Effect of fatty acids on the synthesis and secretion of apolipoprotein Β by rat hepatocytes
|
|
- Phyllis Bryant
- 5 years ago
- Views:
Transcription
1 J. Biosci., Vol. 17, Number 4, December 1992, pp Printed in India. Effect of fatty acids on the synthesis and secretion of apolipoprotein Β by rat hepatocytes Ν SURESH KUMAR, RITA ABRAHAM, G SURESH KUMAR, Ρ R SUDHAKARAN* and Ρ A KURUP Department of Biochemistry, University of Kerala, Kariavattom, Trivandrum , India MS received 27 January 1992; revised 29 June 1992 Abstract. The modulation of apolipoprotein Β synthesis and secretion by fatty acids in rat hepatocytes was studied Maximum apolipoprotein Β production was obtained in the case of oleic acid followed by linoleic, stearic and palmitic/linolenic acid when compared to control which was not supplemented with any fatty acids. Oleic acid was found to exert a concentration dependent increase in the secretion of [ 3 H] apolipoprotein Β into the medium while that associated with the cell layer was not affected. Pulse chase experiments in the presence of oleic acid showed that it caused an increase in the secretion of apolipoprotein Β into the medium. 14 C-acetate incorporation into cholesterol and cholesteryl ester associated with the cell layer and secreted very low density lipoproteins also showed an increase in the presence of oleic acid indicating an increase in cholesterogenesis. The effect of oleic acid on [ 3 H] apolipoprotein Β and very low density lipoproteins secretion appeared to be mediated through cholesterol as (i) ketoconazole, an inhibitor of cholesterol synthesis caused significant reduction in the stimulatory effect of oleic acid on apolipoprotein secretion and (ii) mevinolin, another inhibitor of cholesterol synthesis also reversed the stimulatory effect of oleic acid on apolipoprotein Β secretion. These results indicated that oleic acid may influence apolipoprotein Β synthesis and secretion in hepatocytes probably by affecting cholesterol/cholesteryl ester formation which may be a critical component in the secretion of apolipoprotein Β as lipoproteins. Keywords. Hepatocytes; oleic acid; apolipoprotein Β synthesis; modulation by cholesterol. 1. Introduction The very low density lipoproteins (VLDL) synthesised and secreted by liver are primarily involved in the transport of triacylglycerol of endogenous origin from liver to other tissues. Isolated hepatocytes maintained in primary culture are a useful system to study the synthesis and secretion of triglyceride rich VLDL (Davis et al 1979). The availability of fatty acids, the primary substrate for triglyceride (TG) synthesis has been shown to increase the synthesis and secretion of TG as VLDL (Kohout et al 1971; Davis and Boogaerts 1982; Field et al 1988). Though different fatty acids exert different degrees of stimulation, it has been shown that oleic acid has the maximum stimulatory effect (Field et al 1988). While Pullinger et al (1989) and Moberly et al (1990) reported that oleic acid in addition to its effect on TG synthesis has also stimulated the synthesis of apolipoprotein Β (apob), the major apo protein of VLDL, Davis and Boogaerts (1982) did not observe any effect for oleic acid on apob synthesis. However, it is not known how the synthesis of apob that is taking place on the rough endoplasmic reticulum is coordinated with the synthesis of TG which is occurring in the smooth endoplasmic reticulum surface. *Corresponding author. 473
2 474 Ν Suresh Kumar et al It was postulated that the availability of cholesteryl ester which is synthesised by enzymes located in the rough endoplasmic reticulum rather than TG is a critical component in apob synthesis and its assembly and secretion as VLDL (Cianflone et al 1990). Recent reports from our laboratory (Kumar et al 1992) using hepatocytes and by others using HepG2 cells suggested that cholesterol ester is an obligatory requirement for synthesis and secretion of apob as VLDL. Therefore the effect of different fatty acids on apob synthesis and secretion of VLDL and the possibility that change in VLDL production in response to fatty acid challenge is mediated through cholesterol was examined using isolated rat hepatocytes in primary culture. 2. Materials and methods Oleic acid, linoleic acid, linolenic acid, stearic acid, palmitic acid and ketoconazole were purchased from Sigma chemicals (USA). Foetal bovine serum was a product of Gibco. Tissue culture plastic wares were from NUNC, Denmark. Protein A- sepharose was from Pharmacia, Sweden. L- [ 3 H] leucine and [ 14 C] acetate were purchased from the Bhabha Atomic Research Centre, Bombay. 2.1 Preparation of hepatocytes Normal male adult rats (Sprague Dawley strain) weighing g were used for the isolation of hepatocytes by collagenase perfusion according to the procedure of Seglen (1976) as described before (Kumar et al 1992). Hepatocytes suspended in Eagles MEM supplemented with 10% FBS, penicillin (100 µg/ml), streptomycin sulphate 100 µg/ml) and insulin (0 1 nm) were plated in 35mm plastic petri dishes and maintained at 37 C in a 95% air 5% CO 2 atmosphere for about 4 h. The unattached cells were removed and cell monolayer was washed with serum free medium and incubated in serum free medium. The effect of in vitro addition of various substances was studied by incorporating them into the medium. 2.2 Metabolic labelling and immunoprecipitation of apob The cells in the basal medium were metabolically labelled with [ 3 H] leucine. At the end of the incubation period the medium was collected and cells were harvested in lysis buffer (0 2% SDS, 2mM EDTA, 2mM PMSF in 0 1 Μ Tris, ph 8 1). The [ 3 H] leucine labelled total apob secreted into the medium and that associated with the cell layer were immunoprecipitated by adding antisera raised against rat apob. The antigen-antibody complex was treated with protein A-sepharose as described before (Sudhakaran et al 1986) and was solubilized in Laemmli buffer and electrophoresed by the method of Laemmli (1970); gel slices were dissolved in 30% H 2 O 2 and the total apob associated radioactivity was measured in the liquid scintillation counter. 2.3 [ 14 C] acetate incorporation into cellular lipids Hepatocytes were incubated with Eagles MEM containing 1, 2 [ 14 C] acetate in the presence or absence of fatty acids or drugs. At the end of the incubation period the
3 Effect of fatty acids on ApoB by rat hepatocytes 475 medium was collected and the cell layer was washed three times with phosphate buffered saline (PBS), ph 7 4. The secreted VLDL was isolated by floatation at d < in the presence of carrier serum in a Sorvall ultracentrifuge (Hatch and Lees 1968). The cells were harvested using PBS and delipidated according to Folch et al (1957). The [ 14 C] labelled cholesterol and cholesteryl esters associated with the cell layer and secreted VLDL were then separated by TLC (Silica gel G) in a solvent system of hexane-ether-acetic acid according to Nelson (1972). Cholesterol and cholesteryl esters were scrapped out and transferred to scintillation vials and the radioactivity was measured. The protein was also measured according to Lowry et al (1951). 2.4 Fatty acid Albumin preparation The sodium salt of fatty acid was dissolved in water and added to a small amount of Eagles MEM-containing HEPES-(10mM, ph 7 4) and the appropriate amount of albumin to maintain fatty acid albumin ratio of 3 : 1 3. Results 3.1 Effect of different fatty acids on the secretion of apob into the medium by hepatocytes All the fatty acids, namely palmitic, stearic, oleic, linoleic and linolenic caused increased secretion of [ 3 H] apob into the medium when compared to the controls which was not supplemented with any fatty acids (table 1). Maximum secretion of [ 3 H] apob was observed with oleic acid and minimum with palmitic acid. In descending order of the [ 3 H] apob secretion into the medium, the different fatty acids are 18:2, 18:0, 18:3 = 16:0. But there was no significant difference in cell associated [ 3 H] apob in the case of different fatty acids. The sum of the secreted and cell associated [ 3 H] apob was maximum in the case of oleic acid followed by linoleic acid, stearic acid, and palmitic/linolenic acid. Table 1. Incorporation of [ 3 H] leucine into apob Effect of different fatty acids The cells were incubated with different fatty acids (500 μμ) for 12 h in medium containing 20 μci of [ 3 H] leucine and the radioactivity associated with secreted and cell associated apob was measured. The values given are the average of four different experiments ± S D. In all cases P < *Not significant.
4 476 Ν Suresh Kumar et al 3.2 Effect of different concentrations of oleic acid on the secretion of apob The secretion of [ 3 H] apob increased up to the highest concentration of oleic acid tested i.e. 1 mm (figure 1). However, there was no significant increase in the cell associated [ 3 H] apob. But there was significant increase in the apob in the medium plus cell associated apob indicating increased production of apob. Figure 1. Effect of oleic acid on the secretion of [ 3 H] apob. Hepatocytes were labelled with 30 μci of [ 3 H] leucine for 12 h in the presence of different amounts of oleic acid. [ 3 H] apob secreted into the medium was immunoprecipitated and determined as described in the text. The results of a typical experiment are given. Values are the average of four experiments. The variation for different experiment was less than 5% 3.3 Pulse chase experiment The increase in the level of [ 3 H] apob in the medium in the presence of oleic acid can be due to an increased rate of synthesis or increased rate of secretion or due to both. In order to examine this, cells were pulse labelled with radioactive amino acids and chased in non radioactive medium in the presence of oleic acid. In the presence of oleic acid the content of [ 3 H] apob secreted into the medium was found to be significantly more (figure 2), probably indicating that the rate of secretion is higher. 3.4 Effect of oleic acid on the incorporation of [1, 2 14 C] acetate into the cholesterol of secreted VLDL and cell associated cholesterol There was significant increase in the incorporation of [ 14 C] acetate both into the
5 Effect of fatty acids on ApoB by rat hepatocytes 477 Figure 2. Pulse-chase analysis of apob in the presence of oleic acid. Hepatocytes were pulse labelled with 100 μci of [ 3 H] leucine for 3 h. The media was removed, cells were washed and reincubated in medium containing non-radioactive leucine in the presence (test) or absence (control) of oleic acid (500 μμ) for 6 h. The apob secreted into the medium was immunoprecipitated and quantitated as described in the text. The results of a typical experiment are given. The values are the average of four experiments. The variation for different set of experiments was less than 5%. cholesterol of VLDL and that associated with the cell in the presence of oleic acid (250 μμ) when compared with the control (table 2). Table 2. Incorporation of [1, 2 14 C] acetate into cholesterol Effect of oleic acid. The cells were incubated with 10 μci of [ 14 C] acetate in the presence of oleic acid (500 μm) for 12 h. [ 14 C] cholesterol was separated from cell extract as well as from isolated secreted VLDL and estimated radioactivity. The values given are the average of four experiments ± S D P < 0 01.
6 478 Ν Suresh Kumar et al 3.5 Effect of inhibitors of cholesterogenesis on the stimulation of apob secretion by oleic acid In order to examine whether the increased apob and VLDL production in response to oleic acid challenge is related to cholesterol synthesis, the effect of ketoconazole and mevinolin, two drugs, which inhibit cholesterol synthesis on apob synthesis were studied. Ketoconazole at a concentration of 1 μμ caused significant inhibition in the incorporation of labelled acetate into total and esterified cholesterol when compared with the control (figure 3). The drug alone caused significant inhibition of the secretion of [ 3 H] apob into the medium and also decreased the cell associated [ 3 H] apob when compared to control cells. The stimulation of apob secretion into the medium by oleic acid was significantly reduced in the presence of the drug (figure 4). Addition of mevinolin (20 μμ) to cultures in the presence of oleic acid also reversed the stimulatory effect of oleic acid on apob production (figure 4). Similar effect of mevinolin was observed in short term experiments where [ 3 H] leucine incorporation into apob was studied in the presence of mevinolin alone or with oleic acid (data not given). Figure 3. Effect of oleic acid and inhibitors of cholesterol synthesis on the incorporation of [ 14 C] acetate into cholesterol and cholesteryl ester by hepatocytes. Hepatocytes were incubated with 10 μci of [ 14 C] acetate in the presence or absence of oleic acid, mevinolin and ketoconazole for 12 h. [ 14 C] cholesterol were separated from cell extracts and radioactivity was measured as described in the text. The values given are the mean of four experiments. *Not significant; C, control; O, oleic acid; K, ketoconazole; Μ, mevinolin. 3.6 Effect of mevinolin on the stimulation of [ 14 C] acetate incorporation by oleic acid The stimulation of the synthesis of cholesterol and cholesteryl ester by oleic acid was studied in the presence of mevinolin, by measuring the incorporation of [ 14 C] acetate. The results are given in figure 3. The stimulatory effect of oleic acid on [ 14 C] acetate incorporation into free and ester cholesterol was reduced by mevinolin.
7 Effect of fatty acids on ApoB by rat hepatocytes 479 Figure 4. Effect of oleic acid and inhibitors of cholesterol synthesis on the incorporation of [ 3 H] leucine into apob Hepatocytes were incubated with 30 μci of [ 3 H] leucine for 12 h in the presence or absence of oleic acid (50 μμ), mevinolin (20 μμ) and ketoconazole (1 μμ). The radioactivity associated with the apob secreted into the medium as well as that associated with the cell layer was measured as described in the text (A) Media; (B) Cell layer. *Not significant; C, control, K, ketoconazole; Ο, oleic acid; Μ, mevinolin. 4. Discussion The results now obtained indicate that exogenous fatty acids have significant effect in stimulating the secretion of apob into the medium. Of the different fatty acids studied, oleic acid exerted maximum effect. The results now obtained are generally similar to those reported by Field et al (1988) using CaCo-2 cells and Davis and Boogaerts (1982) using hepatocytes on the effect of different fatty acids on the secretion of triacylglycerol rich lipoproteins. However Field et al (1988) in their experiments did not study the secretion of apob but only triacylglycerol secretion. The increase in the secretion of apob containing lipoproteins in the presence of exogenous fatty acids now obtained was observed when compared to controls which is not supplemented with fatty acids. When stearate was compared with C 18 - unsaturated fatty acids for their effect on apob synthesis and secretion, it is seen that in the presence of linolenic acid, lower amounts of apob containing lipoproteins was secreted into the medium. Oleic acid significantly increased the output of apob containing lipoproteins, while with linoleate, the secretion was more, even though lower than that observed in the case of oleic acid. This is relevant in the light of the fact that the serum VLDL/LDL levels are higher in response to saturated fat in the diet and is significantly lower if the dietary fat is rich in polyunsaturated fatty acids particularly of the linolenic acid group containing n-3 fatty acids (Mölgaard et al 1990). Since oleic acid showed maximum stimulatory effect on apob secretion, its effect was studied in greater detail. Eventhough the cell associated apob was not
8 480 Ν Suresh Kumar et al significantly altered, the total of secreted and cell associated [ 3 H] apob showed a concentration dependent increase indicating increased synthesis of apob. These results together with pulse chase analysis indicate that oleic acid increases both synthesis and secretion of apob by hepatocytes. This does not appear to be due to an alteration in the total protein synthesis in response to oleic acid as it did not show any effect on general protein synthesis. The results reported by Moberly et al (1990) and Pullinger et al (1989) with HepG2 cells are in agreement with our findings. Cianflone et al (1990) demonstrated that oleic acid stimulated apob secretion in HepG2 cells and this apparently was shown to be a specific effect as apoa-i secretion was unaffected. However, Davis and Boogaerts (1982), did not find any effect for oleic acid on apoprotein synthesis. Exogenous fatty acids appear to cause parallel changes in cholesterol synthesis and apob production as evidenced by the results on cholesterogenesis. Oleic acid caused significant increase in the incorporation of [ 14 C] acetate into cellular cholesterol indicating increased cholesterogenesis. This is similar to the results reported by Goh and Heimberg (1977) in liver perfusion studies with free fatty acids where the activity of HMG CoA reductase was shown to be linearly proportional to the uptake of oleic acid suggesting increased cholesterogenesis. An inhibitor of cholesterol biosynthesis namely ketoconazole was observed in our experiment to counteract the stimulation of apob secretion caused by oleic acid. Ketoconazole is an antifungal drug which inhibits cholesterol synthesis by blocking demethylation of lanosterol (Miettinen 1988) and decreased incorporation of [ 14 C] acetate into total and esterified cholesterol indicating an inhibitory effect on cholesterol synthesis in hepatocytes also. The effect on free cholesterol appeared to be less significant probably because the radioactivity associated with the free cholesterol fraction in ketoconazole treated cells may also contain that of methylated intermediates. Mevinolin, a specific competitive inhibitor of HMG-CoA reductase (Alberts et al 1980) also reversed the stimulatory effect of oleic acid on the production of these lipoproteins by hepatocytes indicating that the stimulatory effect of oleic acid on the synthesis and secretion of apob containing lipoproteins is mediated through the availability of cholesterol. This is in line with the observation made by Koshyk et al (1988), Khan et al (1989) and Cianflone et al (1990). We have shown that any condition that results in increasing intracellular cholesterol results in increasing apob synthesis and secretion and where the cholesterol synthesis was inhibited there was a reduction in apob synthesis and secretion suggesting a critical role for cholesterol ester rather than triglyceride in apob synthesis and secretion (Kumar et al 1992). The results discussed above also suggested that the increase in the synthesis and secretion of apob containing lipoproteins in hepatocytes in response to fatty acid challenge is triggered through enhanced cholesterol synthesis. In our studies oleic acid caused more than two-fold increase in the incorporation of radioactive acetate into the cholesterol in the secreted VLDL. This newly synthesised cholesterol may be required in the packaging and assembly of VLDL. Acknowledgement Financial assistance received from the Department of Science and Technology, New Delhi, to carry out this work is gratefully acknowledged.
9 Effect of fatty acids on ApoB by rat hepatocytes 481 References Alberts A W, Chen J, Kuron G, Hunt V, Huff J, Hoffman C, Rothrock J, Lopez J Μ, Joshua Η, Harris Ε, Patchett A, Monaghan R, Currie S, Stapley E, Albers-Schonberg G, Hensens O, Hirshfiled J, Hoogsteen K, Liesch J and Springer J 1980 Mevinolin: a highly potent competitive inhibitor of hydroxymethylglutaryl coenzyme A reductase and a cholesterol lowering agent; Proc. Natl. Acad. Sci. USA Cianflone Κ Μ, Yazrud Ζ, Rudriguez Μ A, Vas D A and Sniderman 1990 Regulation of apob secretion from HepG2 cells, evidence for a critical role for cholesterol ester synthesis in the responses to fatty acid challenge; J. Lipid Res Davis R A, Engelhorn S C, Pangburn S H, Weinstein D Β and Steinberg D 1979 Very low density lipoprotein synthesis and secretion by cultured rat hepatocytes; J. Biol. Chem Davis R A and Boogaerts J R 1982 Intrahepatic assembly of very low density lipoproteins; J. Biol. Chem Field F J, Albright Ε and Mathur S Ν 1988 Regulation of triglyceride-rich lipoprotein secretion by fatty acids in CaCo-2 cells; J. Lipid Res Folch J, Lees Μ and Sloane Stanley G Η 1957 A simple method for the isolation and purification of total lipids from animal tissues; J. Biol. Chem Goh Ε Η and Heimberg Μ 1977 Effect of free fatty acids on activity of hepatic microsomal 3-hydroxy-3- methyl glutaryl coenzyme A reductase and on secretion of Triglyceride and cholesterol by liver; J. Biol. Chem Hatch F Τ and Lees R S 1968 Practical methods for plasma lipoprotein analysis; Adv. Lipid Res Khan B, Wilcox Η G and Heimberg Μ 1989 Cholesterol is required for secretion of very-low-density lipoprotein by rat liver; Biochem. J Kohout Μ Β, Kohoutova Β and Heimberg Μ 1971 The regulation of hepatic triglyceride metabolism by free fatty acids; J. Biol. Chem Koshyk V A, Surguchov A P, Podres Ε A, Novikov D K, Sudarickov A B, Beresteskaya YU V, Repin V S and Smirnov V Ν 1988 VLDL apoprotein secretion and apob mrna level in primary culture of cholesterol loaded rabbit hepatocytes; FEBS Lett Kumar Ν S, Abraham R, Kumar G S, Sudhakaran Ρ R and Kurup Ρ A 1992 Synthesis and secretion of VLDL by rat hepatocytes Modulation by cholesterol and phospholipids; Indian J. Biochem. Biophys. (in press) Laemmli U Κ 1970 Cleavage of structural proteins during the assembly of the head of bactereophage T4 ; Nature (London) Lowry Ο Η, Rosebrough Ν J, Farr A L and Randall R J 1951 Protein measurement with the Folin phenol reagent; J. Biol. Chem Miettinen Τ A 1988 Cholesterol metabolism during Ketoconazole treatment in man; J. Lipid Res Moberly J Β, Cole Τ G, Alpers D Η and Schonfeld G 1990 Oleic acid stimulation of apolipoprotein Β secretion from HepG2 and CaCo-2 cells occur Post-transcriptionally; Biochim. Biophys. Acta Mölgaard J, Von Schenck Η, Lassivk C, Kuusi Τ and Olsson A G 1990 Effect of fish oil treatment on plasma lipoproteins in type III hyperlipoproteinemia; Atherosclerosis Nelson G J 1972 Quantitative analysis of blood lipids; in Blood lipids and lipoproteins: Quantitation, composition and metabolism (ed.) G J Nelson (New York: Wiley-Interscience) pp Pullinger C R, North J D, Teng Β Β, Rifici V A, Ronhild de Brito Α Ε and Scott J 1989 The apolipoprotein Β gene is constitutively expressed in HepG2 cells: regulation of secretion by oleic acid, albumin, and insulin, and measurement of the mrna halflife; J. Lipid Res Seglen Ρ Ο 1976 Preparation of isolated liver cells; Methods Cell Biol Sudhakaran Ρ R, Stamatoglou S C and Hughes R C 1986 Modulation of protein synthesis and secretion by substratum in primary cultures of rat hepatocytes; Exp. Cell. Res
Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats
J. Biosci., Vol. 12, Number 2, June 1987, pp. 137 142. Printed in India. Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats P. VALSALA and P. A. KURUP Department
More informationMechanism of hypercholesterolemia produced by biotin deficiency
J. Biosci., Vol. 13, Number 4, December 1988, pp. 393 399. Printed in India. Mechanism of hypercholesterolemia produced by biotin deficiency ANNIE ABRAHAM and P. A. KURUP* Department of Biochemistry, University
More informationGlycosaminoglycans are important macromolecular components. surface of cell membranes and also membranes of subcellular
Chapter VII EFFECT OF GLYCOSAMINOGLYCANS ON THE SYNTHESIS AND SECRETION OF APOLIPOPROTEIN B BY RAT HEPATOCYTES IN CULTURE Glycosaminoglycans are important macromolecular components of intercellular matrix
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationReplacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
More informationInhibition of fatty acid synthesis decreases very low density lipoprotein secretion in the hamster
Inhibition of fatty acid synthesis decreases very low density lipoprotein secretion in the hamster Cynthia M. Arbeeny,' Daniel S. Meyers, Kristin E. Bergquist, and Richard E. Gregg The Bristol-Myers Squibb
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More informationIodide transport in isolated cells of mouse submaxillary gland
J. Biosci., Vol. 10, Number 3, September 1986, pp. 303 309. Printed in India. Iodide transport in isolated cells of mouse submaxillary gland R. K. BANERJEE*, A. K. BOSE, T. K. CHAKRABORTY, P. K. DE and
More informationTopic 11. Coronary Artery Disease
Topic 11 Coronary Artery Disease Lipid metabolism http://news.bbc.co.uk/2/hi/health/7372495.stm Sterol Metabolism and Coronary Artery Disease Big Picture: Exogenous Cholesterol and Fat Metabolism Fats-Triglycerides
More informationBIOB111_CHBIO - Tutorial activity for Session 12
BIOB111_CHBIO - Tutorial activity for Session 12 General topic for week 6 Session 12 Lipids Useful Links: 1. Animations on Cholesterol (its synthesis, lifestyle factors, LDL) http://www.wiley.com/college/boyer/0470003790/animations/cholesterol/cholesterol.htm
More informationMetabolism of glycosaminoglycans in CCl 4 -induced liver regeneration
J. Biosci., Vol. 14, Number 2, June 1989, pp. 163 172. Printed in India. Metabolism of glycosaminoglycans in CCl 4 -induced liver regeneration V. S. UNNIKRISHNAN and P. R. SUDHAKARAN* Department of Biochemistry,
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationPLASMA LIPOPROTEINS AND LIPIDS DETERMINATION OF PLASMA CHOLESTEROL AND TRIGLICERIDE LEVEL
PLASMA LIPOPROTEINS AND LIPIDS DETERMINATION OF PLASMA CHOLESTEROL AND TRIGLICERIDE LEVEL Lipids are characterized by low polarity and limited solubility in water. Their plasma concentration is about 500-600
More informationPhospholipids of ethambutol-susceptible and resistant strains of Mycobacterium smegmatis
J. Biosci., Vol. 13, Number 3, September 1988, pp. 243 248. Printed in India. Phospholipids of ethambutol-susceptible and resistant strains of Mycobacterium smegmatis MONIKA SAREEN and G. K. KHULLER* Department
More informationTRANSPORT OF AMINO ACIDS IN INTACT 3T3 AND SV3T3 CELLS. Binding Activity for Leucine in Membrane Preparations of Ehrlich Ascites Tumor Cells
Journal of Supramolecular Structure 4:441 (401)-447 (407) (1976) TRANSPORT OF AMINO ACIDS IN INTACT 3T3 AND SV3T3 CELLS. Binding Activity for Leucine in Membrane Preparations of Ehrlich Ascites Tumor Cells
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More informationInhibition of hepatocyte apob secretion by naringenin: enhanced rapid intracellular degradation independent of reduced microsomal cholesteryl esters
Inhibition of hepatocyte apob secretion by naringenin: enhanced rapid intracellular degradation independent of reduced microsomal cholesteryl esters Nica M. Borradaile,* Linda E. de Dreu,* P. Hugh R. Barrett,
More informationChapter VIII: Dr. Sameh Sarray Hlaoui
Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationCHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS
28 09/16/2013 17:44:40 Page 415 APTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents
More informationApoB100, synthesized in the liver, is an essential structural
ApoB100 Secretion From HepG2 Cells is Decreased by the ACAT Inhibitor CI-1011 An Effect Associated With Enhanced Intracellular Degradation of ApoB Lisa J. Wilcox, P. Hugh R. Barrett, Roger S. Newton, Murray
More informationGeneral Biochemistry-1 BCH 202
General Biochemistry-1 BCH 202 1 I would like to acknowledge Dr. Farid Ataya for his valuable input & help in this course. 2 Outline Lipids Definition, function, fatty acids, classification: simple lipids:
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
More informationOxiSelect Human Oxidized LDL ELISA Kit (OxPL-LDL Quantitation)
Product Manual OxiSelect Human Oxidized LDL ELISA Kit (OxPL-LDL Quantitation) Catalog Number STA-358 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipoproteins are submicroscopic
More informationEffect of phospholipase-d on rat kidney mitochondria*
J. Biosci., Vol. 1, Number 1, March 1979, pp. 75 82. Printed in India. Effect of phospholipase-d on rat kidney mitochondria* S. N. A. ZAIDI, A. C. SHIPSTONE and N. K. GARG Division of Biochemistry, Central
More informationLipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
More informationStimulation of fatty acid biosynthesis by dietary cholesterol and of cholesterol synthesis by dietary fatty acid
Stimulation of fatty acid biosynthesis by dietary cholesterol and of cholesterol synthesis by dietary fatty acid Thomas V. Fungwe, James E. Fox, Lauren M. Cagen, Henry G. Wilcox, and Murray Heimberg' Departments
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationSTRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty
STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE OF LIPIDS AND LIPOPROTEINS DEFINTITION: Compounds Insoluble in water But
More informationBiosynthesis of Triacylglycerides (TG) in liver. Mobilization of stored fat and oxidation of fatty acids
Biosynthesis of Triacylglycerides (TG) in liver Mobilization of stored fat and oxidation of fatty acids Activation of hormone sensitive lipase This enzyme is activated when phosphorylated (3,5 cyclic AMPdependent
More informationMetabolism of echitamine and plumbagin in rats
J. Biosci., Vol. 3, Number 4, December 1981, pp. 395-400. Printed in India. Metabolism of echitamine and plumbagin in rats B. CHANDRASEKARAN and B. NAGARAJAN Microbiology Division, Cancer Institute, Madras
More informationIncreased Cholesterol-Ester Formation during Forced Cholesterol Synthesis in Rat Hepatocytes
Eur. J. Biochem. 51, 337-342 (1975) Increased Cholesterol-Ester Formation during Forced Cholesterol Synthesis in Rat Hepatocytes Wke NILSSON Department of Physiological Chemistry, University of Lund (Received
More informationCHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS
HAPTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents and their insolubility
More informationHuman LDL Receptor / LDLR ELISA Pair Set
Human LDL Receptor / LDLR ELISA Pair Set Catalog Number : SEK10231 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in
More informationTurnover of Individual Cholesterol Esters in Human Liver and Plasma*
Journal of Clinical Investigation Vol. 45, No. 7, 1966 Turnover of Individual Cholesterol Esters in Human Liver and * P. J. NESTEL t AND E. A. COUZENS (From the University of Melbourne Department of Medicine,
More informationReduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows
FULL PAPER Biochemistry Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows Hisami NAKAGAWA-UETA 1) and Norio KATOH 2) * 1) Ishikawa
More informationControl of ornithine decarboxylase activity in jute seeds by antizyme
J. Biosci., Vol. 15, Number 2, June 1990, pp. 83-91. Printed in India. Control of ornithine decarboxylase activity in jute seeds by antizyme MALABIKA PANDIT and BHARATI GHOSH Department of Botany, Bose
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationProteases in germinating finger millet (Eleusine coracana) seeds
Biosci., Vol. 5, Number 3, September 1983, pp. 219 224. Printed in India. Proteases in germinating finger millet (Eleusine coracana) seeds Introduction U. VIDYAVATHI, B. SHIVARAJ and T. N. PATTABIRAMAN
More informationFactors to Consider in the Study of Biomolecules
Factors to Consider in the Study of Biomolecules What are the features of the basic building blocks? (ex: monosaccharides, alcohols, fatty acids, amino acids) 1) General structure and functional groups
More informationLecithin Cholesterol Acyltransferase (LCAT) ELISA Kit
Product Manual Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Catalog Number STA-616 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol
More informationByung Hong Chung 1, * and Nassrin Dashti
Lipolytic remnants of human VLDL produced in vitro: effect of HDL levels in the lipolysis mixtures on the apocs to apoe ratio and metabolic properties of VLDL core remnants Byung Hong Chung 1, * and Nassrin
More informationOptimization of a Pravastatin Quantification Method Using HPLC with Ultraviolet Detection in Human Serum for Monitoring Dyslipidemic Patients
Journal of Liquid Chromatography & Related Technologies w, 31: 667 674, 2008 Copyright # Taylor & Francis Group, LLC ISSN 1082-6076 print/1520-572x online DOI: 10.1080/10826070701853784 Optimization of
More informationFunctional changes in rat liver trna following aflatoxin Β 1 administration
J. Biosci., Vol. 3 Number 3, September 1981, pp. 215-219 Printed in India. Functional changes in rat liver trna following aflatoxin Β 1 administration R. K. BHATTACHARYA and V.S. ABOOBAKER Biochemistry
More informationLipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels
Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital
More informationLIPIDS OF PHYSIOLOGICAL SIGNIFICANCE
LIPIDS OF PHYSIOLOGICAL SIGNIFICANCE Original slides. Important. 436 Notes 438 notes Extra information رابط التعديل: https://docs.google.com/document/d/1wvdec1atp7j- ZKWOUSukSLsEcosjZ0AqV4z2VcH2TA0/edit?usp=sharing
More informationIn vitro formation of thyroid hormones from 3,5-diiodothyronine by supernatant of submaxillary gland
J. Biosci., Vol. 3 Number 3, September 1981, pp. 239-248. Printed in India. In vitro formation of thyroid hormones from 3,5-diiodothyronine by supernatant of submaxillary gland MITALI GUHA, RATHA N. HATI
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
More informationANSC/NUTR 618 Lipids & Lipid Metabolism
I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.
More informationBringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health
Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive
More informationFATTY ACIDS COMPOSITION OF FISH, LINSEED AND RAPESEED OILS
Short Communication FATTY ACIDS COMPOSITION OF FISH, LINSEED AND RAPESEED OILS S. Ezhil Valavan 1, B Mohan, P Selvaraj, S. C. Edwin, K. Mani, R. Amutha and A. Bharathidhasan Directorate of Distance Education
More informationHuman Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General
Human Oxidized LDL ELISA Kit (MDA-LDL Quantitation), General For the detection and quantitation of human OxLDL in plasma, serum or other biological fluid samples Cat. No. KT-959 For Research Use Only.
More informationLipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationSEASONAL CHANGES OF AVOCADO LIPIDS DURING FRUIT DEVELOPMENT AND STORAGE
California Avocado Society 1968 Yearbook 52: 102-108 SEASONAL CHANGES OF AVOCADO LIPIDS DURING FRUIT DEVELOPMENT AND STORAGE Yoshio Kikuta Present address: Department of Botany, Faculty of Agriculture,
More informationParticipation of Endogenous Fatty Acids in Ca 2+ Release Activation from Mitochondria
Gen. Physiol. Biophys. (1985), 4, 549 556 549 Participation of Endogenous Fatty Acids in Ca 2+ Release Activation from Mitochondria B. I. MEDVEDEV, E. P. SEVERINA, V. G. GOGVADZE, E. A. CHUKHLOVA and Yu.
More informationInfluence of capsaicin, curcumin and ferulic acid in rats fed high fat diets*
J. Biosci., Vol. 12, Number 2, June 1987, pp. 143 152. Printed in India. Influence of capsaicin, curcumin and ferulic acid in rats fed high fat diets* M. R. SRINIVASAN and M. N. SATYANARAYANA** Department
More informationMetabolic fate of oleic acid, palmitic acid and stearic acid in cultured hamster hepatocytes
Biochem. J. (1996) 316, 847 852 (Printed in Great Britain) 847 Metabolic fate of oleic acid, palmitic acid and stearic acid in cultured hamster hepatocytes Jennifer S. BRUCE and Andrew M. SALTER* Department
More informationAN OVERVIEW OF FATTY ACID ETHYL ESTERS
AN OVERVIEW OF FATTY ACID ETHYL ESTERS Michael Laposata, M.D., Ph.D. Director of Clinical Laboratories Massachusetts General Hospital Professor, Harvard Medical School OUTLINE OF PRESENTATION Background
More informationOxiSelect Human Oxidized LDL ELISA Kit (MDA- LDL Quantitation)
Product Manual OxiSelect Human Oxidized LDL ELISA Kit (MDA- LDL Quantitation) Catalog Number STA- 369 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipoproteins are
More informationVery-low-density-lipoprotein secretion by isolated hepatocytes of fat-fed rats
Biochem. J. (1981) 198, 373377 Printed in Great Britain 373 Verylowdensitylipoprotein secretion by isolated hepatocytes of fatfed rats AthinaDespina KALOPISSIS, Sabine GRIGLIO, MarieIrene MALEWIAK, Raymond
More informationab SREBP-2 Translocation Assay Kit (Cell-Based)
ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationHepG2 cell LDL receptor activity and the accumulation of apolipoprotein B and E in response to docosahexaenoic acid and cholesterol
HepG2 cell LDL receptor activity and the accumulation of apolipoprotein B and E in response to docosahexaenoic acid and cholesterol Mary Sorci-Thomas,' Cynthia L. Hendricks, and Mary W. Kearns Department
More informationChemistry Chapter 21
Chemistry 2100 Chapter 21 Lipids Fa3y Acids CH oleic acid (mp 4 C) CH stearic acid (mp 70 C) Triacylglycerols Fatty Acids! The fatty acid components of triglycerides have certain things in common: 1.
More informationFig. 1 Family pedigree of Patient 1 (upper) and Patient 2 (lower).
Fig. 1 Family pedigree of Patient 1 (upper) and Patient 2 (lower). Fig. 2 Determination of cholesteryl ester net transfer rate from HDL to VLDL and LDL. Table 1 Serum lipids and apoprotein levels in the
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationacyl-coax holesterol acyltransferase in cholesterol metabolism
Role of cellular acyl-coax holesterol acyltransferase in cholesterol metabolism Keith E. Suckling* and Eduard F. Stange"' Department of Biochemistry, University of Edinburgh Medical School, * Hugh Robson
More informationSUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of
SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium
More informationLDL Uptake Flow Cytometry Assay Kit
LDL Uptake Flow Cytometry Assay Kit Item No. 601470 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationdoi: /01.ATV
Glucose Phosphorylation Is Essential for the Turnover of Neutral Lipid and the Second Stage Assembly of Triacylglycerol-Rich ApoB-Containing Lipoproteins in Primary Hepatocyte Cultures Anna-Marie Brown,
More informationMCQS ON LIPIDS. Dr. RUCHIKA YADU
MCQS ON LIPIDS Dr. RUCHIKA YADU Q1. THE FATS AND OILS ARE RESPECTIVELY RICH IN a) Unsaturated fatty acids b) Saturated fatty acids c) Saturated and unsaturated fatty acids d) None of these Q2. ESSENTIAL
More informationANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD
ANTIHYPERLIPIDEMIA Darmawan,dr.,M.Kes,Sp.PD Plasma lipids consist mostly of lipoproteins Spherical complexes of lipids and specific proteins (apolipoproteins). The clinically important lipoproteins, listed
More informationGlossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"
More informationHypersecretion of VLDL, but not HDL, by hepatocytes from the JCR:LA-corpulent rat
Hypersecretion of VLDL, but not HDL, by hepatocytes from the JCR:LA-corpulent rat Jean E. Vance* and James C. Russellt Lipid and Lipoprotein Group,* and Departments of Medicine* and Surgery,t University
More informationInteraction of lanthanum chloride with human erythrocyte membrane in relation to acetylcholinesterase activity
J. Biosci., Vol. 13, Number 2, June 1988, pp. 123 128. Printed in India. Interaction of lanthanum chloride with human erythrocyte membrane in relation to acetylcholinesterase activity SUNIL MUKHOPADHYAY,
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationRegulating Hepatic Cellular Cholesterol
Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce
More informationCholest s er e o r l o ١
Cholesterol ١ Contents of The Lecture What is Cholesterol? Structure of Cholesterol Structure of Cholesteryl Ester Normal Cholestrol Level Sources of Cholesterol What Are The Exogenous Sources Of Cholesterol?
More informationApoB is the major protein of VLDL, IDL, LDL, and
Niacin Accelerates Intracellular ApoB Degradation by Inhibiting Triacylglycerol Synthesis in Human Hepatoblastoma (HepG2) Cells Fu-You Jin, Vaijinath S. Kamanna, Moti L. Kashyap Abstract The mechanism
More informationChapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationOriginal Article Effect of Corn Oil, Olive Oil, Sheep s and Cow s Ghee on the Expression of apob Protein in Syrian Mice s Intestine and Liver
International Journal of Medical Laboratory 2015;2(1):41-49. Original Article Effect of Corn Oil, Olive Oil, Sheep s and Cow s Ghee on the Expression of apob Protein in Syrian Mice s Intestine and Liver
More informationChapter 11: Lipids. Voet & Voet: Pages
Chapter 11: Lipids Voet & Voet: Pages 380-394 Slide 1 Lipids Lipids are distinguished by their high solubility in non polar solvents and low solubility in H2O Diverse group of compounds including Fats,
More informationDr. Nafith Abu Tarboush
5 Dr. Nafith Abu Tarboush June 25 th 2013 Mohammad Abu Dosh Sheet 5.. Lipids ( Dr. Nafith ) : Classification of fatty acids : - they are classified depending on the existence of double bonds to : 1) Saturated
More informationRAT LIVER MICROSOMES can be shown to carry out. lipid synthesis on added protein. Dependence of microsomal
Dependence of microsomal lipid synthesis on added protein RUTH TZUR and B. SHAPIRO Department of Biochemistry, The Hebrew University-Hadassah Medical School, Jerusalem, Israel SUMMARY Lipid synthesis by
More informationEffect of phosphatidylcholine molecular species on the uptake of HDL triglycerides and cholesteryl esters by the liver
Effect of phosphatidylcholine molecular species on the uptake of HDL triglycerides and cholesteryl esters by the liver Hiroko Kadowaki,' George M. Patton and Sander J. Robins Division of Lipid Metabolism,
More informationHorwitz, Advances in Diet and Nutrition, MECHANISM AND EFFECT OF EXCESS COPPER SUPPLEMENTATION ON BODY LIPIDS
Horwitz, Advances in Diet and Nutrition, 1985. MECHANISM AND EFFECT OF EXCESS COPPER SUPPLEMENTATION ON BODY LIPIDS Executive Summary Rats were used in long term feeding experiments to determine the most
More informationChapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.
BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal
More informationThe lipid profile of the pallid emperor moth Cirina forda Westwood (Lepidoptera: Saturniidae) caterpillar
BIOKEMISTRI 13: 37-41 (January 2003) Printed in Nigeria The lipid profile of the pallid emperor moth Cirina forda Westwood (Lepidoptera: Saturniidae) caterpillar Adeolu.T. ANDE Department of Biological
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationThe four levels of protein structure are: primary structure, secondary structure, tertiary structure, and quaternary structure.
Proteins Proteins are organic complex nitrogenous compounds of high molecular weight, formed of C, H, O and N. They are formed of a number of amino acids linked together by peptide linkage [-CO-NH-]. Proteins
More informationPurification and characterization of chymotrypsin inhibitors from marine turtle egg white
J. Biosci., Vol. 6, Number 2, June 1984, pp. 155 163. Printed in India. Purification and characterization of chymotrypsin inhibitors from marine turtle egg white M. K. GUHA and N. K. SINHA* Department
More informationGlossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
More informationBIOCHEMISTRY ond MOLECULAR BIOLOGY INTERNATIONAL
Vol. 44, No. 3, March 1998 BIOCHEMISTRY ond MOLECULAR BIOLOGY INTERNATIONAL Pages 515-521 SHORT-TERM EFFECT OF DEXAMETHASONE ON FATTY ACID AND CHOLESTEROL SYNTHESIS IN ISOLATED RAT t lepatocytes. Anna
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More information