Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
|
|
- Kelly Gibbs
- 6 years ago
- Views:
Transcription
1 Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg) by tail vein (n=5 males/group, 11 week old). Four days after the injection, mice were fasted for 2 h at the end of the dark cycle, and blood was collected. Plasma lipid levels were measured enzymatically as described in the Methods. () Lipoprotein profiles of Ldlr -/ mice treated with control IgG or REGN15 P<.5, P<.1. Fig. S2. Decreased VLDL-TG secretion in ngptl3 -/- and REGN15-treated mice. () ngptl3 -/- mice and littermate controls (n=5 /group, 1-13 weeks old) were fed ad libitum and VLDL secretion was measured at the end of dark cycle as described in the Methods (Right). ngptl3 -/- mice and littermate controls were synchronized for 3 days with daytime fasting (7: am-7:pm) and nighttime refeeding (7: pm-7: am) (N=4-6 males/group, 6-9 weeks). On day 4, the livers were collected after a 24-hr fast (fasted) or at the end of the dark cycle (refed). Tissue lipid levels were measured as described in the Methods (Left). () VLDL-TG secretion is reduced in REGN5-treated Ldlr -/- mice. Ldlr -/- mice were treated exactly as described in Fig. 5. lood was drawn at the indicated time after Triton WR1339 (5 mg/kg) administration. Plasma was isolated and TG was measured (n=5 males/group, 1 week old). (C) VLDL-TG secretion in fasting mice. WT mice were fasted overnight and REGN15 or control antibody was injected at 8: am. Two hours later, Triton WR1339 (5 mg/kg) was injected into the tail vein and blood was collected and plasma TG levels measured at the indicated times. (D) REGN15 decreased VLDL-TG secretion in WT mice fed a fat-free diet. The feeding of WT mice was synchronized as described in the legend to Fig.5 except that the mice were refed a fat-free diet. On day 4, mice were refed at 7: am and injected with either control antibody or REGN15 at 9: am (n=5 male mice/group, 24 weeks old). Two hours after the injection, Triton WR1339 (5 mg/kg) was injected into 1
2 the tail vein. lood samples were drawn from the tail veins at the indicated time points. Plasma was isolated and TG was measured as described in the Method. P<.5, P<.1, P<.1 Fig. S3. Fatty acid uptake and clearance in REGN15-treated mice. () TG and NEF levels in REGN15-treated mice. () Uptake of NEF in tissues of mice treated with REGN15. WT mice were entrained to a synchronized feeding regimen as described in Fig. 5. On day 4, mice were refed at 7: am and injected 2 hours later with control antibody or REGN15 (1 mg/kg) (n=5 male mice/group, 1 weeks old). fter 2 hours, blood was collected and TG and NEF were measured. Mice were then injected with 1µci 3 H-bromopalmitate and 1µci of 14 C-palmitate. Tissues were collected and analyzed as described in Methods. (C) Tritiated palmitate turnover in REGN15-treated mice. Tritiatedpalmitate complexed with fatty acid free S was infused into the tail vein of the mice over 5 min as described in the Methods. The appearance of radioactivity was monitored in blood samples obtained every min for 7 min. 2
3 Figure S1 Triglyceride (µg/fraction) WT Ldlr -/- WT Ldlr -/- WT Ldlr-/- Cholesterol (mg/dl) VLDL LDL HDL Cholesterol (µg/fraction) 4 NEF (meq/l) 8 VLDL LDL HDL po-48 (.U) Fractions po-1 (.U) Fractions
4 Figure S /+ ngptl3 -/- Hepatic Triglyceride (mg/g) 8 4 +/+ ngptl3 -/- C D E Fasted Refed
5 Figure S3 Triglyceride (mg/dl) romopalmitate Uptake (dpm x 1 3 /1 mg) NEF (meq/l) Heart Liver WT T Muscle Lung Palmitate Uptake (dpm x 1 3 /1 mg) C 14 C-Palmitate (dpm/5 µl plasma) Heart Liver WT T Muscle Lung anti-ngptl Infuse
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationBCH 447. Triglyceride Determination in Serum
BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationControl 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
More informationSupplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationTriglyceride determination
Triglyceride determination Introduction: - Triglycerides are esters of fatty acids and are hydrolyzed to glycerol and free fatty acids (by lipase) - Triglyceride determinations when performed in conjunction
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationCHAPTER IV RESEARCH METHOD. This study belongs to the field of Internal Medicine, specifically the field
CHAPTER IV RESEARCH METHOD 4.1 Research fields This study belongs to the field of Internal Medicine, specifically the field of Infectious and Tropical Disease. 4.2 Research location and period This study
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationASSUMPTIONS AND DETAILS OF CALCULATIONS FOR FATTY ACID KINETICS
1 1 1 1 1 1 0 1 ASSUMPTIONS AND DETAILS OF CALCULATIONS FOR FATTY ACID KINETICS Our hypothesis was that many sources of palmitate (NEFA, lipogenesis, diet) could contribute to newly-synthesized VLDL-TG
More informationSupplementary Information
Supplementary Information Supplementary Figures and Figure Legends Supplementary Figure 1 A. HDL-C (mg/dl) 14 12 1 8 6 4 2 Noncarriers HDL Cholesterol **** Carriers B. apoa-i (mg/dl) 325 3 275 25 225 2
More informationANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease
ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationChapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
More informationFigure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution
Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein
More informationILDR2: An Endoplasmic Reticulum Resident Molecule Mediating Hepatic Lipid Homeostasis
ILDR2: An Endoplasmic Reticulum Resident Molecule Mediating Hepatic Lipid Homeostasis Kazuhisa Watanabe 1, Elizabeth Watson 1., Maria Laura Cremona 1., Elizabeth J. Millings 1, Jay H. Lefkowitch 2, Stuart
More informationInvestigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats
J. Biosci., Vol. 12, Number 2, June 1987, pp. 137 142. Printed in India. Investigations on the mechanism of hypercholesterolemia observed in copper deficiency in rats P. VALSALA and P. A. KURUP Department
More informationSupplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups
Supplemental Table S1: Unadjusted and Adjusted Hazard Ratios for Diabetes Associated with Baseline Factors Considered in Model 3 SMART Participants Only Unadjusted Adjusted* Baseline p-value p-value Covariate
More informationTitle. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations
Title VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body Authors Hideaki Yamamoto 1, Tappei Takada 1 *, Yoshihide Yamanashi 1, Masatsune Ogura 2, Yusuke Masuo
More informationMechanism of hypercholesterolemia produced by biotin deficiency
J. Biosci., Vol. 13, Number 4, December 1988, pp. 393 399. Printed in India. Mechanism of hypercholesterolemia produced by biotin deficiency ANNIE ABRAHAM and P. A. KURUP* Department of Biochemistry, University
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationAN OVERVIEW OF FATTY ACID ETHYL ESTERS
AN OVERVIEW OF FATTY ACID ETHYL ESTERS Michael Laposata, M.D., Ph.D. Director of Clinical Laboratories Massachusetts General Hospital Professor, Harvard Medical School OUTLINE OF PRESENTATION Background
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationThe ddy mouse: a model of postprandial hypertriglyceridemia in response to dietary fat
The ddy mouse: a model of postprandial hypertriglyceridemia in response to dietary fat Tomomi Yamazaki, 1 Kyoko Kishimoto, and Osamu Ezaki 1,2 Department of Nutritional Science, National Institute of Health
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationA COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS
A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS Rosario S. Sagum, Ph.D., Mildred A. Udarbe, MSc., Trinidad P. Trinidad, Ph.D. And
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationReplacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
More informationANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
More informationDietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)
Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild
More informationTHE EFFECT OF VITAMIN-C THERAPY ON HYPERGLYCEMIA, HYPERLIPIDEMIA AND NON HIGH DENSITY LIPOPROTEIN LEVEL IN TYPE 2 DIABETES
Int. J. LifeSc. Bt & Pharm. Res. 2013 Varikasuvu Seshadri Reddy et al., 2013 Review Article ISSN 2250-3137 www.ijlbpr.com Vol. 2, No. 1, January 2013 2013 IJLBPR. All Rights Reserved THE EFFECT OF VITAMIN-C
More informationSUPPLEMENTAL CHOLINE FOR PREVENTION AND ALLEVIATION OF FATTY LIVER IN DAIRY CATTLE
SUPPLEMENTAL CHOLINE FOR PREVENTION AND ALLEVIATION OF FATTY LIVER IN DAIRY CATTLE Ric R. Grummer and Reinaldo Cooke Department of Dairy Science University of Wisconsin-Madison rgrummer@wisc.edu Fatty
More information2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries
Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global
More informationResponses of blood lipids to aerobic and resistance type of exercise
Responses of blood lipids to aerobic and resistance type of exercise Labros Sidossis, Ph.D. Laboratory of Nutrition and Clinical Dietetics Harokopio University of Athens, Greece Triacylglycerol structure
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationCt=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)
a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6
More informationNon-fasting Lipid Profile Getting to the Heart of the Matter! Medimail Dec 2017
Non-fasting Lipid Profile Getting to the Heart of the Matter! Medimail Dec 2017 Historical Basis for Fasting Lipids The initial classifications of hyperlipidemia proposed in 1967 were genetic and required
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationResearch Article Anti hyperlipidemic Activity of Costus Igneus in Triton X- 100 Induced Hyperlipidemic Rats
Research Article Anti hyperlipidemic Activity of Costus Igneus in Triton X- 100 Induced Hyperlipidemic Rats Nimmy Chacko*, Shastry CS, Prerana shetty, Prasanna Shyamma, Ullas D souza and Patel Maulika
More informationNormal cholesterol level for men over 50
Normal cholesterol level for men over 50 Understand what your cholesterol levels mean: Total, LDL, for men and 50 mg per dl their respective numbers have to stay over or under a particular level,. 24-4-2017
More informationHydrophobic Surfactant Treatment Prevents Atherosclerosis in the Rabbit
Hydrophobic Surfactant Treatment Prevents Atherosclerosis in the Rabbit RAPID PUBLICATIONS J. B. RODGERS, E. C. KYRIAKIDES, B. KAPUSCINSKA, S. K. PENG, and W. J. BOCHENEK, Department of Medicine, Albany
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationALKA VITA DIABETES TEST
ALKA VITA DIABETES TEST By PCO PreCleanOmics Indianapolis, Indiana Study Number: 4-29-1 11 Aug - 21 Sep Date of Study: 24 Animals Used in Study: ZDF-obese males Date of Birth: 17-Jun-4 Group 1 - RO H2O
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationLipid Lowering in Patients at High Risk for Cardiovascular Disease
Lipid Lowering in Patients at High Risk for Cardiovascular Disease Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Novel
More informationPlasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension
World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original
More informationWhat is Diabetes Mellitus?
Normal Glucose Metabolism What is Diabetes Mellitus? When the amount of glucose in the blood increases, After a meal, it triggers the release of the hormone insulin from the pancreas. Insulin stimulates
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationPCSK9 Inhibition: From Genetics to Patients
PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSuppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationInhibition of endothelial lipase causes increased HDL cholesterol levels in vivo
Inhibition of endothelial lipase causes increased HDL cholesterol levels in vivo See the related Commentary beginning on page 318. Weijun Jin, John S. Millar, Uli Broedl, Jane M. Glick, and Daniel J. Rader
More informationSuppression of Hepatic Lipogenesis by Pectin and Galacturonic Acid Orally-Fed at the Separate Timing from Digestion-Absorption of Nutrients in Rat
J, Nutr. Sci, Vitaminol., 29, 553-562, 1983 Suppression of Hepatic Lipogenesis by Pectin and Galacturonic Acid Orally-Fed at the Separate Timing from Digestion-Absorption of Nutrients in Rat Masashige
More informationCHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationRole of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD
Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal
More informationEbrahim Abbasi Oshaghi 1,2
1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationEFFECTS OF VIRGIN COCONUT OIL (VCO) ON THE LIPID PROFILE OF RATS (DOSE RESPONSE STUDY)
EFFECTS OF VIRGIN COCONUT OIL () ON THE LIPID PROFILE OF RATS (DOSE RESPONSE STUDY) ROSARIO S. SAGUM, Ph.D., MILDRED A. UDARBE, M.Sc, TRINIDAD P. TRINIDAD, Ph.D., and MARIO V. CAPANZANA, Ph.D. Food and
More informationReduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows
FULL PAPER Biochemistry Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows Hisami NAKAGAWA-UETA 1) and Norio KATOH 2) * 1) Ishikawa
More informationHyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi
Hyperlipidemia Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Outline The story of lipids Definition of hyperlipidemia Classification of hyperlipidemia Causes of hyperlipidemia
More informationWidespread concern about the role of SFA in heart disease: Is it justified?
Widespread concern about the role of SFA in heart disease: Is it justified? 1. What is the association of SFA intake and LDL-C? 2. Is LDL-C the best biomarker? 3. If SFA is reduced, does it matter what
More informationA Phase 3 Study of Lomitapide, a Microsomal Triglyceride Transfer Protein (MTP) Inhibitor, in Patients with Homozygous Familial Hypercholesterolemia
A Phase 3 Study of Lomitapide, a Microsomal Triglyceride Transfer Protein (MTP) Inhibitor, in Patients with Homozygous Familial Hypercholesterolemia Marina Cuchel, MD, PhD University of Pennsylvania, Philadelphia,
More informationYour Guide to Managing and Understanding Your Cholesterol Levels
Your Guide to Managing and Understanding Your Cholesterol Levels Our goal at Bon Secours is to help you be well. Our experienced Heart Team includes cardiologists, cardiovascular surgeons, electrophysiologists,
More informationNCBA Ground Beef Diet/Health Study
NCBA Ground Beef Diet/Health Study Stephen B. Smith Department of Animal Science Rosemary L. Walzem Department of Poultry Science Texas A&M University Assumptions: Corn-fed beef is healthier than pasture-fed
More informationPCSK9 RNAi Therapeutics. Kevin FitzGerald
PCSK9 RNAi Therapeutics Kevin FitzGerald Presenter Disclosure Information PSCK9 RNAi Therapeutics The following relationships exist related to this presentation:» Kevin Fitzgerald and Alnylam team members:
More informationPlasma cholesterol has been established as a predictor of
Dietary Fat Induced Alterations in Atherosclerosis Are Abolished by ACAT2-Deficiency in ApoB100 Only, LDLr / Mice Thomas A. Bell III, Kathryn Kelley, Martha D. Wilson, Janet K. Sawyer, Lawrence L. Rudel
More informationMetabolism and Atherogenic Properties of LDL
Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal
More informationMipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3
(ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,
More informationHypolipidemic effect of Terminalia arjuna (L.) in experimentally induced hypercholesteremic rats
Volume 55(2):289-293, 2011 Acta Biologica Szegediensis http://www.sci.u-szeged.hu/abs ARTICLE Hypolipidemic effect of Terminalia arjuna (L.) in experimentally induced hypercholesteremic rats R. H. Patil
More informationEPOA. Latest Insights on Palm Oil & Health. European Industry Meeting on Palm Oil Nicolette Drieduite I EPOA Project team member I Cargill 2 June 2015
EPOA Latest Insights on Palm Oil & Health European Industry Meeting on Palm Oil Nicolette Drieduite I EPOA Project team member I Cargill 2 June 2015 Summary 1. In the nineties palm oil s success was related
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationEffects of Dietary Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver
Animal Industry Report AS 661 ASL R3006 2015 Effects of Cholesterol and its Oxidation Products on Pathological Lesions and Cholesterol and Lipid Oxidation in the Rabbit Liver Sun Jin Hur Iowa State University
More information(For National Authority Use Only) Name of Study Drug: to Part of Dossier:
2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: ABT-335 Name of Active Ingredient: Page: ABT-335, A-7770335.115
More informationHepatic insulin signaling regulates VLDL secretion and atherogenesis in mice
Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han,, Domenico Accili, Alan R. Tall J Clin Invest. 2009;119(4):1029-1041. https://doi.org/10.1172/jci36523. Research
More informationNormal cholesterol levels for men over 50
Normal cholesterol levels for men over 50 The Borg System is 100 % Normal cholesterol levels for men over 50 High cholesterol doesn't usually produce any obvious symptoms so higher than ideal cholesterol
More informationKeywords: Type 2 DM, lipid profile, metformin, glimepiride ABSTRACT
Human Journals Research Article September 2015 Vol.:4, Issue:2 All rights are reserved by K. Saravanan et al. Effects of Monotherapy and Combination Therapy Involving Metformin and Glimepiride on HbA1c
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation
More informationHepatic insulin signaling regulates VLDL secretion and atherogenesis in mice
Research article Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han, Chien-Ping Liang, Marit Westerterp, Takafumi Senokuchi, Carrie L. Welch, Qizhi Wang, Michihiro
More informationPALM OLEIN BLENDING FOR TEMPERATE MARKET L/O/G/O
PALM OLEIN BLENDING FOR TEMPERATE MARKET L/O/G/O Basic Facts on Oil Palm Originated from West Africa, palm oil is the rich source of edible oil and has become important resource of vegetable oil in the
More informationJMSCR Vol 05 Issue 05 Page May 2017
www.jmscr.igmpublication.org Impact Factor 5.84 Index Copernicus Value: 83.27 ISSN (e)-2347-176x ISSN (p) 2455-0450 DOI: https://dx.doi.org/10.18535/jmscr/v5i5.193 Lipid Profile as Early Predictor of Complication
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationThe new guidelines issued in PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice
... PRESENTATIONS... Future Outlook: Changing Perspectives on Best Practice Based on a presentation by Daniel J. Rader, MD Presentation Summary The guidelines recently released by the National Cholesterol
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationFat Metabolism, Insulin and MTHFR
Fat Metabolism, Insulin and MTHFR BCAA, SAMe and ACAT Carolyn Ledowsky Overview of This Presentation 1. Fat Metabolism and MTHFR 2. SAMe and Fat Metabolism 3. Acetyl Co A and Fat Metabolism 4. How to Maintain
More information1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver)
I. TEST YOUR KNOWLEDGE OF CHOLESTEROL Choose the correct answer. 1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) 2. Only
More informationNutrition & Wellness for Life 2012 Chapter 6: Fats: A Concentrated Energy Source
Tools: Printer 8.5 x 11 paper Scissors Directions: 1. Print 2. Fold paper in half vertically 3. Cut along dashed lines Copyright Goodheart-Willcox Co., Inc. All rights reserved. Tissue in which the body
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationSupplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
More informationVI. SUMMARY. One hundred and eighty day old commercial Cobb broiler chicks. randomly divided into five groups, each comprising of 36 chicks, were
VI. SUMMARY One hundred and eighty day old commercial Cobb broiler chicks randomly divided into five groups, each comprising of 36 chicks, were used in the present study to evaluate the physiological effects
More informationDevelopment of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
More information