloroquine (5µM) as indicated. Upper panels: The levels of, and in lysates were analyzed by immunoblotting. Vertical black lines denote that lanes were nonadjacent in the gel. Lower panels: Histograms show the quantification of the immunoblot analysis using the ImageJ software. Data represent mea ± SEM; n=3. The percentage of degradation is indicated. 6

7 Number of colonies Relative cell invasion LTN1 mrna level UBE3C mrna level WCL IP CBL IP Flag a CBL Flag CBL Flag CBL Flag b sicbl : 95 CBL Flag sicbl : 95 CBL Flag c siube3c : Flag siube3c : d siltn1 :.6.4 Flag.2 siltn1 : e siube4a1 : siube4a2 : UBE4A 1 5 siube4a1 : siube4a2 : siube4a1 : siube4a2 : 7

8 Supplementary Figure 7. UBE4A, but not CBL, UBE3C and LTN1, mediates antioncogenic activity (a) does not interact with CBL in CRC cells. The levels of and CBL in whole cell lysates (WCL) and in samples coimmunoprecipitated (IP) with the indicated antibodies were analyzed by immunoblotting (IB). (b) dependent degradation does not require CBL. CRC cells that express or not () were trafected with sirna targeting CBL () or sirna negative control () for 72h. Cell lysates were analyzed by IB. (c) dependent degradation does not require UBE3C. cells that express or not () were trafected with sirna targeting UBE3C () or sirna negative control () for 72h. Left panel: UBE3C mrna level was measured by qpcr (mea ± SEM; n=3). Right panel: cell lysates were analyzed by IB. (d) dependent degradation does not require LTN1. cells that express or not () were trafected with sirna targeting LTN1 () or sirna negative control () for 72h. Left panel: LTN1 mrna level was measured by qpcr (mea ± SEM; n=3). Right panel: cell lysates were analyzed by IB. (e) UBE4A depletion reverses function in cells. cells that express or not () were trafected with sirnas targeting UBE4A () or sirna negative control (). Left panel: dependent degradation is mediated by UBE4A. 72h after trafection, cell lysates were analyzed by IB. Band inteity was quantified by the ImageJ software. levels were normalized to. Values are indicated. Middle panel: Soft agar colony formation assay. Right panel: Invasion assay. Data represent mea ± SEM; n=6; : not significant, p<5, p<1 (Student s t test). Molecular size markers () are shown. 8

9 protein level (%) protein level (%) a EphrinA1 : EphrinA1 : 15 39% 41% 25 61% 1 41% 48% % 5 1 : EphrinA1 : 5 sh2 : EphrinA1 : b Low deity High deity Low deity High deity Supplementary Figure 8. degradation induced by is independent from EphrinA1 binding (a) The EphrinA1 ligand induces degradation in a independent manner., and cells infected with the indicated viruses were stimulated with 1µg/ml preclustered EphrinA1Fc or Fc as a control for 15min. The levels of and were analyzed by immunoblotting. Upper panels: Representative western blots. Lower panels: Signal inteities of the blots showed in the upper panels were quantified using ImageJ. Data represent mea ± SEM; n=3. The percentage of degradation is indicated. (b) induces degradation in a ligandindependent manner. CRC cells that express or not () were plated at 1% confluence (low cell deity without cellcell contacts) or 9% confluence (high cell deity). Cell lysates were analyzed by immunoblotting with the indicated antibodies. 9

10 Number of colonies Relative cell invasion Number of colonies Relative cell invasion mrna level WCL IP a 8 6 b : HEK293T KD KD YF py : WT YF KD WT YF KD c : KD KD YF KD KD YF ps473 AKT 5 AKT : KD KD KD KD YF YF : KD KD KD KD YF YF d DMSO PP2 DMSO PP2 1 5 : WT YF KD WT YF KD : WT YF KD WT YF KD Supplementary Figure 9. and (KD) reverse function in a dependent manner (a) cells that express or not () were infected with retroviral vectors that express the indicated mutants (WT, wild type; YF, Y594F mutant and KD, kinase dead) and then mrna level was measured by qpcr (mea ± SEM; n=3). (b) (KD) is phosphorylated at Tyr594. HEK293T cells were trafected with the indicated cotructs for 48h. Cell lysates were immunoprecipitated with an anti antibody. Whole cell lysates (WCL) and immunoprecipitates were analyzed by immunoblotting (IB). (c) Adaptor function of in CRC cells. cells expressing or not () were infected with retroviral vectors that express the indicated mutants (KD, kinase dead and KD YF, kinase dead and Y594F double mutant). Left panel: Cell lysates were analyzed by IB. Middle panel: Soft agar colony formation assay. Right panel: Invasion assay. Data represent mea ± SEM; n=6; : not significant, p<5, p<1 (Student s t test). (d) cells that express or not () and infected with the indicated viruses were treated with the inhibitor PP2 (5µM) or vehicle (DMSO). Left panel: Soft agar colony formation assay. Right panel: Invasion assay. Data represent mea ± SEM; n=3. 1

11 Number of colonies Relative cell invasion 4 shluc sh2 5 shluc sh2 3 4 Akti1/2 : ps473 AKT AKT 2 1 Akti1/2 : Akti1/2 : Supplementary Figure 1. AKT inhibition reverses the traforming properties induced by depletion in CRC cells cells that express anti (sh) or antiluciferase (shluc) shrnas were treated with the AKT inhibitor Akti1/2 (1µM) or vehicle (DMSO). Left panel: After 2h of treatment, cell lysates were analyzed by immunoblotting with the indicated antibodies. Middle panel: Soft agar colony formation assay. Right panel: Invasion assay. Data represent mea ± SEM; n=3. : not significant, p<1, p<1 (Student s t test). 11

12 WCL IP IP WCL WCL IP Flag IP IP IP a : : PP2 : HEK293T b Y594F : : : HEK293T ptyr py594 py594 Flag Flag Flag ptyr c : : : HEK293T Supplementary Figure 11. phosphorylates on Tyr594 promoting complex formation (a) Interaction between and is dependent. HEK293T cells were trafected with the indicated cotructs for 48h. Cells were next treated with the inhibitor PP2 (5µM) or vehicle (DMSO) for 4h. Cell lysates were immunoprecipitated (IP) with the indicated antibodies. Whole cell lysates (WCL) and immunoprecipitates were analyzed by immunoblotting (IB). (b) complex formation does not require ptyr594. HEK293T cells were trafected with the indicated cotructs for 48h. Cell lysates were IP with the indicated antibodies. WCL and immunoprecipitates were analyzed by IB. (c) overexpression does not affect complex formation. HEK293T cells were trafected with the indicated cotructs for 48h. Cell lysates were IP with the indicated antibodies. WCL and immunoprecipitates were analyzed by IB. Molecular size markers () are shown. 12

13 Number of colonies Relative cell invasion : sh2 : sh : / sh2 sh : sh : / sh2 Supplementary Figure 12. silencing reduces the oncogenic potential of induced by inactivation cells expressing and a shrna directed agait (sh2) were infected with retroviral vectors that express a shrna targeting (sh) or a scramble shrna () as control. Left panel: protein level in the corresponding cell lysates was analyzed by immunoblotting. was used as loading control. Middle panel: Soft agar colony formation assay. Right panel: Invasion assay. Data represent mea ± SEM; n=3. 13

14 colonies (%) cell invasion (%) 2 15 shluc sh2 shluc sh sh : sh : Supplementary Figure 13. inactivation dictates the oncogenic addiction of CRC cells to expression cells that express antisla (sh2) or antiluciferase (shluc) shrnas were infected with retroviral vectors that express a shrna targeting (sh) or a scramble shrna () as control. Left panel: Soft agar assays; histograms show the percentage of colonies obtained from cells that express the indicated shrnas and were grown in soft agar compared to control (cells expressing the scramble shrna), arbitrarily set at 1%. Right panel: Boyden chamber assays; histograms show the percentage of invasion of cells that express the indicated shrnas compared to control (cells expressing the scramble shrna), arbitrarily set at 1%. Data represent mea ± SEM; n=5. p<5, p<1 (Student s t test). 14

15 Fig. 2a Fig. 3c Fig. 3d py418 py py861 FAK 95 FAK 95 py861 FAK 95 FAK

16 Fig. 4a Fig. 4f ΔC ΔC Fig. 4g Fig. 4h HEK293T py ΔC ΔC 28 16

17 Fig. 5a Fig. 5c Fig. 5d Fig. 5e Fig. 5f

18 Fig. 6a UBE4A UBE4A 95 UBE4A Fig. 6b UBE4A ΔC Fig. 6c UBE4A Fig. 6d UBE4A Fig. 6e Fig. 6f 25 (Ub) n 25 (Ub) n UBE4A UBE4A 18

19 Fig. 6g Fig. 6h Fig. 7a 25 UBE4A ptyr Fig. 7b ps473 AKT 95 AKT Fig. 7d ps473 AKT ps473 AKT AKT AKT perk perk ERK ERK

20 Fig. 7e Fig. 7f 95 UBE4A ps473 AKT ps473 AKT 28 AKT 95 AKT 28 Fig. 8a Fig. 8b HEK293T ptyr ptyr py594 py594 py

21 Fig. 8c Fig. 8d Fig. 8e 95 py py py418 Fig. 8f Fig. 8g 95 ptyr py594 py Supplementary Figure 14. Western blot images of the selected portion displayed in main figures Boxed areas were cropped for designated figures. 21

22 / py861fak / FAK py418 / / Fig. 2a n=3 Fig. 3d PP2 : n=3 Fig. 5a 2. n=4 22

23 / ps73akt / AKT / / / / Fig. 5c MG132 : h MG132 : h n=3 Fig. 5d WT SH2 SH3 SH3 N32 SH2 WT SH2 SH3 SH3 SH2 N32 n=3 Fig. 6h Fig. 7b siube4a1 : siube4a2 : n=3 : WT YF KD WT YF KD n=3 23

24 / / ps473akt / AKT ps473akt / AKT perk / ERK ps473akt / AKT Fig. 7d PP2 : n=3 Fig. 7e Fig. 7h sh sh siube4a : sh : n=2 n=3 Fig. 8d Fig. 8e PP1 : PP2 : PP1 : PP2 : n=1 n=1 24

25 / / / Fig. 8f : : : : n=5 Fig. 8g 2. sh : : n=2 Supplementary Figure 15. Quantification and statistical analysis of Western blot images displayed in main figures Signal levels were quantified by the ImageJ software. Histograms show the protein level relative to the indicated control level. Data represent mea ± SEM; : not significant, p<5, p<1, p<1 (Student s t test). The number of replicates (n) is indicated. 25

26 Supplementary Table 1. Correlation between expression levels and clinicopathological features in colorectal cancer Variable Number of patients Low expression index High UICC stage I II 13 6 (46,2%) 7 (53,8%) III IV (46,2%) 14 (53,8%) Site Cecum 2 2 (1%) Colon (45,8%) 13 (54,2%) Rectum 13 7 (53,8%) 6 (46,2%) 5 (55,6%) 4 (44,4%) Metastatis 9 Histology Omentum (1) ; Uterus (1) ; Ovary (1) ; Liver (1) ; Lung (1) ; Ovary (1) ; Liver (1) ; Lung (1) Lymph node (1) Adenocarcinoma, well differentiated 1 4 (4%) 6 (6%) Adenocarcinoma, moderately differentiated (5%) 11 (5%) Adenocarcinoma, poorly differentiated 3 2 (66,7%) 1 (33,3%) Mucinous adenocarcinoma 3 3 (1%) Age (years) < (47,6%) 8 (47,1%) 11 (52,4%) 9 (52,9%) Gender Male Female (44,4%) 6 (5%) 15 (55,6%) 6 (5%) 26

27 Supplementary Table 2. shrna and sirna sequences shrna Sequence Vector shluciferase Clontech psirenretroq sh1 h GAGTTACATCCCTGGAATA psirenretroq sh2 h GACCTGGTGAACCACTATT psirenretroq sh GACACTCGGTAGTCTATAC psuper.retro.neo.gfp sh h GCAGTATACGGAGCACTTC psuper.retro.neo.gfp sirna si siluciferase sim1 sim2 sim3 sim4 siube4a1 h siube4a2 h sicbl h siube3c h siltn1 h Sequence Nontargeting sirna#1 (Dharmacon) CGUACGCGGAAUACUUCGA GGGAAUAGCAUGAAAUCCA AGAUUGGUAGCUUCAUGAU AGAACUGUGUGUGUAUGUA GAGCCAAACUACCUUUAUA GCCAAUAGAGCUAACCUUU CCAGGCAACCACUUAAUUA GACACAUUUCGGAUUACUA GAUUGAUGAGCCUCUGUUG GCGAAAGGAUGCUUGCUAA 27

28 Supplementary Table 3. Primer sequences for qpcr Target Gene Forward primer Reverse primer Annealing temperature GAPDH h 5'TCTCCTCTGACTTCAACAGCGAC3' 5'CCCTGTTGCTGTAGCCAAATTC3' 6 C B2M h 5'GTGCTCGCGCTACTCTCTC3' 5'GTCAACTTCAATGTCGGAT3' 6 C h 5'CCGGAGGGACTGGATAGC3' 5'ACAGCCAGCCATGGTAAAC3' 58 C h 5'GGGACCTGATGCAGAACATC3' 5'AGTTGGTGCGGAGCCAGT3' 6 C UBE3C h 5'AAAGCAGATAAGGTCACTCAGC3' 5'CAAAAGGCAACTCTGTCAGGA3' 6 C LTN1 h 5'ACCGGGTTGTAACTTGTTCCT3' 5'TCTGAGGTACACTGTGTTTTCCA3' 6 C GAPDH m 5'TGTGTCCGTCGTGCATCTGA3' 5'CCTGCTTCTCCACCTTCTTGA3' 6 C ActinB m 5'TTGCTGACAGGATGCAGAAG3' 5'AGTCCGCCTAGAAGCACTTG3' 6 C m1 5 ATGGGGAATAGCATGAAATCCAC3 5 GGAGATGGGTAGTCAGTCAGC 3 6 C m2 5'GCACTGGCCGGGAAAGTTAT3' 5'CAGCAGTTCCTCAGCCTTGTC3' 6 C 28

29 SUPPLEMENTARY METHODS Standard proliferation assay. 5 cells were seeded in 24well plates in DMEM containing 5% FCS and then they were fixed every day in trichloroacetic acid (TCA) solution. Standard cell growth was measured by Sulforhodamine B staining (Sigma Aldrich). Migration assay. Cell migration assays were performed in Boyden chambers (BD Bioscience) using 3 cells. After 1h, cells were fixed in 3.7% paraformaldehyde solution containing.1% Hoechst. Whole well images were acquired using an inverted microscope (Zeiss Axiovert 2M or Leica DMIRE2) and a 1x EC Plan Neofluar.3 PH1 objective. Nuclei were then counted in whole wells using the Metamorph software (Molecular Devices, Inc.). Immunohistochemical analyses. For human tissues: a total of 6 formalinfixed, paraffinembedded colon tissue samples (Colorectal cancermetastasisnormal [CDA3] human tissue array) were obtained from Super Bio Chips. This array included 4 cores of colorectal cancer of different stages, 1 cores of metastatic lesion and 9 cores of normal colon tissue. Sectio of paraffinembedded tissue specime were stained with a polyclonal rabbit anti antibody (1:1 dilution, 5mg/ml, Imgenex: IMG6322A). Tissue sectio were immunostained with nopecific IgG and used as negative controls (not shown). The IHC test gives a score of to 3 that measures the amount of protein in the cells of a colon cancer tissue sample. Low expression referred to a score of 1 and high expression to a score of 23. Two investigators, while blinded to the clinical data, scored staining. GST pulldown assays. GSTfusion protei were produced and purified as described in Methods section. 1µg of GST alone, GST N32 or GST N32 bound to Glutathione magnetic beads (Promega) were incubated with,125 µg of prephosphorylated recombinant protein (see Methods section) at 4 C for 3 minutes in 1% BSATBS buffer supplemented with 1µg/ml aprotinin, 2µM leupeptin and 1µM sodium orthovanadate. Beads were washed in WLB buffer (2mM Tris ph 7.5, 15mM NaCl, 1% NP4, 1µg/ml aprotinin, 2µM leupeptin, 1mM DTT, 1mM NaF and 1µM sodium orthovanadate) supplemented with 1% BSA and analyzed by immunoblotting. 29