Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Size: px
Start display at page:

Download "Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody."

Transcription

1 ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 * neuron 5 min 1 min * 3 min b DHPG perk1/2 ERK1/2 Relative level 1.2 * *.8.4 neuron min 5 min 1 min 3 min Supplementary Figure 2. The mglur1/5-mediated intracellular signaling is intact in neurons. The level of phosphorylated ERK1/2 (perk1/2) and total ERK1/2 in hippocampal neurons (a) and hippocampal neurons (b) following the treatment with mglur1/5 agonist DHPG (1 µm) was determined by Western blot. Quantifications show the relative level of perk1/2 normalized to total ERK1/2 (n=6 per group). One-way ANOVA and LSD test was used to determine p-value, * indicates p<.5 between the min group and the indicated group, one-way ANOVA followed by LSD post hoc analysis. Data are presented as mean ± SEM. 1

2 a DKO b spines/ µm dendrite 1.5 * # DKO Supplementary Figure 3. Genetic deletion of Adcy1 in mice rescues higher spine density in visual cortex. (a) Golgi staining of dendritic spines on the apical dendrites of pyramidal neurons in the visual cortex of,,, and Fmr1/Adcy1 DKO mice (n = 4 for each genotype; length of the scale bar = 1 µm). (b) Quantification of total spine number. *: p <.5 between and indicated group, one-way ANOVA followed by LSD post hoc analysis. #: p <.5 between and the indicated group, one-way ANOVA followed by LSD post hoc analysis. Data are presented as mean ± SEM. 15 P<.5 Vmax 1 5 n=16 Fmr 1 n=17 Adcy1 n=15 DKO n=18 Supplementary Figure 4. Acoustic startle response in mice. Startle responses to 12 db auditory stimulation were determined in four different mouse strains as indicated. Comparing to the mice,,, and Fmr1/Adcy1 DKO animals showed higher responses. Data are presented as mean ± SEM. 2

3 % remaining Time (min) Supplementary Figure 5. The level of NB1 at different time points during incubation with liver microsomes. a plasma concentration(ng/ml) Time (hour) b brain concentration (ng/g) Time (hour) Supplementary Figure 6. Absorption and distribution of NB1 in plasma and brain. Samples prepared from plasma or brain were subjected to LC/MS/MS with Turbo-Ionspray TM Interface in the positive ion-mode (Pharmacokinetics Core, University of Michigan). The concentration of NB1 in plasma (a) and brain (b) was determined at different time points following intraperitoneal injection. 3

4 Time in light chamber (s) vehicle vehicle NB1 NB1 Supplementary Figure 7. Effect of NB1 on behavior in light/dark test. Time spent in the lit chamber during the light/dark test was recorded for and mice injected with vehicle (, n = 11;, n = 13) or 1 mg per kg NB1 (, n = 1;, n = 15). : not significant. Data are presented as mean ± SEM. 4

5 a Number of entries 1 5 vehicle rolipram b Time in! light chamber (sec) vehicle rolipram Supplementary Figure 8. Effects of acute low dose rolipram on behavior in the light/dark test. and mice received i.p. injection of rolipram (.3 mg per kg) or vehicle. Thirty minutes after injection, mice were examined by light/dark test as described in Figure 4. Regardless of treatment, mice showed more transition between the lit and dark chamber than mice (genotype effect: F (1,29) = 8., p=.8) (a), and normal time in either lit or dark chamber (b). Rolipram does not cause significant behavioral changes in either or mice (treatment effect: F (1,29) =, p=1). : not significant. Data are presented as mean ± SEM. 5

6 3 Vehicle NB1 b Weight relative to brain Body weight (g) a 2 1 c Vehicle 4 7 Day NB Vehicle 4 NB Heart & lung Liver Kidney d NB1 Vehicle Supplementary Figure 9. There is no significant toxicity following two weeks of NB1 administration at high dose. NB1 (5 mg/kg) (n=5) or vehicle (n=3) was repeatedly administered twice per day for 14 days. (a) Body weight of mice at different days during the 2week NB1 administration. (b) Weight of heart and lung, liver, and kidney normalized to brain weight was recorded at the end of 2-week NB1 administration. (c, d) H&E staining and histology of liver (c) and kidney (d) tissues after 14 days of NB1 administration. : not significant. Data are presented as mean ± SEM. 6

7 Supplementary Figure 1. blots. blots for Fig. 1a blots for Fig. 1e DHPG neuron min 5 min 1 min 3 min blots for Fig. 1f DHPG neuron min 5 min 1 min 3 min ADCY1 13 kda ADCY1 13 kda ADCY1 13 kda β-actin 45 kda β-actin 45 kda β-actin 45 kda 7

8 blots for Fig. 2a DKO blots for Fig. 2b DKO blots for Fig. 2c DKO S6K 7 kda perk1/2 pakt 6 kda ERK1/2 ps6k kda Akt 6 kda ps6k kda blots for Fig. 3a DKO β-actin 45 kda 8

9 blots for Fig. 5b blots for Fig. 5b and 5d blots for Fig. 5d Akt 6 kda pakt 6 kda perk1/2 ERK1/2 Anti Akt and anti ERK1/2 added at the same time blots for Fig. 5c blots for Fig. 5c blots for Fig. 5c ps6k421 7 kda ps6k389 7 kda S6K 7 kda 9

10 blots for Supplementary Fig. 1 ADCY1 13 kda β-actin 45 kda blots for Supplementary Fig. 2a blots for Supplementary Fig. 2b DHPG neuron min 5 min 1 min 3 min DHPG neuron min 5 min 1 min 3 min perk1/2 perk1/2 ERK1/2 ERK1/2 1

11 Supplementary Table 1. Effects of acute low dose rolipram on audiogenic seizures Genotype and treatment N number % wild running % clonic/tonic seizure % death + vehicle vehicle rolipram rolipram Audiogenic seizures were induced by 12 db auditory stimulation 3 min after rolipram (.3 mg per kg) or vehicle (1% kolliphore) injection. The percentage of different seizure-related phenotypes including wild running, clonic/tonic seizures, and death is shown. Chi-square test reveals significant genotype effect (p=.4 for wild running; p=.1 for clonic/tonic seizure; p=.3 for death) but no rolipram effect (p=.842 for wild running; p=.745 for clonic/tonic seizure; p=.936 for death). 11

12 Supplementary Table 2. Long-term effects of NB1 Control NB1 Urea Nitrogen (mg/dl) ± ±.87 Sodium (mmol/l) ± ±1.5 Potassium (mmol/l) 4.77 ± ±.22 Chloride (mmol/l) ± ±.85 Total CO2 (mmol/l) 13. ± ±1.4 Anion Gap (mmol/l) 35. ± ±2.36 Na/K Ratio ± ±1.47 Osmolarity (mos/l) 321. ± ±4. Glucose (mg/dl) ± ±8.5 Calcium (mg/dl) 8.6 ± ±.2 Phosphorus (mg/dl) 7.37 ± ±.24 Magnesium (mg/dl) 3.33 ± ±.11 Iron (ug/dl) 17. ± ±4.5 Albumin (g/dl) 2.8 ± ±.13 ALT (U/L) ± ±.96 AST (U/L) 4.33 ± ±1.55 ALP (U/L) 72. ± ±4.48 Amylase (U/L) ± ±29.2 Chol (mg/dl) ± ±5.96 Hemolysis Chem Normal Normal Lipemia Chem Normal Normal Icterus Chem Normal Normal Blood test results following 14 days of NB1 administration. Vehicle or NB1 at 5 mg per kg (n=5) was given twice per day for 14 days, after which blood samples were collected. ALT: alanine aminotransferase, AST: aspartate aminotransferase, ALP: alkaline phosphatase. Data are presented as mean ± SEM. 12

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain. Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,

More information

Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of

Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of phosphatidylserine and phosphatidylcholine. The instrinsic

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the P-gp expression (% of control) 12 1 8 6 4 2 * * Untreated SipA SipA/pSipA WT Supplementary Figure 1. SipA modulates the expression of P-gp in healthy murine intestinal epithelium in vivo. Salmonella Typhimurium

More information

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by Supplemental Figure 1 Selected ES cell clones show a correctly recombined conditional Ngn3 allele Genotype analysis by Southern blots of nine independent recombinated ES cell clones by hybridization with

More information

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood

More information

Fig. S1. High K+ increases intracellular calcium level.

Fig. S1. High K+ increases intracellular calcium level. Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence

More information

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,

More information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

VITROS MicroSlide Assay Summary

VITROS MicroSlide Assay Summary ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Supplemental Table I

Supplemental Table I Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr. 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

EFFECT OF AN ALUMINUM SUPPLEMENT ON NUTRIENT DIGESTIBILITY AND MINERAL METABOLISM IN THOROUGHBRED HORSES

EFFECT OF AN ALUMINUM SUPPLEMENT ON NUTRIENT DIGESTIBILITY AND MINERAL METABOLISM IN THOROUGHBRED HORSES K.A. Roose et al. 119 EFFECT OF AN ALUMINUM SUPPLEMENT ON NUTRIENT DIGESTIBILITY AND MINERAL METABOLISM IN THOROUGHBRED HORSES K. A. ROOSE, K. E. HOEKSTRA, J. D. PAGAN, R. J. GEOR Kentucky Equine Research,

More information

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected

More information

ACCREDITATION DOCUMENT

ACCREDITATION DOCUMENT Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation

More information

Evaluation of new MiniCollect Z Serum (Separator) Tubes

Evaluation of new MiniCollect Z Serum (Separator) Tubes Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube

More information

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University 1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;

More information

Supplementary Figure 1

Supplementary Figure 1 Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor

More information

Serodos and Serodos plus

Serodos and Serodos plus Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype Supplementary Table 1. Location of lens opacification in Aldh1a1(-/-), Aldh3a1(-/-) single and Aldh1a1(-/-)/Aldh3a1(-/-) double knockout mice (DKO) at different ages. A. One to three months of age Genotype

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Fig. 1: TBR2+ cells in different brain regions.

Supplementary Fig. 1: TBR2+ cells in different brain regions. Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

Supplementary Fig. 1

Supplementary Fig. 1 PDK1-dependent quenching of TACE shedding activity in prion and Alzheimer s diseases Mathéa Pietri, Caroline Dakowski, Samia Hannaoui, Aurélie Alleaume-Butaux, Julia Hernandez-Rapp, Audrey Ragagnin, Sophie

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure

More information

Seeing is not Believing (13-Nov-2004)

Seeing is not Believing (13-Nov-2004) In: 55th Annual Meeting of the American College of Veterinary Pathologists (ACVP) & 39th Annual Meeting of the American Society of Clinical Pathology (ASVCP), ACVP and ASVCP (Eds.) Publisher: American

More information

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

LNA-mediated silencing of microrna-122 in African green monkeys

LNA-mediated silencing of microrna-122 in African green monkeys LNA-mediated silencing of microrna-122 in African green monkeys Supplementary information for Elmen and Lindow et al. February 25, 2008 This document contains details about the clinical parameters measured

More information

perk/erk STAT5B

perk/erk STAT5B pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin

More information

Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.

Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. (a) Western blotting analysis showing degradation of

More information

Analyte Specimen Demographic Reference Range Units

Analyte Specimen Demographic Reference Range Units Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3

More information

Learning Objectives. Disclosures. Self Assessment Questions. Background

Learning Objectives. Disclosures. Self Assessment Questions. Background Association of Hyperuricemia with Liver Dysfunction amongst Adults with Metabolic Disorders in the United States: A Cross Sectional Study Disclosures Dr. Prashant Sakharkar and Dr. Subrata Deb declare(s)

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Excretion. Consumption = Growth + (Metabolism + SDA) + F(egestion) + U (excretion) Energetics Processes. Hormonal Control

Excretion. Consumption = Growth + (Metabolism + SDA) + F(egestion) + U (excretion) Energetics Processes. Hormonal Control Excretion Consumption = Growth + (Metabolism + SDA) + F(egestion) + U (excretion) Energetics Processes Hormonal Control Ingestion Storage Lipid Carbohydrate Mobilization Lipid Carbohydrate Protein Adsorption

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range 5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Rodent Behavioral Learning and Memory Models. From Mechanisms of Memory, 2 nd Edition by J. David Sweatt, Ph.D.

Rodent Behavioral Learning and Memory Models. From Mechanisms of Memory, 2 nd Edition by J. David Sweatt, Ph.D. Rodent Behavioral Learning and Memory Models From Mechanisms of Memory, 2 nd Edition by J. David Sweatt, Ph.D. Hippocampal Pyramidal Neuron of Mice and Rats Figure 1 Open Field Apparatus Open Field Behavior

More information

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1: immunoprecipitation with anti-casr antibody The Casr protein was expressed in transiently transfected HEK cells. Cell lysates from HEK cells were subjected

More information

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

ROUTINE LAB STUDIES. Routine Clinic Lab Studies ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination

More information

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo. Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05772 SUPPLEMENTARY INFORMATION Supplemental figure 1. Enrichment facilitates learning. a. Images showing a home cage and a cage used for environmental enrichment (EE). For EE up to

More information