Supporting Online Material for
|
|
- Robyn Chapman
- 5 years ago
- Views:
Transcription
1 Supporting Online Material for Is an Anti-Inflammatory Adipokine That Modulates Metabolic Dysfunction in Obesity Noriyuki Ouchi, Akiko Higuchi, Koji Ohashi, Yuichi Oshima, Noyan Gokce, Rei Shibata, Yuichi Akasaki, Akihiko Shimono, Kenneth Walsh To whom correspondence should be addressed. (K.W.) or (N.O.) This PDF file includes Materials and Methods Figs. S1 to S11 References Published 17 June 21 on Science Express DOI: /science
2 Supporting Online Material for Is an Anti-Inflammatory Adipokine That Modulates Metabolic Dysfunction in Obesity Noriyuki Ouchi, Akiko Higuchi, Koji Ohashi, Yuichi Oshima, Noyan Gokce, Rei Shibata, Yuichi Akasaki, Akihiko Shimono, Kenneth Walsh To whom correspondence should be addressed. (K.W.); (N.O.) This PDF file includes: Materials and Methods Figs. S1 to S11 References
3 Materials and Methods Materials Phospho-Akt (Ser473), phospho-jnk (Thr183/Tyr185), phospho-cjun (Ser63), Akt, and GAPDH antibodies were purchased from Cell Signaling Technology. Phospho-IRS- 1 (Ser37) antibody was purchased from Upstate biotechnology. β-actin antibody were purchased from Sigma Chemical Co. The polyclonal antibody against mouse was generated by immunizing rabbits with two synthetic peptides conjugated to KLH through the Cys via maleimide (APTRGQEYDYYGWQAEP: amino acid residues and Acetyl-VKMRIKEIKIDNGDRKLIG: amino acid residues )(21st Century Biochemicals). SP6125 was purchased from Biomol international. Recombinant mouse Wnt5a protein produced in CHO cells (endotoxin free: <1. EU/µg protein by the LAL method) and mouse Wnt5a antibody were purchased from R&D Systems. Animal model Mice lacking were backcrossed and maintained on the C57BL6/J background. -/- mice were generated by replacing the first protein coding exon with the PGKneobpAloxA cassette as described previously (1). -/- mice and littermate wildtype () C57BL6/J mice were used. To generate mice lacking both and JNK1, -/- mice and Jnk1 -/+ mice (Jackson laboratory) were inbred. Ob/ob mice were purchased from Jackson laboratory. Zucker diabetic fatty rats and their lean littermates were purchased from Charles River Laboratories. Study protocols were approved by the Boston University Institutional Animal Care and Use Committee. Mice were fed either a normal chow diet (Harlan Teklad global 18% protein rodent diet, #218) or a HF/HS diet (Bio-Serv, #F185)(2) as indicated. The composition of the HF/HS diet was 35.8% fat (primarily lard), 36.8% carbohydrate (primarily sucrose), and 2.3% protein. For the high caloric diet feeding, mice at the age of 1 weeks were maintained on a HF/HS diet for 12 or 24 weeks. Collection of human visceral fat tissue Visceral adipose tissue was collected during gastric bypass surgery in obese adults (age 21 years) with a body mass index 3 kg/m 2 as described previously (3). Patients with unstable medical conditions such as active coronary syndromes, congestive heart failure, systemic infection, malignancy, or pregnancy were excluded. The presence or absence of macrophage crown-like structures (CLS) in adipose tissue was determined by immunohistochemical stains with CD68 in a blinded manner as described previously (3). The insulin resistance marker, homeostasis model assessment of insulin resistance (HOMA-IR) were quantified from blood samples (3). All subjects gave written, informed consent, and the study was approved by the Boston University Medical Center Institutional Review Board. Cell culture Mouse 3T3-L1 cells (ATCC) were maintained in DMEM with 1% fetal bovine serum (FBS) and differentiated into adipocytes by treatment with DMEM supplemented with 5 µg/ml of insulin,.5 mm 1-methyl-3-isobutyl-xanthin, and 1 µm dexamethazone (4). Peritoneal macrophages from lean C57BL/6 mice were maintained in DMEM
4 supplemented 1% FBS and placed in DMEM with.5% FBS for 6 h for serum starvation. Macrophages were incubated in the conditioned media from 3T3-L1 adipocytes transduced with adenoviral vectors in the presence of Wnt5a protein (2 ng/ml) or vehicle for 3 min or 24 h. In some experiments, cells were pretreated with SP6125 (15 µm) or vehicle for 1 h followed by treatment with Wnt5a protein. Construction of adenoviral vectors For transduction experiments, tetracycline-regulated adenovirus (Ad) vectors were used (5). The Ad vectors expressing β-galactosidase (β-gal) or were constructed under the control of seven consecutive tetracycline-responsive elements (TRE) and a CMV minimal promoter (AdTRE-β-gal or AdTRE-). Co-transfection of AdTRE vector with Ad vectors encoding tetracycline transactivator (tta, a fusion of TRE-binding protein and VP16 transactivation domain) under the control of the CMV promoter/enhancer (AdCMV-tTA) results in activation of transgene. Ad vectors expressing adiponectin (Ad- APN) under control of the CMV promoter was constructed as previously described (6, 7). For in vivo gene transfer, AdTRE-β-gal or AdTRE- along with AdCMV-tTA (2.5x1 8 pfu for each adenovirus) was injected into the jugular vein of mice. For some experiments, Ad-APN (5.x1 8 pfu total) was intravenously administered to mice. For in vitro transduction, differentiated 3T3-L1 adipocytes were transfected with AdTRE-β-gal or AdTRE- in the presence of AdCMV-tTA (125 MOI for each adenovirus) for 24 h. The media was then replaced with fresh DMEM, and cells were incubated for additional 24 h. Cells were treated with or without recombinant Wnt5a protein (2 ng/ml) for indicated length of time. For detection of in media, protein was concentrated 3- fold with a Microcon column. Luciferase reporter assays 3T3-L1 adipocytes were transduced with adenoviral vectors for 24 h and co-transfected with a TOPflash (Upstate) construct and a Renilla luciferase control plasmid (prl-sv4, Promega) to normalize for transfection efficiency. After transfection, cells were treated with Wnt5a protein (2 ng/ml) or vehicle. Cells were lysed and analyzed on a luminometer by using dual luciferase assay kit (Promega). Metabolic measurements Serum insulin levels were determined by ELISA (Crystal Chemical Inc.). Serum glucose levels were measured with enzymatic kits (Wako Chemicals). Glucose tolerance testing was performed on 16 h-fasted mice injected intraperitoneally with D-glucose (1 g/kg body weight)(2). Blood glucose levels were determined immediately before and 3, 6, 9, and 12 min after injection as determined by an Accu-Chek glucose monitor (Roche Diagnostics Corp.). Insulin tolerance testing was performed on 6 h-fasted mice injected intraperitoneally with human insulin (Humulin R, Eli Lilly) at U/kg body weight for lean mice or at 4.5 U/kg body weight for obese mice. Blood glucose levels were determined immediately before and 15, 3, and 6 min after injection. Insulin signaling in adipose tissues was determined by measurement of Akt phosphorylation following insulin administration. Mice were fasted overnight and treated with insulin (4.5 U/kg body weight) or saline via the inferior vena cava. Epididymal fat was isolated after 4 min, and immunoblot analysis was preformed. To determine triglyceride content of liver,
5 lipid was extracted using the Bligh-Dyer method (8). Liver tissues were homogenized in chloroform/meoh/h 2 O (1:2:.8) and centrifuged. Supernatants were collected, and equal amounts of chloroform and H 2 O were added. After vortexing and centrifugation, the chloroform layer was collected, dried completely and resuspended in isopropanol containing 1% Triton-X. Triglyceride levels were measured with enzymatic kits (Wako Chemicals). Histology The sections of epididymal adipose tissue were fixed in 1% formalin, dehydrated, and embedded in paraffin. Adipose tissue sections were stained with hematoxylin and eosin to examine the morphology and with anti-f4/8 antibody (Santa Cruz) to detect macrophages. Adipocyte cross-sectional areas were measured in 2 cells per mouse using Image J software. Macrophage accumulation was quantified by measuring the number of F4/8-positive cells per mm 2 in 2 randomly chosen microscopic fields. Liver tissues were embedded in OCT compound (Sakura Finetech USA Inc.) and snap frozen in liquid nitrogen and stained with oil red O for lipid deposition by standard methods (2). Isolation of mouse adipocyte and stromal vascular (SV) fraction Epididymal fat pads from male wild-type C57BL/6 mice fed a normal diet were excised, minced in PBS and digested with 1 mg/ml collagenase Type 1 (Worthington Chemical Corporation) at 37 C for 3 min. The digested fat tissue was filtered through a mesh and centrifuged at 1 rpm for 5 min to separate floating adipocytes from the SV fraction. Measurement of mrna levels Gene expression level was quantified by real-time PCR. Total RNA was prepared with the use of a Qiagen or Ambion kit. cdna was produced using ThermoScript RT-PCR Systems (Invitrogen). PCR was performed on icycler iq Real-Time PCR Detection System (Bio-Rad) using SYBR Green 1 as a double standard DNA specific dye (Applied Biosystems). Primers were: 5 -GAAAGTTGATTGGAGCCCAGAA-3 and 5 - GCCCGTCAGGTTGTCTAACTGT-3 for mouse, 5'- CAGCCAGATGCAGTTAACGC-3' and 5'-GCCTACTCATTGGGATCATCTTG-3' for mouse MCP-1, 5 -CTTTGGCTATGGGCTTCCAGTC-3 and 5 - GCAAGGAGGACAGAGTTTATCGTG-3 for mouse F4/8, 5 - CTTCTGCTGTGGAAATGCAA-3 and 5 -AGAGGGGCTGGTAGGTTGAT-3 for mouse CD68, 5 -TGCCATCCATGCGGAAA-3 and 5 -AGCGGGAAGAACTCCTCTTC-3 for mouse cyclind1, 5 -ATACAGGTGCCAGGAAGGTG-3 and 5 - CAAGGGCAGAAAGTTGGTGT-3 for mouse WISP2, 5'- TTGGGTCAGCACTGGCTCTG-3' and 5'-TGGCGGTGTGCAGTGCTATC-3' for mouse gp91 phox, 5'-GATGTTCCCCATTGAGGCCG-3' and 5'-GTTTCAGGTCATCAGGCCGC-3' for mouse P47 phox, 5'-ACCTATTCCTGCGTCGGTGT-3' and 5'- GCATCGAAGACCGTGTTCTC-3' for mouse GRP78, 5'- GTCCTGTCCTCAGATGAAATTGG-3' and 5'-GCAGGGTCAAGAGTAGTGAAGGTT-3' for mouse CHOP 5 -AATCAAGAACGAAAGTCGGAGG-3 and 5 - GCGGGTCATGGGAATAACG-3 for 18S, 5 -GAAGCTGGTTCTGCACATGA-3 and 5 - TTCTTGTCCCAGCGGTAGAC-3 for rat, 5 -
6 CATCTTCTCAAAACTCGAGTGACAA-3 and 5 - TGGGAGTAGATAAGGTACAGCCC- 3 for rat TNFα, 5 -CCGCTGGGACAAGAAGAATA-3 and 5 - GTAGAGGGAGCAGGGGTAGG-3 for human, 5 -CGAGTGACAAGCCTGTAGC- 3 and 5 - GGTGTGGGTGAGGAGCACAT-3 for human TNFα, 5'- CGACCTGGAAGTCCAACTAC-3' and 5'-ATCTGCTGCATCTGCTTG-3' for human 36B4 and 5'-GCTCCAAGCAGATGCAGCA-3' and 5'-CCGGATGTGAGGCAGCAG-3' for mouse or rat 36B4. Primers for mouse TNFα and mouse IL-6 were purchased from Qiagen. Western blot analysis Tissue and cell samples were homogenized, and equal amounts of proteins were separated with denaturing SDS 4-15% polyacrylamide gels. Following transfer to membranes, immunoblot analysis was performed with the indicated antibodies followed by incubation with secondary antibody conjugated with horseradish peroxidase at a 1:5 dilution. ECL Western Blotting Detection kit (Amersham Pharmacia Biotech) or ECL Advance Western Blotting Detection kit (Amersham Pharmacia Biotech) was used for detection. Relative phosphorylation or protein levels were quantified by Image J program. Statistical analysis All data are expressed as means ± SEM. Differences were analyzed by Student s unpaired t test or analysis of variance (ANOVA) for multiple comparisons. A value of P<.5 was accepted as statistically significant
7 S1 A mrna levels GAPDH WAT BAT Brain Heart Lung Liver Pancreas Kidney S. Muscle.2 B mrna levels P<.1 Adipocyte SV Figure S1: expression in various tissues in wild-type () mice. (A) Tissue distribution of mrna and protein in mice fed normal diet. mrna levels were analyzed by quantitative real-time PCR (QRT-PCR) and expressed relative to 18S levels (n=3).equal amounts of proteins were loaded, and and GAPDH protein levels were determined by immunoblot analysis. WAT, white adipose tissue; BAT, brown adipose tissue; S. Muscle, skeletal muscle. (B) transcript levels in adipocyte and stromal vascular (SV) fractions isolated from white adipose tissues of mice fed a normal diet as measured by QRT-PCR analysis and expressed relative to 36B4 (n=3).
8 S2 A 4 P<.1 2 P<.1 2. P<.1 Body weight (g) 3 2 Glucose (mg/dl) Insulin (ng/ml) Lean ZDF Lean ZDF Lean ZDF B P<.5 mrna levels TNFα mrna levels Lean ZDF P<.1 Lean ZDF Wnt5a/ protein ratio Wnt5a β-actin 4 2 Lean ZDF Lean ZDF Figure S2: Metabolic parameters and expression of and Wnt5a in fat tissue in obese Zucker diabetic fatty (ZDF) rats and lean littermates at the age of 12 weeks. (A) Body weight, serum glucose and serum insulin levels in lean and ZDF rats (mean ± SEM, n=4). (B) Expression of and Wnt5a in epididymal fat tissue in lean and ZDF rats. and TNFα transcript levels were measured by QRT-PCR analysis and expressed relative to 36B4 (mean ± SEM, n=4). Protein expression of and Wnt5a was determined by immunoblot analysis. Wnt5a/ protein ratio was determined using Image J program.
9 S3 A B mrna levels Body weight (g) P<.1 ND HF/HS (12W) P<.1 P<.1 Glucose (mg/dl) Wnt5a β-actin P<.1 ND HF/HS (12W) P<.5 Insulin (ng/ml) Wnt5a/ protein ratio P< P<.5 ND HF/HS (12W) ND HF/HS/12W HF/HS/24W C mrna levels P<.1 P<.5 TNFα P<.5 P<.5 P<.5 P<.5 gp91 phox P47 phox P<.5 P<.5 P<.1 P<.1 F4/8 CD68 P<.5 GRP78 ND HF/HS/12W HF/HS/24W P<.5 P<.5 P<.1 CHOP Figure S3: Expression of and Wnt5a and metabolic parameters in lean and obese mice. (A) Expression of and Wnt5a in epididymal fat tissue in wild-type () mice fed normal diet (ND) or high-fat/high sucrose (HF/HS) diet for 12 weeks. transcript levels were measured by QRT-PCR analysis and expressed relative to 36B4 (n=6-7). Protein expression of and Wnt5a was determined by immunoblot analysis. (B) Body weight, serum glucose and serum insulin levels in lean and obese mice (mean ± SEM, n=5-6). (C) Transcript levels of TNFα, oxidative stress markers (gp91 phox and P47 phox), macrophage markers (F4/8 and CD68) and ER stress markers (GRP78 and CHOP) in epididymal fat tissue in lean and obese mice. mice at the age of 1 week were fed ND for 12 weeks or HF/HS diet for 12 or 24 weeks. Gene expression levels were measured by QRT-PCR analysis and expressed relative to 36B4 (mean ± SEM, n=5-6).
10 S4 Crown-like structure (-) Crown-like structure (+) mrna levels P<.5 TNFα mrna levels P<.5 HOMA-IR P<.1 Figure S4: transcript levels in visceral adipose tissue in human subjects. Expression of and TNFα, and homeostasis model assessment of insulin resistance (HOMA-IR) were assessed in obese subjects with or without macrophage crown-like structures in visceral fat tissue as determined by immunohistochemical stains with CD68. Transcript levels of and TNFα were measured by QRT-PCR analysis and expressed relative to 36B4 (mean ± SEM, n=18).
11 S5 Body weight (g) P<.5 KO Food intake (kcal/day) N.S KO Glucose (mg/dl) P<.5 KO 2. P<.1 4 P< P<.5 Insulin (ng/ml) 1..5 Liver weight (g) Fat weight (g) KO KO KO Figure S5: Body weight, food intake, serum glucose, serum insulin, liver weight and fat weight in wild-type () and -/- (KO) mice after 12 weeks of HF/HS diet feeding (mean ± SEM, n=9-12).
12 S6 A B mrna levels KO P<.1 P<.1 F4/8 CD68 F4/8 CD68 ND HF/HS mrna levels KO P<.1 P<.1 P<.1 TNFα IL-6 MCP1TNFα IL-6 MCP1 ND HF/HS C mrna levels N.S CyclinD1 N.S WISP2 KO Figure S6: Expression of macrophage marker, pro-inflammatory mediator and canonical Wntrelated genes in fat tissues from wild-type () and -/- (KO) mice. (A) Gene expression of F4/8 and CD68 in epididymal adipose tissue from and KO mice receiving normal diet (ND) or HF/HS diet was quantified by QRT-PCR and expressed relative to 18S levels (mean ± SEM, n=6-7). (B) Gene expression of TNFα, IL-6 and MCP-1 in stromal vascular fraction from epididymal fat tissues of and KO mice when fed a normal diet (ND) or HF/HS diet for 12 weeks. Transcript levels were quantified by QRT-PCR and expressed relative to 18S levels (mean ± SEM, n=4). (C) Quantification of mrna levels of CyclinD1 and WISP2 in adipose tissues of and KO mice by QRT-PCR methods (mean ± SEM, n=9). Gene expression levels were presented relative to 18S levels.
13 S7 A β-gal Media Cell B TOPflash reporter activity Wnt5a N.S N.S C 2. P<.1 D 2. β-gal P<.1 IL-6 mrna levels 1..5 IL-6 mrna levels 1..5 Wnt5a Wnt5a β-gal Vehicle SP6125 Figure S7: Effect of on TOPFlash reporter activity and IL-6 expression in adipocytes. (A) Increased production of in cell lysate and media of 3T3-L1 adipocytes after overexpression of. Differentiated 3T3-L1 adipocytes were transduced with AdTRE-β-gal or AdTRE- along with AdCMV-tTA. After 48 h of transduction, cells and media were collected, and immunoblot analysis was performed. (B) Effect of on TOPFlash reporter activity. Differentiated 3T3-L1 adipocytes were transduced with AdTRE-β-gal or AdTRE- along with AdCMV-tTA for 24 h, and co-transfected with TOPflash and Renilla luciferase control constructs. At 48 h after transduction, cells were treated with Wnt5a (2 ng/ml) or vehicle for 24 h. Reporter activity was analyzed by using dual luciferase assay kit (mean ± SEM, n=6). (C) Effect of on Wnt5a-stimulated IL-6 expression in adipocytes. After 48 h of transduction with adenoviral vectors, cells were treated with Wnt5a (2 ng/ml) or vehicle for 24 h. Transcript levels were quantified by QRT-PCR and expressed relative to 36B4 levels (mean ± SEM, n=4). (D) Effect of JNK inhibitor on Wnt5a-induced IL-6 expression in adipocytes. Differentiated 3T3-L1 adipocytes were pretreated with SP6125 (15 µm) or vehicle and stimulated with Wnt5a (2 ng/ml) or vehicle for 24 h. Transcript levels were quantified by QRT-PCR and expressed relative to 36B4 levels (mean ± SEM, n=4).
14 S8 A P<.1 2. P<.5 TNFα mrna levels IL-6 mrna levels 1..5 Wnt5a Wnt5a CM-β-gal CM- CM-β-gal CM- B TNFα mrna levels P<.1 IL-6 mrna levels P<.5 Wnt5a Wnt5a Vehicle SP6125 Vehicle SP6125 Figure S8: Role of in regulation of Wnt5a-induced expression of pro-inflammatory mediators in macrophages. (A) Effect of the conditioned media from -transfected adipocytes on Wnt5astimulated cytokine expression in macrophages. Mouse peritoneal macrophages were stimulated with Wnt5a (2 ng/ml) or vehicle for 24 h in the presence of the conditioned media from 3T3-L1 adipocyte transduced with AdTRE-β-gal or AdTRE- along with AdCMV-tTA. (B) Involvement of JNK in Wnt5a-induced expression of pro-inflammatory mediators in macrophages. Peritoneal macrophages were pretreated with SP6125 (15 µm) or vehicle and stimulated with Wnt5a (2 ng/ml) or vehicle for 24 h in the presence of the conditioned media from 3T3-L1 adipocyte transduced with AdTRE-β-gal and AdCMV-tTA. Gene expression levels were quantified by QRT-PCR and expressed relative to 36B4 levels (mean ± SEM, n=4).
15 S9 A -KO Jnk1-KO /Jnk1-DKO B -KO Jnk1-KO /Jnk1-DKO Body weight (g) P<.5 P<.1 P<.1 N.S mrna levels P<.5 P<.5 P<.1 P<.1 P<.1 P<.1 TNFα IL-6 P<.5 P<.1 P<.1 MCP-1 Figure S9: Body weight and expression of pro-inflammatory mediators of fat tissue in wild-type (), -/- (-KO), Jnk1 -/- (Jnk1-KO) and -/- Jnk1 -/- (/Jnk1-DKO) mice (A) Body weight of, -KO, Jnk1-KO and /Jnk1-DKO mice maintained on a high-fat/high sucrose (HF/HS) diet for 12 weeks (mean ± SEM, n=6-1). (B) Gene expression of TNFα, IL-6 and MCP-1 in epididymal fat tissues from, -KO, Jnk1- KO and /Jnk1-DKO mice after 12 weeks of the HF/HS diet feeding. Transcript levels were quantified by QRT-PCR and expressed relative to 18S levels (mean ± SEM, n=6-7).
16 S1 A Serum β-gal B Glucose levels (mg/dl) Time (min) +β-gal KO+β-gal + KO+ Figure S1: Effect of systemic delivery of on glucose metabolism in the HF/HS diet-fed wild-type () and -/- (KO) mice. After 1 weeks of HF/HS diet feeding, and KO mice were intravenously treated with AdTRE-β-gal (2.5x1 8 pfu total) or AdTRE- (2.5x1 8 pfu total) along with AdCMV-tTA (2.5x1 8 pfu total). (A) Detection of in serum of mice following adenovirus-mediated intravenous injection of. At 1 week after treatment of mice with adenoviral vectors (β-gal or ), serum was collected. protein level in serum (1 µl) was determined by immunoblot analysis. (B) Glucose tolerance test (left) and insulin tolerance test (right) at 2 weeks after injection of adenoviral vectors (β-gal or ) (mean ± SEM, n=6-7 in each group)., P<.1 vs. corresponding β-gal treatment. Glucose levels (% of control) Time (min)
17 S11 A mrna levels ob/ob+β-gal ob/ob+ TNFα IL-6 MCP1 F4/8 CD68 B P-JNK β-actin β-gal Figure S11: Effect of systemic delivery of on gene expression of pro-inflammatory mediators and macrophage markers (A) and phosphorylation of JNK (B) in epididymal fat tissue from ob/ob mice at 2 weeks after treatment with adenoviral vectors (β-gal or ). Gene expression was quantified by QRT-PCR analysis (n=5)., P<.1 vs. β-gal treatment.
18 Supplementary References S1. W. Satoh, M. Matsuyama, H. Takemura, S. Aizawa, A. Shimono, Genesis 46, 92 (28). S2. Y. Izumiya et al., Cell Metab 7, 159 (28). S3. C. M. Apovian et al., Arterioscler Thromb Vasc Biol 28, 1654 (28). S4. N. Maeda et al., Diabetes 5, 294 (21). S5. T. Mano et al., Hum. Gene Ther. 11, 1625 (2). S6. N. Maeda et al., Nat. Med. 8, 731 (22). S7. R. Shibata et al., Nat. Med. 1, 1384 (24). S8. E. G. Bligh, W. J. Dyer, Can J Biochem Physiol 37, 911 (1959).
Sfrp5 Is an Anti-Inflammatory Adipokine That Modulates Metabolic Dysfunction in Obesity. DOI: /science
Sfrp5 Is an Anti-Inflammatory Adipokine That Modulates Metabolic Dysfunction in Obesity Noriyuki Ouchi, et al. Science 329, 454 (21); DOI: 1.1126/science.118828 This copy is for your personal, non-commercial
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationFor pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationSUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)
SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationThe antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSupplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment
More informationFigure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow
Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSupplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and
Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationWe obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan
Supplementary Methods Animal models We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan or Jackson Laboratories. All mice were housed under a 12-h light-dark cycle and allowed
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationSUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
More informationOver-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,
SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested
More informationBMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice
SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationTaylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University
Atherosclerosis Development and the Inflammatory Response of Hepatocytes to Sesame Oil Supplementation Taylor Yohe Project Advisor: Dr. Martha A. Belury Department of Human Nutrition at the Ohio State
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationProtein extraction and western blot analysis Protein extraction was performed as
ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More information1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
More informationTBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationUniversity of California, San Diego La Jolla CA 92093
AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationAdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationFigure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
More informationSupplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More information