Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling

Size: px
Start display at page:

Download "Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling"

Transcription

1 Reeived 7 Fe 1 Aepted 14 May 1 Pulished 1 Jun 1 DOI: 1.138/nomms195 Impaired thermogenesis and adipose tissue development in mie with fat-speifi disruption of insulin and IGF-1 signalling Jeremie Bouher 1, Marelo A. Mori 1,, Kevin Y. Lee 1, Graham Smyth 1, Chong Wee Liew 1, Yazmin Maotela 1,, Mihael Rourk 1, Matthias Bluher, Steven J. Russell 1 & C. Ronald Kahn 1 Insulin and insulin-like growth fator 1 (IGF-1) have important roles in adipoyte differentiation, gluose tolerane and insulin sensitivity. Here to assess how these pathways an ompensate for eah other, we reated mie with a doule tissue-speifi knokout of insulin and IGF-1 reeptors to eliminate all insulin/igf-1 signalling in fat. These mie had markedly dereased white and rown fat mass and were ompletely resistant to high fat diet-indued oesity and age- and high fat diet-indued gluose intolerane. Energy expenditure was inreased in mie despite a > 85% redution in rown fat mass. However, mie were unale to maintain ody temperature when plaed at 4 C. Brown fat ativity was markedly dereased in mie ut was responsive to β3-reeptor stimulation. Thus, insulin/igf-1 signalling has a ruial role in the ontrol of rown and white fat development, and, when disrupted, leads to defetive thermogenesis and a paradoxial inrease in asal metaoli rate. 1 Setion on Integrative Physiology and Metaolism, Joslin Diaetes Center and Department of Mediine, Brigham and Women s Hospital and Harvard Medial Shool, Boston, Massahusetts 15, USA. Department of Mediine, University of Leipzig 413 Leipzig, Germany. Present addresses: Department of Biophysis. Federal University of São Paulo. São Paulo, Brazil (M.A.M.); Instituto de Neuroiología, Universidad Naional Autonoma de Mexio, Queretaro 763, Mexio (Y.M.). Correspondene and requests for materials should e addressed to C.R.K. ( .ronald.kahn@joslin.harvard.edu). nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

2 nature ommuniations DOI: 1.138/nomms195 Oesity, that is, exess ody fat, is assoiated with the development of metaoli disorders suh as type diaetes, hyperlipidemia and ardiovasular disease and fatty liver 1. Oesity results from an imalane etween energy expenditure and energy intake resulting in a positive energy alane. White adipose tissue (WAT) is the main energy storage organ in the ody, whereas rown adipose tissue (BAT) is an essential omponent of energy expenditure y dissipating energy as heat through unoupled respiration mediated y unoupling protein 1 (UCP1). While BAT persists after irth in small mammals, its presene in humans was thought to e limited to neworns. However, reent studies using positron emission tomography (PET) imaging have shown that BAT is present in adult humans and is funtionally ative 6. Both white and rown adipose tissue development and expansion our through differentiation of preadipoytes into adipoytes, as well as storage and moilization of lipids. Many pararine and endorine fators ontrol adipose tissue development 7. Among them, insulin and IGF-1 have an essential role in stimulating ell proliferation, differentiation and lipid aumulation 8,9. Both insulin reeptors (IR) and IGF-1 reeptors (IGF1R) are present in preadipoytes and adipoytes, with more IGF1R in preadipoytes and more IR in adipoytes 1 1. While insulin and IGF-1 ind preferentially to their ognate reeptors, we have shown that IR and IGF1R an at as idential portals in the regulation of gene expression and adipoyte differentiation in preadipoytes 1. Thus, when the IR 13,14 or IGF1R 15 is inativated in adipose tissue, the other memer of this reeptor family an take over part or all of its funtions. In the present study, we have investigated the role of insulin and IGF-1 signalling in adipose tissue y reating mie laking the IR and IGF1R in oth white and rown adipose tissues y gene targeting using a Cre reominase driven y the adipose-speifi ap promoter. We show that Fat-speifi IGF1R and IR KO () mie are resistant to age-assoiated and diet-indued oesity and the assoiated gluose intolerane. Even more striking is the almost omplete asene of BAT and dramati old sensitivity in these mie. Nonetheless, these mie exhiit inreased asal energy expenditure. Thus, insulin and IGF-1 signalling have a ruial role in ontrolling white and rown fat development, adipoyte metaolism and thermogenesis. Results mie show redued white and rown adipose tissues. To investigate the overlapping signalling reated y insulin and IGF-1, we reated mie with a omined tissue-speifi knokout of the insulin and IGF-1 reeptors (IR/IGF1R) in fat y reeding mie with IR and IGF1R floxed alleles with mie arrying an ap promoter-cre transgene. On normal how, ody weight of male mie was dereased y 16% at 4 weeks, and this inreased to a 4% redution y 1 year of age (Fig. 1a). Epididymal and inguinal fat pad weights at 4 months were dereased y 4% and 53%, respetively (Fig. 1). Even more striking was the > 85% redution in BAT (Fig. 1). Weights of other tissues were unhanged (Supplementary Fig. S1a). There was no differene in ell size in the perigonadal or suutaneous WAT etween and ontrol mie, indiating that the derease in fat mass was due to fewer, not smaller, white adipoytes (Fig. 1,d). On the other hand, there was a redution in lipid ontent in BAT from mie (Fig. 1) and a 17.% derease in ell diameter, indiating a derease in oth ell numer and ell size in this depot. Lean mass was dereased y 1% in mie, ut slightly inreased when normalized to total ody weight, indiating that the derease in ody weight oserved in mie was mostly attriuted to a derease in fat mass (Supplementary Fig. S1). Skeletal musle weights were not different etween ontrol and mie (Supplementary Fig. S1), ut femur length was dereased in mie y 6% suggesting a mild growth defet (Supplementary Fig. S1d). White adipose tissue at 6 weeks old was redued y ~% in mie, a 5 Body weight (g) Weeks PG SC BAT PG (g) SC (g).6.. BAT (g) d % PG aipoytes % SC adipoytes < >1 Diameter (µm) < >1 Diameter (µm) Figure 1 mie have redued adiposity. (a) Body weight of male ontrol and mie fed a how diet. Results are mean ± s.e.m. of 8 15 animals/group. () Lower panels show perigonadal (PG), inguinal suutaneous (SC), and rown adipose tissue (BAT) depot weights in 4 month old ontrol and male mie fed a how diet. Results are mean ± s.e.m. of animals/group. Upper panels show representative fat pads. Sale ar = 1 m. () Hematoxylin and eosin stained setions of adipose tissues from male ontrol and at 4 months of age on a how diet. Sale ar = 1 µm. (d) Diameter distriution of isolated PG and SC adipoytes from 4 month old ontrol and male mie. Data represent the distriution from ~4, adipoytes from 4 ontrol and 4 mie. Statistial signifiane assessed y two-tailed Student s t-test, P <.5. nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

3 nature ommuniations DOI: 1.138/nomms195 ARTICLE a d.9 Gluose (mg dl 1 ) 16 Fed Fasted Gluose (mg dl 1 ) 3 1 Gluose (mg dl 1 ) min min Insulin (ng ml 1 ) min e Gluose infusion rate (mg kg 1 min 1 ) Gluose utilization (mg kg 1 min 1 ) Hepati gluose prodution asal (mg kg 1 min 1 ) f Gluose uptake (%) WAT EDL Soleus TA Figure mie are proteted against age-assoiated gluose intolerane. (a) Fed and fasted lood gluose levels in 1 year old ontrol and male mie. Results are mean ± s.e.m. of 7 8 animals/group. () Intraperitoneal gluose tolerane test and () Insulin tolerane test performed in 1 year old ontrol and male mie. Results are mean ± s.e.m. of 7 8 animals/group. (d) First phase insulin seretion in 1 year old male ontrol and mie. Results are mean ± s.e.m. of 1 animals/group. (e) Gluose infusion rate, gluose utilization, and hepati gluose prodution in the asal state, were measured during an hyperinsulinemi-euglyemi lamp. Results are mean ± s.e.m. of 4 ontrol and 5 mie. (f) Insulin-stimulated 14 C--deoxygluose uptake was assessed in perigonadal WAT, extensor digitorum longus (EDL), soleus and tiialis anterior (TA) skeletal musles, during the final 45 min of the hyperinsulinemi-euglyemi lamp. Results are mean ± s.e.m. of 4 ontrol and 5 mie. Statistial signifiane assessed y two-tailed Student s t-test, P <.5. whereas intersapular BAT was dereased y 84% (Supplementary Fig. Sa,). IR and IGF1R messenger RNA levels in the remaining WAT and BAT and isolated WAT adipoytes of mie were dereased 3 6% ompared with ontrol, with no hange in other tissues (Supplementary Fig. S3). mie are proteted against gluose intolerane. In 4-month old mie, fed and fasted gluose and insulin levels (Supplementary Fig, S4a,), and gluose tolerane (Supplementary Fig. S4) were all similar etween ontrol and mie. However, y 1 year of age fasting gluose (Fig. a) and gluose tolerane was etter in mie than ontrols (Fig. ). This ourred without any differene in insulin sensitivity as measured y insulin tolerane test (Fig. ) or gluose-stimulated insulin seretion (Fig. d). However, the gluose infusion rate required to maintain euglyemia during a hyperinsulinemi euglyemi lamp was 5% higher in than in ontrols, indiating an inrease in insulin sensitivity (Fig. e). Insulin-stimulated whole-ody gluose disposal was also inreased y 51% in mie; this was paralleled y an inrease in asal endogenous gluose prodution (Fig. e). Insulin-stimulated gluose uptake assessed during the lamp using 14 C--deoxygluose was dereased y 5% in white adipose tissue from mie, ut inreased y fold in skeletal musle (Fig. f) indiating that the etter gluose tolerane of mie is due to inreased gluose uptake in musle. mie are proteted against HFD-indued oesity. When hallenged with a high fat diet (HFD) for 4 months, ontrol mie rapidly developed oesity with a 75% inrease in ody weight, while mie were ompletely proteted from HFD-indued weight gain (Fig. 3a). Aordingly, perigonadal and inguinal adipose tissues in mie were markedly redued to 8 and 8% of those in ontrol mie after the HFD (Fig. 3). Adipoyte ell size was again not different etween ontrol and mie indiating that mie are proteted from oesity y having redued adipoyte numer. BAT mass in HFD-fed mie was also redued y 83% when ompared with ontrols and showed redued lipid ontent (Fig. 3). Adipoyte lipid ontent reflets a alane etween synthesis, whih is dependent on gluose uptake y gluose transporter 4 (GLUT4) and fatty aid synthase (FAS), and triglyeride reakdown, dependent on hormone sensitive lipase (HSL) and adipoyte triglyeride lipase (ATGL). In perigonadal fat, there was no differene in FAS, GLUT4, HSL or ATGL expression etween ontrol and mie fed either a how or HFD (Fig. 3). There was also no differene in expression of these genes in suutaneous adipose tissue fed a how diet. However, there were 58 76% redutions of FAS, GLUT4, HSL and ATGL in suutaneous fat from HFD-fed mie ompared with ontrol. FAS, GLUT4, HSL and ATGL were also dereased y 4 85% in BAT from mie on either how or HFD (Fig. 3). Consistent with the differene in weight gain, gluose tolerane worsened in ontrol mie on HFD, ut remained unhanged in mie (Fig. 4a). This ourred without improvement in insulin sensitivity as measured y insulin tolerane test (Fig. 4) or differene in gluose-stimulated insulin seretion (Fig. 4). Random-fed insulin levels, however, were elevated sixfold in mie after HFD ompared with ontrols, possily ontriuting to the improved gluose tolerane (Tale 1). Cirulating levels of adiponetin, leptin and resistin were dereased y 4, 6 and 65% in nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

4 nature ommuniations DOI: 1.138/nomms195 a Body weight (g) PG mrna level CD -CD -HFD -HFD PG (g) Weeks FiGIRKO SC (g) 1 FiGIRKO BAT (g) FiGIRKO SC mrna level FAS GLUT4 HSL ATGL FAS GLUT4 HSL ATGL PG SC BAT BAT mrna level FAS GLUT4 HSL ATGL Figure 3 mie display resistane to HFD-indued oesity and gluose intolerane. (a) Body weight of ontrol and mie fed a HFD for 16 weeks. Results are mean ± s.e.m. of 6 animals/group. () Adipose tissue weights (upper panel) and representative hematoxylin and eosin stained setions (lower panel) from perigonadal (PG), inguinal suutaneous (SC), and rown adipose tissue (BAT) from 6 month old ontrol and male mie fed a HFD for 4 months. Results are mean ± s.e.m. of 6 animals/group. Sale ar = 1 µm () Fas, Glut4, HSL and ATGL mrna aundane was measured y real time PCR in perigonadal (PG), suutaneous (SC), and rown (BAT) adipose tissues in male ontrol and mie fed either a how diet (CD) or HFD. Results are mean ± s.e.m. of 6 animals/group. Statistial signifiane assessed y two-tailed Student s t-test, P <.5. mie ompared with ontrol mie (Tale 1), onsistent with the redued expression of these genes in perigonadal and suutaneous adipose (Supplementary Fig. S5a). Oesity is often assoiated with hepati steatosis. Analysis of livers from ontrol mie on HFD revealed a 3.5-fold inrease in lipid ontent ompared with mie fed regular how (1.3 ±.17 versus 3.61 ±.99 mg triglyeride per 1 mg liver). Livers from mie on HFD were % heavier and aumulated 1.9 times more lipid than ontrol mie (Fig. 4d,e). Serum triglyeride and free fatty aid levels also trended to e elevated in mie on HFD, whereas holesterol levels and irulating levels of TNFα, IL6 and PAI-1 were similar (Tale 1). As expeted, HFD resulted in inreases in inflammatory markers (TNFα, MCP1 and F4/8) in oth perigonadal and suutaneous WAT of ontrol mie. Interestingly, there was a similar inrease in expression of these genes in adipose tissue (Supplementary Fig. S5). Thus, mie on HFD develop inflammatory hanges in adipose tissues ompared to those of ontrol despite the muh smaller fat pad size. Inreased energy expenditure in mie. Alterations in ody weight are the alane etween energy intake and energy expenditure. Food intake was similar etween ontrol and mie fed either how or HFD, suggesting that the redution in adipose mass was due to inreased energy expenditure (Fig. 5a). Indeed, oxygen onsumption rates assessed y indiret alorimetry revealed a 15% inrease in VO per gram of lean ody weight in mie on a how diet (Supplementary Fig. S4d). This ourred with no hange in spontaneous ativity (Fig. 5). Indiret alorimetry performed in a separate ohort of mie, fed a HFD from 6-to-1 months of age, onfirmed a omplete resistane to diet-indued oesity (Fig. 5; Supplementary Fig. S6a,). Energy expenditure was again inreased in mie ompared with ontrol mie y 13 14% during the dark yle and 7 8% during the light yle on standard how and HFD (Fig. 5d), with no differene in respiratory exhange ratio etween ontrol and mie (Fig. 5e). Together, these results indiate that the dereased fat mass oserved in mie was due to a omination of a derease in the numer of adipoytes and an inrease in energy expenditure. Dereased adipoyte differentiation in mie and ells. Adipoyte differentiation depends on the regulation of a transriptional regulatory asade involving PPARγ and proteins from the C/EBP family. In perigonadal fat, expression of C/EBPα and C/EBPβ, as well as the adipoyte marker ap, was unhanged in mie ompared with ontrols on oth how and HFD, whereas PPARγ expression was redued y ~4% in fat of HFD-fed mie. In suutaneous fat, PPARγ, C/EBPα, C/EBPβ and nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

5 nature ommuniations DOI: 1.138/nomms195 ARTICLE a 6 Gluose (mg dl 1 ) Gluose (mg dl 1 ) Insulin (ng ml 1 ) min min min ap were all dereased to 7% in mie fed either how or HFD (Supplementary Fig. S5). For BAT, the derease in these adipoyte differentiation genes was even more pronouned, with all four genes downregulated to 9% in how diet or HFD-fed mie (Fig. 6a). To etter understand the redution in adipose tissue mass and expression of key differentiation fators in fat, we investigated the effet of knokout of the IR and IGF1R genes in rown preadipoytes in vitro 16. Eight days after indution of differentiation, wild-type (WT) ells aumulated aundant lipid droplets that stained with Oil Red O (Fig. 6). By ontrast, no lipid aumulation was apparent in the IR and IGF1R doule knokout (DKO) ells, indiating that insulin/igf-1 signalling is ritial for adipoyte differentiation. Addition of either the PPARγ agonist rosiglitazone or the rown adipogenesis induer BMP-7 (ref. 17) were unale to resue the lak of differentiation oserved in DKO ells. This differene in adipoyte differentiation was also apparent in measurement of expression of adipoyte markers, whih inreased progressively at d Liver (g) e 1 TG (mg per 1 mg) CD HFD Figure 4 mie display resistane to HFD-indued gluose intolerane. (a) Intraperitoneal gluose tolerane, () insulin tolerane and () gluose stimulated insulin seretion tests were performed in 6 month old ontrol and male mie fed a HFD for 4 months. Results are mean ± s.e.m. of 6 animals/group. (d) Liver weight (upper panel) and representative hematoxylin and eosin stained setion (lower panels) from 6 month old male ontrol and mie fed a HFD for 4 months. Results are mean ± s.e.m. of 6 animals/group. Sale ar = 1 µm. (e) Liver triglyeride ontent in 6 month old male ontrol and mie fed either a how diet (CD) or a HFD. Statistial signifiane assessed y two-tailed Student s t-test, P <.5 etween ontrol and mie, P <.5 etween CD and HFD. Tale 1 Serum parameters in how diet or HFD-fed ontrol and mie. Insulin (ng ml 1 ) IGF-1 (ng ml 1 ) TG (mg dl 1 ) FFA (meq ml 1 ) Cholesterol (mg dl 1 ) Leptin (ng ml 1 ) Resistin (ng ml 1 ) Adiponetin (µg ml 1 ) TNFα (pg ml 1 ) PAI-1 (ng ml 1 ) IL6 (pg ml 1 ) Chow diet High-fat diet.86 ±.1.98 ± ± ± ± ± ± 47 4 ± 9 67 ± ± 1 89 ± ± ± ±.17 4 ±.5.7 ± ± 5 19 ± ± ± ±.8.7 ±.4.8 ± ± ±.1 1. ±.7.74 ±.8. ±.8.3 ± ± ± 1. ± ± ±.3 4. ± ±.6.95 ±.14.8 ± ± ± ± ±.1 9. ± ±. Cirulating onentrations were measured in ontrol and male mie fed a regular how diet or HFD for 4 months (6 1 animals per group) in the fed state. Results are mean ± s.e.m. Statistial signifiane assessed y two-tailed Student s t-test, P <.5 etween ontrol and mie. the mrna and protein level in WT ells, ut failed to e indued in DKO ells (Fig. 6,d). As expeted, PPARγ and C/EBPα mrnas oth inreased y > -fold in WT ells during adipoyte differentiation. By ontrast, PPARγ and C/EBPα did not inrease in DKO ells, indiating that insulin/igf-1 signalling ats upstream of C/EBPα and PPARγ to indue adipoyte differentiation (Fig. 6d), most likely on C/EBPβ and C/EBPδ (refs 18,19). C/EBPβ and C/EBPδ mrna inreased -fold rapidly after indution of differentiation oth in WT and DKO ells (Supplementary Fig. S7). This was onfirmed at the protein level (Fig. 6e). However, C/EBPβ phosphorylation at threonine 188, whih leads to DNA inding and transativation of C/EBPα and PPARγ genes,1, was signifiantly redued in DKO ells, oth under asal onditions and after addition of the indution oktail (Fig. 6f). However, ellular loalization of C/EBPβ and δ was normal in DKO ells ompared with WT ells. Thus, insulin and IGF-1 signalling have a ritial role in adipoyte differentiation, ontrolling C/EBPβ phosphorylation and ativation upstream of C/EBPα and PPARγ. Impaired thermogenesis in mie. Although BAT is involved in thermogenesis, asal ody temperature was similar etween ontrol and mie (Supplementary Fig. S8a) raised at ~1 C. However, when put in a 4 C environment, mie were unale to maintain their ody temperature. Thus, whereas ontrol mie dropped their ody temperature y only 3.5 C after 9 min under these onditions, mie dropped their ody temperature y 1.6 C, and all mie had to e removed from the old efore h owing to a drop of their ody temperature elow 5 C (Fig. 7a). By ontrast, mie with a fat-speifi insulin reeptor KO (FIRKO mie) that have a 5% redution in BAT mass 14 and mie with a fat-speifi knokout of the IGF1R that have normal BAT mass showed normal thermoregulation at 4 C (Supplementary Fig. S8,). This defet was due to the major redution nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

6 nature ommuniations DOI: 1.138/nomms195 a Food intake (g/g LBM per day) Body fat (g) Body weight (g) CD -HFD -CD -HFD CD HFD Weeks on diet Weeks on diet Loomotor ativity d VO (ml per kg LBM per h) e 1, 1, , 5,5 5, 4,5 4, RER Dark yle CD HFD VO (ml per kg LBM per h) 5, Light yle 4,5 4, 3,5 3, CD HFD Dark yle Light yle Light yle Dark yle RER CD HFD CD HFD Figure 5 Inreased energy expenditure in mie. (a) Daily food intake was measured in how diet (CD) or HFD-fed ontrol and male mie. Mie were housed individually and food weight was measured 3 times a week for onseutive weeks. For eah mouse daily food intake was averaged and results are mean ± s.e.m. of 6 8 animals/group. () Spontaneous ativity was measured in ontrol and male mie fed a how diet during 48 h. Results are mean ± s.e.m. of 1 animals/group. () Body weight and ody fat ontent assessed y nulear magneti resonane were measured weekly in 6 month old ontrol and male mie fed a how diet or HFD for another 4 months. Results are mean ± s.e.m. of 6 animals/group. (d) Oxygen onsumption (VO ) and (e) respiratory exhange ration (RER) were analysed y indiret alorimetry in 1 month old ontrol and male mie fed a how diet or a HFD for 4 months. Results are mean ± s.e.m. of 6 animals/group. Dark phase is the 1h period of day during whih the lights were off. Statistial signifiane assessed y two-tailed Student s t-test, P <.5. in BAT mass in mie, as well as a derease in expression of genes involved in thermogenesis and various BAT markers. Thus, BAT from mie had a 4% derease in UCP1 mrna levels ompared with ontrol (Fig. 7), and this was paralleled y 41 75% dereases in PGC1α, PRDM16, Tfam, Nrf1, UCP3 and etaadrenergi reeptors Adr1, and 3 (Fig. 7; Supplementary Fig. S8d). Interestingly, expression of other BAT markers, suh as Dio, Elovl3 and Cox, was not hanged in BAT from mie ompared with ontrol (Supplementary Fig. S8d), indiating that BAT from mie has some alterations in differentiated funtion, ut not a omplete failure of differentiation. To determine BAT ativity and its ativation y β-adrenergi stimulation in vivo, we performed 18 F-fluorodeoxygluose (FDG) positron-emission tomographi and omputed tomographi (PET/CT) sans in ontrol and mie efore and after intraperitoneal injetion of the seletive β3 adrenergi reeptor agonist CL Under asal onditions, FDG uptake was five times higher in BAT from ontrol mie ompared with mie (Fig. 7d). One hour after CL31643 injetion, FDG uptake inreased 1.9-fold in BAT of ontrol mie, and 5.-fold in BAT from mie, ut uptake in mie was still redued y 45% ompared with stimulated ontrols. When adjusted for the size differenes in intersapular rown fat etween the ontrol and knokout mie, total FDG uptake was 35 and 13 times higher in BAT from ontrol mie ompared with mie under asal and CL31643-ativated onditions, respetively (Fig. 7d). Thus, BAT from mie is dramatially redued ompared with BAT from ontrol mie, ut is still responsive to β3 adrenergi stimulation. We also measured gene expression in white and rown adipose tissues of mie injeted with CL After 3 h, UCP1 mrna levels inreased 45-fold and fourfold in PG and SC white adipose tissues of ontrol mie, ut not in BAT, proaly eause of the already extremely high UCP1 expression level in this tissue (Fig. 7e). In mie, CL31643 indued an even greater inrease in UCP1 with 175-fold and -fold inreases in PG and SC, respetively. Similarly, CL31643 indued an inrease in PGC1α and Elovl3 mrna levels in adipose tissues of oth ontrol and mie. These results indiate that asene of insulin and IGF-1 signalling nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

7 nature ommuniations DOI: 1.138/nomms195 ARTICLE a CONTROL-CD -CD CONTROL-HFD -HFD + TZD + BMP ap PPARγ C/EBPα C/EBPβ WT DKO WT DKO FAS GLUT4 UCP1 C/EBPα PPARγ C/EBPβ kda Days WT DKO 55 d FAS mrna C/EBPα mrna 15 1 WT 5 DKO GLUT4 mrna PPARγ mrna UCP1 mrna 1,5 1, PGC1α mrna 5, Days Days e C/EBPα C/EBPβ C/EBPδ WT DKO h kda kda 4 f 7 Cytoplasmi Nulear 4 4 WT DKO WT DKO WT DKO WT DKO Hours P C/EBPβ C/EBPβ C/EBPδ Lamin A/C SOD4 Figure 6 Adipoyte differentiation is impaired in DKO rown preadipoytes. (a) ap, PPARγ, C/EBPα and C/EBPβ mrna aundane was measured y real time PCR in BAT from ontrol and male mie fed either a how or a HFD. Results are mean ± s.e.m. of 6 animals/group. () Oil Red O staining of WT and DKO rown preadipoyte ells differentiated for 8 days in the presene or in the asene of the thiazolidinedione rosiglitazone (1 µm) or one morphogeneti protein 7 (1 nm). A right field mirosopy piture of the differentiated ells is also shown. Sale ar = 1 µm () Protein levels measured y western lot in WT and DKO ells efore or, 4 and 8 days after indution of the differentiation. One representative lot from 3 independent experiments is shown. (d) mrna aundane was measured y real time PCR in WT and DKO ells during the differentiation proess efore or, 4 and 8 days after indution of the differentiation. Results are mean ± s.e.m. of 4 independent experiments. (e) Protein levels measured y western lot in WT and DKO ells during the first 3 days of differentiation. One representative lot from 3 independent experiments is shown. (f) Phosphorylation of C/EBPβ on Thr188, and C/EBPβ and δ levels were measured in WT and DKO ells in ytoplasmi and nulear extrats, oth in asal onditions and 4 h after the start of adipogeni onversion. One representative lot from 3 independent experiments is shown. Statistial signifiane assessed y two-tailed Student s t-test, P <.5. in fat does not prevent the inreased expression of genes involved in old-indued thermogenesis. Thus, the old sensitivity oserved in mie is likely due to the dramati redution in BAT mass and alteration in expression of key thermogeni genes, rather than an asene of indution of old-indued stimulated genes. However, other potential mehanisms for the old sensitivity suh as dereased free fatty aid supply, dereased skeletal musle aility to shiver or impaired heart or lung funtion annot e exluded. Systemi rown adipoytes differ from the disrete or preformed intersapular BAT depot in their developmental origin,3. They are found mixed in white fat and etween musle undles 4, arise from different progenitors than the ells giving rise to the preformed BAT, and are induile y β3-adrenergi reeptor stimulation and old exposure. Daily injetions of CL31643 for weeks led to formation of systemi rown adipoytes within PG and SC white adipose tissue in ontrol mie, as indiated y the inrease in rown fat markers, histology and UCP1-immunostaining of fat from treated mie (Supplementary Fig. S9a,). Interestingly, mie also aumulated newly formed rown adipoytes in PG and SC adipose tissue depots to a similar extent than in ontrol mie, indiating that while insulin/igf-1 signalling is essential for preformed BAT formation, this pathway seems to e less important in the differentiation of systemi rown fat. Disussion Insulin and IGF-1 at through highly homologous reeptors to initiate their funtions on metaolism and growth. Although insulin and IGF-1 an have distint physiologial roles, at the ellular level, they regulate many of the same signalling pathways. We have previously shown that the IR and IGFR have similar effets in regulating nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

8 nature ommuniations DOI: 1.138/nomms195 a Temperature ( C) min UCP1 mrna 4, 3,, 1, PG SC BAT d %FDG in BAT per mouse %FDG per mm 3 BAT Saline CL31643 e UCP1 mrna (fold hange) PGC1α mrna (fold hange) mrna levels UCP1 PGC1α PRDM16 Tfam Nrf1 Adr PG SC BAT Figure 7 mie are extremely old sensitive. (a) Retal temperature was measured in 4 month old ontrol and male mie every 3 min for h after exposure to a 4 C environment (n = 9 per group). () UCP1 mrna aundane was measured y real-time PCR in PG, SC and BAT in 4 month old male ontrol and mie. () mrna aundane was measured y real-time PCR in BAT from 4 month old ontrol and male mie. Results are mean ± s.e.m. of 6 animals/group. (d) and mie were anesthetized and injeted with 18-FDG. One hour after FDG injetion, whole ody PET-CT sans were performed and the intersapular area was analysed to measure FDG uptake in BAT. The experiment was repeated 1 h after injetion of CL31643 (1 µg/g ody weight) intraperitoneally. Results are mean ± s.e.m. of animals/group. Right panel show threedimensional reonstrution images of ontrol and mie after FDG injetion in the asal state. (e) UCP1, PGC1α and Elovl3 mrna aundane was measured y real time PCR in PG, SC and BAT in 4 month old ontrol and male mie injeted with either saline or CL31643 (1 µg/g ody weight) intraperitoneally. Results are mean ± s.e.m. of 5 animals/group and are expressed as fold hange over the saline group. Statistial signifiane assessed y two-tailed Student s t-test, P <.5 etween ontrol and mie, P <.5 etween saline and CL31643 treated group. Elovl3 mrna (fold hange) 1 1 gene expression in preadipoytes, with the main differene etween insulin and IGF-1 effets eing due to a modulation in amplitude of the signal reated y the speifi ligand reeptor interation 1. To understand the role of omplementary ations of insulin and IGF-1 in fat metaolism and development, we reated mie with a omined knokout of IR and IGFR in fat using Cre reominase under the ontrol of the adipoyte-speifi ap promoter. The resulting mie exhiit redued ody weight, redued white adipoyte numer, and an almost omplete asene of BAT with dramati sensitivity to old exposure. Nonetheless, these mie are ompletely proteted from age- and HFD-indued oesity and gluose intolerane, at least in part, owing to inreased energy expenditure and inreased gluose uptake in skeletal musle. From the data, it seems that these hanges ourred with only a partial knokdown of IR and IGF1R, eause the mrna levels of these two reeptors in different fat depots were redued only 3 to 6% in mie. However, this is almost ertainly an underestimate of the effiieny of the knokout, as inativation of oth IR and IGF1R dramatially impairs adipoyte differentiation, and in vivo, we an only assess the degree of inativation in the residual adipose tissue in whih the ells may have reomined some, ut not all four, targeted alleles. This marked impairment of adipose tissue development, with some esaping ells, is onsistent with the redued numer of normal-sized adipoytes oserved in adipose tissues from mie and is more than suffiient to produe a strong whole-ody phenotype. The phenotype of the mie differs drastially from that of mie with a fat-speifi knokout of the insulin reeptor (FIRKO). Whereas oth mie have redued white fat mass, this hange is muh greater in mie, where there is a derease in ell numer ompared with FIRKO mie, where there is primarily a hange in ell size. Both FIRKO and mie are proteted against ageassoiated gluose intolerane and diet-indued oesity and gluose intolerane, and oth display inreased energy expenditure 14,5. On the other hand, mie are extremely old sensitive and unale to exhiit an adequate thermogeni response when plaed in the old, whereas FIRKO mie show normal temperature regulation, indiating that the omined inativation of the IR and IGF1R mediates some additional effets from that of IR alone on BAT development and funtion. These additional effets of the IGF1R are only oserved when omined with a deletion of the IR. Thus, mie with adipoytespeifi deletion of IGF1R only have normal BAT mass, normal temperature regulation, and even an inrease in white adipose tissue mass. The latter is part of a generalized inrease in somati growth, whih has een attriuted to inreased irulating IGF-1 in these mie 15. However, mie have normal IGF-1 levels. The redution in oth white and rown adipoyte numers in nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

9 nature ommuniations DOI: 1.138/nomms195 ARTICLE mie reflets the important and synergisti roles of insulin and IGF-1 on the ontrol of white and rown adipoyte differentiation. Both white and rown adipose tissues from mie show redutions in adipoyte differentiation markers. Furthermore, IR and IGF1R doule-knokout rown preadipoytes (DKO) fail to aumulate lipids or inrease expression of adipoyte markers after indution of differentiation. C/EBPβ phosphorylation was strongly redued in DKO ells, oth under asal onditions or after indution of differentiation, indiating that insulin and IGF-1 signalling have a ritial role in the ontrol of adipoyte differentiation via ativation and phosphorylation of C/EBPβ leading to impaired indution of C/EBPα and PPARγ. Interestingly, while insulin and IGF-1 signalling are essential for adipose development in the preformed, disrete BAT depots, they may not e required for differentiation of systemi rown adipoytes. These differenes may e due to the differential lineages of these different rown fat depots,3. This is also suggested y different moleular responses of preursors from these depots to a stimulation y a PPARγ agonist 6. It is also possile that this pool of rown preadipoytes has a low level of ap expression ompared with the preformed depot, limiting the extent of reeptor inativation in this population of ells. mie are proteted against age- and HFD-indued gluose intolerane. Interestingly, expression of inflammatory markers in adipose tissue and irulating ytokine levels are inreased in mie on high-fat diet to a similar level as in ontrol mie, ruling out redued inflammation in fat as a ause for the improved gluose tolerane oserved in these mie. Improved gluose tolerane is also not due to differenes in insulin seretion. However, insulin-stimulated gluose uptake is inreased in skeletal musle from mie, and oupled with the inreased insulin levels in HFD-fed mie, it seems likely that the etter gluose tolerane of mie is due to inreased insulin ation in skeletal musle. The most dramati finding in mie is the almost omplete asene of intersapular BAT, highlighting the ruial role for insulin/igf-1 signalling in BAT formation. BAT mass/ativity in humans is inversely orrelated with ody mass index and perent ody fat 4,7 9. Interestingly, the defet in rown fat development in mie is assoiated with inreased energy expenditure and leanness. Although surprising, this is in agreement with the phenotype oserved in UCP1-defiient mie whih are old sensitive 3 and proteted from HFD-indued oesity when raised at C (ref. 31), ut an eome oese on HFD in a thermoneutral (9 C) environment 3. This suggests that for BAT to have a role in regulating energy expenditure, the tissue must have funtional insulin and IGF-1 reeptors. Exatly how mie maintain temperature at 1 C is unlear, as mie do not show inreased systemi rown adipoytes or inreased expression of any UCP in the musle, fat or the liver. Nevertheless, at 4 C mie are unale to maintain their ody temperature, indiating that rown fat is essential for adaptative thermogenesis, similar to what has een oserved in mie with UCP1 inativation 3. However, UCP1-defiient mie an e kept at 4 C, if they are gradually adapted to the old,34, ut this is eause of shivering rather than the development of BAT-related thermogenesis,35. Cold-indued thermogenesis is mediated via the sympatheti nervous system through ativation of β-adrenergi reeptors 36,37. Despite the small BAT mass, the inrease in FDG uptake after β3 stimulation is greater in mie than ontrols. Furthermore, the β3 adrenergi agonist indued UCP1, PGC1α and Elovl3 expression in white and rown adipose tissues from oth ontrol and mie to the same extent. However, the relative amount of FDG uptake is still lower in BAT from mie in oth asal and stimulated onditions indiating that in addition to the redued BAT mass, BAT from mie is less ative. Taken together, these results highlight the ritial role of insulin and IGF-1 signalling in the ontrol of white and rown adipose tissue development and funtion, as well as the regulation of gluose metaolism and energy expenditure. Methods Animals and diets. Mie were housed in a temperature-ontrolled ( C) room on a 1 h-light/dark yle in an animal faility at the Foster Biomedial Researh Laoratory of Brandeis University in Waltham, MA, USA. All protools were approved y the Institutional Animal Care and Use Committee of the Joslin Diaetes Center and Brandeis University and were in aordane with NIH guidelines. Mie were allowed ad liitum aess to water and food. ap-cre from the Barara Kahn laoratory and doule IR and IGF1R floxed animals have een desried previously 38,39. and fat-speifi IR and IGF1R KO () mie were maintained on a mixed (C57Bl/6 19Sv) akground y reeding ap-cre IR f/f /IGF1R f/f with IR f/f /IGF1R f/f mie. Animals were maintained on a standard how diet ontaining % alories from fat, 3% from protein, and 55% from arohydrates (Mouse Diet 9F 5; PharmaServ), or sujeted to a HFD ontaining 6% alories from fat, % from protein, and % from arohydrates (OpenSoure Diet D149, Researh Diets). FIRKO mie and fat-speifi IGF-1 reeptor knokout mie (IGF-1RaPCre) have een desried previously 14,15. Adipoyte ell size. Adipoytes from perigonadal and suutaneous adipose tissue depots were disseted, mined and digested with 1 mg ml 1 ollagenase I (Worthington Biosienes) in DMEM high gluose supplemented with 1% ovine serum alumin (BSA), shaking for 3 min at 37 C. Cells were passed through a -µm filter and washed twie with DMEM high gluose plus BSA. Cells were fixed with osmium tetroxide, rinsed twie with PBS, and aliquots were used to take pitures on mirosope slides. Adipoyte diameter from ells igger than µm was determined using Image J software. At least 5 pitures representing a total of ~1, per adipose tissue depot were used. 4 ontrol and 4 mie were used, representing a total of ~5, adipoytes per group. For rown adipoyte ell size, the numer of ells/nulei was determined from hematoxylin and eosinstained setions of BAT from 4 and 4 ontrol mie. Average diameter of ells was determined for eah slide. Metaoli studies. Gluose tolerane and gluose stimulated insulin seretion tests ( g dextrose per kg ody weight, injeted intraperitoneally) were performed in unrestrained onsious mie after a 16-h overnight fast. Insulin tolerane tests ( units insulin per kg ody weight injeted intraperitoneally, Humulin R, Lilly) were performed after a h fast. Gluose levels were measured in lood olleted from the tail at the indiated times after injetion, with Infinity gluose monitors and strips (US Diagnostis). Insulin sensitivity was diretly and more preisely assessed y performing hyperinsulinemi euglyemi lamps in onsious mie as desried previously 4, with a ontinuous insulin infusion dose of.5 mu kg 1 min 1. Tissue triglyeride analysis. Lipids from liver samples were extrated with Folh solution onsisting of a mixture of :1 (v/v) hloroform/ methanol. Lipids were soluilized in 1% Triton X-1 and dried y evaporation. Triglyeride ontent was determined using Triglyeride Determination Kit (Sigma). Energy expenditure and ody omposition. For the energy expenditure studies, 1 ontrol and 1 male mie were shipped to the Vanderilt Mouse Metaoli Phenotyping Center. Oxygen onsumption (VO ), aron dioxide (VCO ) and heat prodution were measured y indiret alorimetry using the Comprehensive Laoratory Animal Monitoring System (Columus Instruments) in 6-month old animals fed a how diet. The respiratory exhange ratio (VCO / VO ) was alulated from the gas exhange data and all data were normalized to lean ody mass. Half of the animals were then plaed on a HFD for 4 months while the others remained on a how diet, and ody omposition was assessed weekly y nulear magneti resonane. VO, VCO and heat prodution were measured again at the end of the diet. Body temperature and old exposure. Body temperatures were assessed in 4-month-old mie using a RET-3 retal proe for mie (Physitemp). For the old exposure experiment, mie were housed individually and transferred to a old room with an amient temperature of 4 C. Temperature was measured every 3 min for 3 h, or until mouse ore ody temperature dropped elow 5 C. In vivo BAT Imaging y PET/CT. Mie were anaesthetized y intraperitoneal injetion of pentoarital at 75 mg kg 1. Ten minutes post-injetion of anaestheti, saline or CL31643 was injeted intraperitoneally at 1 mg kg 1. Five minutes post-injetion of drug, mie were then injeted retro-oritally with F18-FDG at 3 µci. Time and exat amount of injeted isotope was noted immediately after injetion. Two hours post-injetion of 18 F-FDG, mie were imaged y PET/CT on a NanoPET/CT (Biosan) dual modality small animal imager. Thirty minutes efore PET aquisition, all mie were given a susequent dose nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

10 nature ommuniations DOI: 1.138/nomms195 of pentoarital at 75 mg kg 1 to ensure adequate anaesthetization throughout the duration of the PET/CT san. Gene expression analysis. Total RNA was extrated from tissues with Trizol. RNA (1 µg) was reverse-transried with a high-apaity omplementary DNA (DNA) reverse transription kit (Applied Biosystems) aording to the manufaturer s instrutions. Real-time PCR was performed starting with ng of DNA and oth sense and antisense oligonuleotides (3 nm eah) in a final volume of 1 µl with the SYBR Green PCR Master Mix (Applied Biosystems). Fluoresene was monitored and analysed in an ABI Prism 79 HT sequene detetion system (Applied Biosystems). Analysis of TATA ox inding protein expression was performed in parallel to normalize gene expression. Amplifiation of speifi transripts was onfirmed y analysing melting urve profiles at the end of eah PCR. Real-time PCR primers sequenes are listed in Supplementary Tale S1. Cell ulture and adipoyte differentiation. DKO rown preadipoyte ell lines were generated from immortalized IR and IGF1R floxed rown preadipoytes infeted with an adenovirus enoding Cre reominase, as desried previously 16. Cells were maintained in DMEM (high gluose) ontaining 1% (v/v) fetal alf serum at 37 C in a 5% CO environment. Adipoyte differentiation was indued in onfluent WT or DKO preadipoytes y treating onfluent ells (day ) with an indution mixture ontaining nm insulin and 1 nm triiodothyronine,.5 mm isoutylmethylxanthine, 1 µm dexamethasone, and.15 mm indomethain for 48 h. After this indution phase (day ), ells were kept in medium ontaining insulin and triiodothyronine for the susequent 6 days, hanging the medium every days. Lipid aumulation was visualized at day 8 y oil red O staining. Cells were washed one with phosphate-uffered saline and fixed with 1% uffered formalin for 1 h. Cells were then stained with filtered oil red O solution (5 g per liter in isopropyl alohol) diluted twofold in water for 1 h at room temperature. Western lot analysis. Cells were washed one with old PBS and sraped in radioimmunopreipitation assay lysis uffer ontaining 1% SDS, 1 mm glyerophosphate, 1 mm NaF,.1 mm. sodium orthovanadate, and 1% protease inhiitor oktail (Sigma). For ytoplasmi and nulear extrats, NE-PER Nulear and Cytoplasmi Extration Reagents (Thermo Sientifi) were used aording to manufaturer s instrutions. Protein onentrations were determined with the Bradford protein assay (Bio-Rad). Lysates ( to 4 µg) were sujeted to SDS polyarylamide gel eletrophoresis (SDS PAGE). Proteins were transferred to a polyvinylidene difluoride memrane (Amersham Biosienes) and immunolotted with the appropriate antiodies. Seondary antiodies were horseradish peroxidase (HRP)-onjugated anti-rait immunogloulin G (IgG) from donkey and HRP-onjugated anti-mouse IgG from sheep (Amersham). Proteins on the memranes were visualized with SuperSignal West Pio sustrate or SuperSignal West Dura extended-duration sustrate (Piere Biotehnologies). Antiodies (with atalogue numer) to C/EBPα (s-61), C/EBPβ (s-15), C/EBPδ (s-151), GLUT4 (s-7938) and UCP1 (s-658) were purhased from Santa Cruz Biotehnologies (dilution 1/). Antiodies to Phospho-C/EBPeta (Thr188) (384) and Lamin A/C (3) were purhased from Cell Signaling (dilution 1/1,). FAS (a759) and Superoxide dismutase 4 (a16834) were purhased from Aam (dilution 1/1,). PPARγ (7-466) was purhased from Millipore (dilution 1/1,). Referenes 1. Haslam, D. W. & James, W. P. Oesity. Lanet 366, (5).. Cypess, A. M. et al. Identifiation and importane of rown adipose tissue in adult humans. N. Engl. J. Med. 36, (9). 3. Marken Lihtenelt, W. D. et al. Cold-ativated rown adipose tissue in healthy men. N. Engl. J. Med. 36, (9). 4. Saito, M. et al. High inidene of metaolially ative rown adipose tissue in healthy adult humans: effets of old exposure and adiposity. Diaetes 58, (9). 5. Virtanen, K. A. et al. Funtional rown adipose tissue in healthy adults. N. Engl. J. Med. 36, (9). 6. Zingaretti, M. C. et al. The presene of UCP1 demonstrates that metaolially ative adipose tissue in the nek of adult humans truly represents rown adipose tissue. FASEB. J. 3, (9). 7. Poulos, S. P., Hausman, D. B. & Hausman, G. J. The development and endorine funtions of adipose tissue. Mol. Cell Endorinol. 33, 34 (1). 8. Bluher, S., Kratzsh, J. & Kiess, W. Insulin-like growth fator I, growth hormone and insulin in white adipose tissue. Best. Prat. Res. Clin. Endorinol. Meta. 19, (5). 9. Tseng, Y. H., Kriauiunas, K. M., Kokkotou, E. & Kahn, C. R. Differential roles of insulin reeptor sustrates in rown adipoyte differentiation. Mol. Cell Biol. 4, (4). 1. Entingh-Pearsall, A. & Kahn, C. R. Differential roles of the insulin and insulinlike growth fator-i (IGF-I) reeptors in response to insulin and IGF-I. J. Biol. Chem. 79, (4). 11. Bak, K. & Arnqvist, H. J. Changes in insulin and IGF-I reeptor expression during differentiation of human preadipoytes. Growth Horm. IGF. Res. 19, (9). 1. Bouher, J., Tseng, Y. H. & Kahn, C. R. Insulin and insulin-like growth fator-1 reeptors at as ligand-speifi amplitude modulators of a ommon pathway regulating gene transription. J. Biol. Chem. 85, (1). 13. Guerra, C. et al. Brown adipose tissue-speifi insulin reeptor knokout shows diaeti phenotype without insulin resistane. J. Clin. Invest. 18, (1). 14. Bluher, M. et al. Adipose tissue seletive insulin reeptor knokout protets against oesity and oesity-related gluose intolerane. Dev. Cell 3, 5 38 (). 15. Kloting, N. et al. Autorine IGF-1 ation in adipoytes ontrols systemi IGF-1 onentrations and growth. Diaetes 57, 74 8 (8). 16. Bouher, J. et al. A kinase-independent role for unoupied insulin and IGF-1 reeptors in the ontrol of apoptosis. Si. Signal. 3, ra87 (1). 17. Tseng, Y. H. et al. New role of one morphogeneti protein 7 in rown adipogenesis and energy expenditure. Nature 454, 1 14 (8). 18. Wu, Z., Buher, N. L. R. & Farmer, S. R. Indution of peroxisome proliferator ativated reeptor y during onversion of 3T3-L1 firolasts into adipoytes is mediated y C/EBPB, C/EBP/d, and gluoortioids. Mol. Cell Biol. 16, (1996). 19. Yeh, W. C., Cao, Z., Classon, M. & MKnight, S. L. Casade regulation of terminal adipoyte differentiation y three memers of the C/EBP family of leuine zipper proteins. Genes. Dev. 9, (1995).. Tang, Q. Q. et al. Sequential phosphorylation of CCAAT enhaner-inding protein eta y MAPK and glyogen synthase kinase 3eta is required for adipogenesis. Pro. Natl. Aad. Si. USA. 1, (5). 1. Park, B. H., Qiang, L. & Farmer, S. R. Phosphorylation of C/EBPeta at a onsensus extraellular signal-regulated kinase/glyogen synthase kinase 3 site is required for the indution of adiponetin gene expression during the differentiation of mouse firolasts into adipoytes. Mol. Cell Biol. 4, (4).. Tseng, Y. H., Cypess, A. M. & Kahn, C. R. Cellular ioenergetis as a target for oesity therapy. Nat. Rev. Drug Disov. 9, (1). 3. Kajimura, S., Seale, P. & Spiegelman, B. M. Transriptional ontrol of rown fat development. Cell. Meta. 11, 57 6 (1). 4. Almind, K., Manieri, M., Sivitz, W. I., Cinti, S. & Kahn, C. R. Etopi rown adipose tissue in musle provides a mehanism for differenes in risk of metaoli syndrome in mie. Pro. Natl. Aad. Si. USA. 14, (7). 5. Kati, M. et al. Mitohondrial gene expression and inreased oxidative metaolism: role in inreased lifespan of fat-speifi insulin reeptor knok-out mie. Aging Cell 6, (7). 6. Petrovi, N. et al. Chroni peroxisome proliferator-ativated reeptor gamma (PPARgamma) ativation of epididymally derived white adipoyte ultures reveals a population of thermogenially ompetent, UCP1-ontaining adipoytes moleularly distint from lassi rown adipoytes. J. Biol. Chem. 85, (1). 7. Vijgen, G. H. et al. Brown adipose tissue in moridly oese sujets. PLoS. ONE. 6, e1747 (11). 8. Ouellet, V. et al. Outdoor temperature, age, sex, ody mass index, and diaeti status determine the prevalene, mass, and gluose-uptake ativity of 18F-FDG-deteted BAT in humans. J. Clin. Endorinol. Meta. 96, (11). 9. Pfannenerg, C. et al. Impat of age on the relationships of rown adipose tissue with sex and adiposity in humans. Diaetes 59, (1). 3. Enerak, S. et al. Mie laking mitohondrial unoupling protein are oldsensitive ut not oese. Nature 387, 9 94 (1997). 31. Liu, X. et al. Paradoxial resistane to diet-indued oesity in UCP1-defiient mie. J. Clin. Invest. 111, (3). 3. Feldmann, H. M., Golozouova, V., Cannon, B. & Nedergaard, J. UCP1 alation indues oesity and aolishes diet-indued thermogenesis in mie exempt from thermal stress y living at thermoneutrality. Cell. Meta. 9, 3 9 (9).. Golozouova, V. et al. Only UCP1 an mediate adaptive nonshivering thermogenesis in the old. FASEB. J. 15, 48 5 (1). 34. Ukrope, J., Anuniado, R. P., Ravussin, Y., Hulver, M. W. & Kozak, L. P. UCP1-independent thermogenesis in white adipose tissue of old-alimated Up1 / mie. J. Biol. Chem. 81, (6). 35. Shaalina, I. G. et al. Cold tolerane of UCP1-alated mie: a skeletal musle mitohondria swith toward lipid oxidation with marked UCP3 up-regulation not assoiated with inreased asal, fatty aid- or ROSindued unoupling or enhaned GDP effets. Biohim. Biophys. Ata. 1797, (1). 36. Lowell, B. B. & Spiegelman, B. M. Towards a moleular understanding of adaptive thermogenesis. Nature 44, (). 1 nature ommuniations 3:9 DOI: 1.138/nomms Mamillan Pulishers Limited. All rights reserved.

Impaired Thermogenesis and Adipose Tissue Development in Mice with Fat-Specific Disruption of Insulin and IGF-1 Signalling

Impaired Thermogenesis and Adipose Tissue Development in Mice with Fat-Specific Disruption of Insulin and IGF-1 Signalling Impaired Thermogenesis and Adipose Tissue Development in Mice with Fat-Specific Disruption of Insulin and IGF-1 Signalling The Harvard community has made this article openly available. Please share how

More information

Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence

Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2

More information

iii Neurones carry information in the form of electrical impulses. Sensory neurones carry impulses from receptors to the central nervous system.

iii Neurones carry information in the form of electrical impulses. Sensory neurones carry impulses from receptors to the central nervous system. Page 4 Coordination 1 a Brain (1); spinal ord (1) i Motor (1) i Neurones arry information in the form of eletrial impulses. Sensory neurones arry impulses from reeptors to the entral nervous system. (3)

More information

Spleen VAT FMO. Nature Immunology: doi: /ni Ki67 DX5 CD27. CD11b 2B4 KLRG1 CD69 NKG2D CXCR3 CD44 NKG2A/C/E CD62L CD103 CD94 CD48.

Spleen VAT FMO. Nature Immunology: doi: /ni Ki67 DX5 CD27. CD11b 2B4 KLRG1 CD69 NKG2D CXCR3 CD44 NKG2A/C/E CD62L CD103 CD94 CD48. IFN (% of ells) CD7 Marophages Medium NCR LPS PMA/Ionomyin CD IFN (% of ells) T ells Marophages B ells DX CD9 KLRG NKGD B CDL CD CD CXCR CD9 CD NKGA/C/E NCR Ly9h Ly9G Ly9d Ly9i Ly9/i/h FMO CD7 CD9a CD7

More information

Rho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling

Rho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling Rho-kinase Regulates Energy Balane y Targeting Hypothalami Leptin Reeptor Signaling Hu Huang 1, Dong Kong 1, Kyung Hee Byun 2, Chianping Ye 1, Shuihi Koda 1, Dae Ho Lee 1, Byung-Chul Oh 2, Sam W Lee 3,

More information

Cytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor

Cytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor Cytomegalovirus and tumor stress-surveillane y human γδ T ell reeptor inding to Endothelial Protein C Reeptor Carrie R. Willox, Vinent Pitard, Sonia Netzer, Lionel Couzi, Mahoo Salim, Toias Silerzahn,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake

The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake Plum et al., Supplementary online material The Oesity Suseptiility Gene Caroxypeptidase E Links FoxO1 Signaling in Hypothalami Pro opiomelanoortin Neurons with Regulation of Food Intake Leona Plum, Hua

More information

Supplementary Figure 1. Schematic illustrating major conclusions of this study.

Supplementary Figure 1. Schematic illustrating major conclusions of this study. ORNs GABA A GABA B glomeruli LN PNs Supplementary Figure 1. Shemati illustrating major onlusions of this study. This study represents the most diret evidene to date of inhiitory interations etween olfatory

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Learned spatiotemporal sequence recognition and prediction in primary visual cortex

Learned spatiotemporal sequence recognition and prediction in primary visual cortex Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning

More information

Mineral Oil Application Experiments: Reducing Current Season PVY

Mineral Oil Application Experiments: Reducing Current Season PVY Mineral Oil Appliation Experiments: Reduing Current Season PVY Prinipal Investigator(s). Russell L. Groves, Assistant Professor and Entomology Extension Speialist, Department of Entomology, 537 Russell

More information

Reversal of ammonia coma in rats by L-dopa: a peripheral effect

Reversal of ammonia coma in rats by L-dopa: a peripheral effect Gut, 1979, 2, 28-32 Reversal of ammonia oma in rats by L-dopa: a peripheral effet L. ZV1, W. M. DOZAK, AND R. F. DRR From the Department of Mediine, Hennepin ounty Medial enter and Minneapolis Veterans

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Figure 1. Implants derived from human embryoid body preparations contain non-cardiac structures. In early studies, infarcted hearts

Supplementary Figure 1. Implants derived from human embryoid body preparations contain non-cardiac structures. In early studies, infarcted hearts a Supplementary Figure 1. Implants derived from human emryoid ody preparations ontain non-ardia strutures. In early studies, infarted hearts reeived ell preparations of low ardia purity (

More information

WT;ATTAC-5 ** ** SkM

WT;ATTAC-5 ** ** SkM SUPPLEMENTARY INFORMATION doi:.3/nature a WT;ATTAC- H/H;ATTAC- WT;ATTAC- H/H;ATTAC- 3 weeks months GFP p Inka relative expression 3 SkM Skel. Mus. FKBP- relative expression SkM Skel. Mus. relative expression

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Supplementary Figure 1. Verification of drug infusions into the IPN. a. Representative

Supplementary Figure 1. Verification of drug infusions into the IPN. a. Representative Supplementary Figure 1. Verifiation of drug infusions into the IPN. a. Representative neutral red-stained oronal setion from a mouse with a guide annula targeting the IPN. The guide annula sar is irled

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

B2a answers B2 A DISCOVER MARTIAN LIVING! Page 70 Cells. Page 70 Specialised Cells. Page 71 Diffusion 1. Page 71 Diffusion 2

B2a answers B2 A DISCOVER MARTIAN LIVING! Page 70 Cells. Page 70 Specialised Cells. Page 71 Diffusion 1. Page 71 Diffusion 2 B2 A DISCOVER MARTIAN LIVING! B2a answers Page 70 Cells 1 a B hloroplast; C nuleus (1) A ontrols what enters and leaves the ell; D holds the ell in shape (1) Riosomes where proteins are made (1); mitohondria

More information

Partial inactivation of Ankrd26 causes diabetes with enhanced insulin responsiveness of adipose tissue in mice

Partial inactivation of Ankrd26 causes diabetes with enhanced insulin responsiveness of adipose tissue in mice Diabetologia (11) :911 9 DOI.7/s-11-3-9 ARTICLE Partial inativation of Ankrd auses diabetes with enhaned insulin responsiveness of adipose tissue in mie G. A. Raiti & T. K. Bera & O. Gavrilova & I. Pastan

More information

Supplementary Information

Supplementary Information Supplementary Information Optial ontrolling reveals time-dependent roles for adult-orn dentate granule ells Yan Gu, Maithe Arruda-Carvalho 3,4, Jia Wang, Stephen Janoshka,, Sheena Josselyn 3-5, Paul Frankland

More information

describing DNA reassociation* (renaturation/nucleation inhibition/single strand ends)

describing DNA reassociation* (renaturation/nucleation inhibition/single strand ends) Pro. Nat. Aad. Si. USA Vol. 73, No. 2, pp. 415-419, February 1976 Biohemistry Studies on nulei aid reassoiation kinetis: Empirial equations desribing DNA reassoiation* (renaturation/nuleation inhibition/single

More information

100 osimertinib. concentration of drugs (nm) Ba/F3 C797S/del19. concentration of drugs (nm) Ba/F3 C797S/T790M/L858R. relative cell vaibility (% of

100 osimertinib. concentration of drugs (nm) Ba/F3 C797S/del19. concentration of drugs (nm) Ba/F3 C797S/T790M/L858R. relative cell vaibility (% of Ba/F3 del19 Ba/F3 L858R a afatini afatini EGF-816 EGF-816 ty (% of ontrol) relative ell vaiilit elative ell vaiility (% of ontrol) 5 1 1 5 ty (% of ontrol) relative ell vaiilit 5 1 1 Ba/F3 T79M/L858R Ba/F3

More information

Pharmacological inhibition of S6K1 increases glucose metabolism and Akt signalling in vitro and in diet-induced obese mice

Pharmacological inhibition of S6K1 increases glucose metabolism and Akt signalling in vitro and in diet-induced obese mice Diabetologia (6) 9:9 6 DOI.7/s--89-6 ARTICLE Pharmaologial inhibition of K inreases gluose metabolism and Akt signalling in vitro and in diet-indued obese mie Mihael Shum & Kerstin Bellmann & Philippe

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

articles Published online: 11 March 2002, DOI: /nn823

articles Published online: 11 March 2002, DOI: /nn823 Mutant SOD1 auses motor neuron disease independent of opper haperone mediated opper loading Jamuna R. Suramaniam 1, W. Ernest Lyons 1, Jian Liu 2, Thomas B. Bartnikas 3, Jeffrey Rothstein 4,5, Donald L.

More information

Measurement of Dose Rate Dependence of Radiation Induced Damage to the Current Gain in Bipolar Transistors 1

Measurement of Dose Rate Dependence of Radiation Induced Damage to the Current Gain in Bipolar Transistors 1 Measurement of Dose Rate Dependene of Radiation Indued Damage to the Current Gain in Bipolar Transistors 1 D. Dorfan, T. Dubbs, A. A. Grillo, W. Rowe, H. F.-W. Sadrozinski, A. Seiden, E. Spener, S. Stromberg,

More information

Unit 02 - The Inside Story about Nutrition and Health. True / False

Unit 02 - The Inside Story about Nutrition and Health. True / False True / False 1. Geneti traits exert the strongest overall influene on health and longevity. False 2. The bodies of modern humans adapted to exist on a diet of wild game, fish, fruits, nuts, seeds, roots,

More information

100 μm. Axon growth cones. Tubulin (red) + scr (green)

100 μm. Axon growth cones. Tubulin (red) + scr (green) Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

between normal children and children with primary

between normal children and children with primary Arhives of Disease in Childhood, 1989, 64, 224-228 odium transport in erythroytes: differenes between normal hildren and hildren with primary and seondary hypertension M UCHIYAMA, V HAH, C E DAMAN WILLEM,

More information

Rapid, experience-dependent expression of synaptic NMDA receptors in visual cortex in vivo

Rapid, experience-dependent expression of synaptic NMDA receptors in visual cortex in vivo artiles Rapid, experiene-dependent expression of synapti NMDA reeptors in visual ortex in vivo Elizaeth M. Quinlan 1, enjamin D. Philpot 1, Rihard L. Huganir 2 and Mark F. ear 1 1 Howard Hughes Medial

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Impaired acetaldehyde oxidation in alcoholics*

Impaired acetaldehyde oxidation in alcoholics* Impaired aetaldehyde oxidation in aloholis* K R PALMR and W J JNKINSt From the Aademi Department of Mediine, Royal Free Hospital, London Gut, 1982, 23, 729-733 SUMMARY High blood aetaldehyde levels in

More information

Reading a Textbook Chapter

Reading a Textbook Chapter HENR.546x.APPBpp001-013 7/21/04 9:37 AM Page 1 APPENDIX B Reading a Textbook Chapter Copyright 2005 Pearson Eduation, In. 1 2 Read the following hapter from the ollege textbook Total Fitness: Exerise,

More information

Retraction Retracted: Study of Effect of Salvianolic Acid B on Motor Function Recovery in Rats with Spinal Cord Injury

Retraction Retracted: Study of Effect of Salvianolic Acid B on Motor Function Recovery in Rats with Spinal Cord Injury Hindawi BioMed Researh International Volume 217, Artile ID 8234878, 1 page https://doi.org/1.1155/217/8234878 Retration Retrated: Study of Effet of Salvianoli Aid B on Motor Funtion Reovery in Rats with

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a OD c. 1. 1... Time [min] 1 p

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

More information

A novel approach to regulate cell membrane permeability for ATP and NADH. formations in Saccharomyces cerevisiae induced by air cold plasma 1

A novel approach to regulate cell membrane permeability for ATP and NADH. formations in Saccharomyces cerevisiae induced by air cold plasma 1 A novel approah to regulate ell membrane permeability for ATP and NADH formations in Saharomyes erevisiae indued by air old plasma 1 Xiaoyu DONG ( 董晓宇 ), Tingting LIU ( 刘婷婷 ), Yuqin XIONG ( 熊玉琴 ) Shool

More information

% of Nestin-EGFP (+) cells

% of Nestin-EGFP (+) cells 8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

hcg PREPARATIONS have been used extensively

hcg PREPARATIONS have been used extensively 001-97X/8/5501-007$0.00/0 Journal of Clinial Endorinology and Metabolism Copyright 198 by The Endorine Soiety Vol. 55, No. 1 Printed in U.S.A. Testiular Responsiveness to Chroni Human Chorioni Gonadotropin

More information

Ubiquitin-dependent degradation of TGF-β-activated Smad2

Ubiquitin-dependent degradation of TGF-β-activated Smad2 Ubiquitin-dependent degradation of -ativated Roger S. Lo* and Joan Massagué* *Cell Biology Program, Howard Hughes Medial Institute, Memorial Sloan-Kettering Caner Center, New York, New York 10021, USA

More information

Cyclic Fluctuations of the Alveolar Carbon Dioxide Tension during the Normal Menstrual Cycle

Cyclic Fluctuations of the Alveolar Carbon Dioxide Tension during the Normal Menstrual Cycle Cyli Flutuations of the Alveolar Carbon Dioxide Tension during the Normal Menstrual Cyle Ruth L. Goodland, M.S., and W. T. Pommerenke, Ph.D., M.D. THE SHORT spa~ of funtional life of the unfertilized human

More information

Gene Symbol Chromosome Accession number T-start Polymorphism Reference. 5,10-methylenetetrahydrofolate MTHFR 1p36.22 rs Ala222Val [1] reductase

Gene Symbol Chromosome Accession number T-start Polymorphism Reference. 5,10-methylenetetrahydrofolate MTHFR 1p36.22 rs Ala222Val [1] reductase Tael T1 Genes previously shown to e involved in the metaolism of gluose and insulin. Inluded are 21 genes with a total of 30 single nuleotide polymorphisms. a Gene Symol Chromosome Aession numer T-start

More information

Methylglyoxal impairs insulin signalling and insulin action on glucose-induced insulin secretion in the pancreatic beta cell line INS-1E

Methylglyoxal impairs insulin signalling and insulin action on glucose-induced insulin secretion in the pancreatic beta cell line INS-1E Diabetologia () 5:9 95 DOI.7/s5--8-8 ARTICLE Methylglyoxal impairs insulin signalling and insulin ation on gluose-indued insulin seretion in the panreati beta ell line INS-E F. Fiory & A. Lombardi & C.

More information

clinical conditions using a tape recorder system

clinical conditions using a tape recorder system Thorax (1964), 19, 125 Objetive assessment of ough suppressants under linial onditions using a tape reorder system C. R. WOOLF AND A. ROSENBERG From the Respiratory Unit, Sunnybrook Hospital (Department

More information

Interrelationships of Chloride, Bicarbonate, Sodium, and Hydrogen Transport in the Human Ileum

Interrelationships of Chloride, Bicarbonate, Sodium, and Hydrogen Transport in the Human Ileum Interrelationships of Chloride, Biarbonate, Sodium, and Hydrogen Transport in the Human Ileum LEsLE A. TURNBERG, FREDERICK A. BIEBERDORF, STEPHEN G. MORAWSKI, and JOHN S. FORDTRAN From the Department of

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

Miles Fisher. Coronary disease DIABETES AND ATHEROGENESIS RESISTANCE AND THE METABOLIC SYNDROME

Miles Fisher. Coronary disease DIABETES AND ATHEROGENESIS RESISTANCE AND THE METABOLIC SYNDROME 336 Correspondene to: Dr Miles Fisher, Wards 4 & 5, Glasgow Royal Infirmary, Glasgow, G4 0SF, UK; miles.fisher@northglasgow. sot.nhs.uk Coronary disease DIABETES AND ATHEROGENESIS INSULIN T Miles Fisher

More information

PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT. Keywords: Medical, Optimization, Modelling, Oscillation, Noise characteristics.

PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT. Keywords: Medical, Optimization, Modelling, Oscillation, Noise characteristics. PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT Mohammad Haeri, Yashar Sarbaz and Shahriar Gharibzadeh Advaned Control System Lab, Eletrial Engineering Department, Sharif University

More information

polymorphonuclear neutrophil release of granular

polymorphonuclear neutrophil release of granular Br. J. Pharma. (1985), 86, 533-537 Phorbol myristate aetate enhanes human polymorphonulear neutrophil release of granular enzymes but inhibits hemokinesis J.R.S. Hoult & Sussan Nourshargh Department of

More information

Peroxisome proliferator-activated receptor gamma modulation and lipogenic response in adipocytes of small-for-gestational age offspring

Peroxisome proliferator-activated receptor gamma modulation and lipogenic response in adipocytes of small-for-gestational age offspring Yee et al. Nutrition & Metabolism, 9:6 RESEARCH Open Aess Peroxisome proliferator-ativated reeptor gamma modulation and lipogeni response in adipoytes of small-for-gestational age offspring Jennifer K

More information

EFFECT OF DIFFERENT METHODS OF PRESERVATION ON THE QUALITY OF CATTLE AND GOAT MEAT. Abstract

EFFECT OF DIFFERENT METHODS OF PRESERVATION ON THE QUALITY OF CATTLE AND GOAT MEAT. Abstract Bang. J. Anim. Si. 2009, 38(1&2) : 86 91 ISSN 0003-3588 EFFECT OF DIFFERENT METHODS OF PRESERVATION ON THE QUALITY OF CATTLE AND GOAT MEAT S. Bin. Faisal, S. Akhter 1 and M. M. Hossain Abstrat The study

More information

Keywords: congested heart failure,cardiomyopathy-targeted areas, Beck Depression Inventory, psychological distress. INTRODUCTION:

Keywords: congested heart failure,cardiomyopathy-targeted areas, Beck Depression Inventory, psychological distress. INTRODUCTION: International Journal of Medial Siene and Eduation An offiial Publiation of Assoiation for Sientifi and Medial Eduation (ASME) Original Researh Artile ASSOCIATION BETWEEN QUALITY OF LIFE AND ANXIETY, DEPRESSION,

More information

Exenatide versus Insulin Lispro Added to Basal Insulin in a Subgroup of Korean Patients with Type 2 Diabetes Mellitus

Exenatide versus Insulin Lispro Added to Basal Insulin in a Subgroup of Korean Patients with Type 2 Diabetes Mellitus Original Artile Others Diaetes Meta J 217;41:69-74 https://doi.org/1.493/dmj.217.41.1.69 pissn 2233-679 eissn 2233-687 DIABETES & METABOLISM JOURNAL Exenatide versus Insulin Lispro Added to Basal Insulin

More information

TNFa-induced GM-CSF release from human airway smooth muscle cells depends on activation of an ET-1 autoregulatory positive feedback mechanism

TNFa-induced GM-CSF release from human airway smooth muscle cells depends on activation of an ET-1 autoregulatory positive feedback mechanism Additional details of the methods and results, and an additional figure are published online only at http://thorax.bmj. om/ontent/vol64/issue12 1 Department of Pneumology, Clini III for Internal Mediine,

More information

a b Pml F/F Prrx1-cre f 1.4 n.s.

a b Pml F/F Prrx1-cre f 1.4 n.s. a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1

More information

Urbanization and childhood leukaemia in Taiwan

Urbanization and childhood leukaemia in Taiwan C International Epidemlologial Assoiation 1998 Printed in Great Britain International Journal of Epidemiology 199827:587-591 Urbanization and hildhood leukaemia in Taiwan Chung-Yi Li, a Ruey S Iin b and

More information

constituent amino acids in man'

constituent amino acids in man' Gut, 197, 11, 25-254 Intestinal absorption of arnosine and its onstituent amino aids in man' A. M. ASATOOR, J. K. BANDOH2, A. F. LANT, M. D. MILN, AND F. NAVAB From the Medial Unit of the Westminster Hospital,

More information

RESEARCH ARTICLE Adiponectin effects and gene expression in rainbow trout: an in vivo and in vitro approach

RESEARCH ARTICLE Adiponectin effects and gene expression in rainbow trout: an in vivo and in vitro approach 7 The Journal of Experimental iology 5, 7-8. Pulished y The Company of iologists Ltd doi:./je.6697 ESECH TICLE effets and gene expression in rainow trout: an in vivo and in vitro approah Juan Sánhez-Gurmahes,

More information

Supplementary Information Computational Methods

Supplementary Information Computational Methods Supplementary Information Computational Methods Data preproessing In this setion we desribe the preproessing steps taken to establish the data matrix of hepatoyte single ell gene expression data (Table

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

The metabolic syndrome: common origins of a multifactorial disorder

The metabolic syndrome: common origins of a multifactorial disorder Review Endorinology and Metabolism Unit, DOHaD Division, Institute of developmental Sienes, Southampton General Hospital, Southampton, UK Correspondene to: Professor C D Byrne, Endorinology and Metabolism

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Christian Carpene, Michel Berlan, and Max Lafontan

Christian Carpene, Michel Berlan, and Max Lafontan Influene of development and redution of fat stores on the antilipolyti a,-adrenoeptor in hamster adipoytes: omparison with adenosine and,&adrenergi lipolyti responses' Christian Carpene, Mihel Berlan,

More information

original article Chao-Lien Liu 1, Peiqing Ye 1, Benjamin C Yen 1 and Carol H Miao 1,2

original article Chao-Lien Liu 1, Peiqing Ye 1, Benjamin C Yen 1 and Carol H Miao 1,2 The Amerian Soiety of Gene & Cell Therapy original artile In Vivo Expansion of Regulatory T ells With IL-2/IL-2 mab Complexes Prevents Anti-fator VIII Immune Responses in Hemophilia A Mie Treated With

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

Cystic fibrosis transmembrane conductance regulator is vital to sperm fertilizing capacity and male fertility

Cystic fibrosis transmembrane conductance regulator is vital to sperm fertilizing capacity and male fertility Cysti firosis transmemrane ondutane regulator is vital to sperm fertilizing apaity and male fertility Wen Ming Xu, Qi Xian Shi, Wen Ying Chen, Chen Xi Zhou, Ya Ni, Dewi Kenneth Rowlands, Guo Yi Liu, Hu

More information

Survivin withdrawal by nuclear export failure as a physiological switch to commit cells to apoptosis

Survivin withdrawal by nuclear export failure as a physiological switch to commit cells to apoptosis Citation: (2010) 1, e57; doi:10.1038/ddis.2010.34 & 2010 Mamillan Pulishers Limited All rights reserved 2041-4889/10 www.nature.om/ddis withdrawal y nulear export failure as a physiologial swith to ommit

More information

Sequence Analysis using Logic Regression

Sequence Analysis using Logic Regression Geneti Epidemiology (Suppl ): S66 S6 (00) Sequene Analysis using Logi Regression Charles Kooperberg Ingo Ruzinski, Mihael L. LeBlan, and Li Hsu Division of Publi Health Sienes, Fred Huthinson Caner Researh

More information

Funding: MPIC/Agrochemical Industry USDA/ARS

Funding: MPIC/Agrochemical Industry USDA/ARS Evaluation and omparison of iofungiides and fungiides for the ontrol of post harvest potato tuer diseases. E. Gahango, W. W. Kirk, P. S. Wharton, R. Shafer and P. Tumalam. Department of Plant Pathology,

More information

Lung function studies before and after a work shift

Lung function studies before and after a work shift British J6urnal ofindustrial Mediine 1983;40:153-159 Lung funtion studies before and after a work shift R G LOVE From the Institute of Oupational Mediine, Edinburgh EH8 9SU, UK ABSTRAT The lung funtion

More information

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,

More information

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week

More information

Supporting information

Supporting information Supporting information Evolution of Hollow TiO 2 Nanostrutures via the Kirkendall Effet Driven y Cation Exhange with Enhaned Photoeletrohemial Performane Yanhao Yu, 1 Xin Yin, 1 Alexander Kvit, 1,2 Xudong

More information

Study of Necrosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mice

Study of Necrosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mice THE JOURNAL OF TROPICAL LIFE SCIENCE OPEN ACCESS Freely available online VOL. 3, NO. 1, pp. 58 62, January, 2013 Study of Nerosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mie Ahmad Soni,

More information

Systematic Review of Trends in Fish Tissue Mercury Concentrations

Systematic Review of Trends in Fish Tissue Mercury Concentrations Systemati Review of Trends in Fish Tissue Merury Conentrations Tom Grieb 1, Roxanne Karimi 2, Niholas Fisher 2, Leonard Levin 3 (1) Tetra Teh, In., Lafayette, CA, USA; (2) State University of New York,

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

Department of Virology, Wellcome Research Laboratories, Langley Court, Beckenham, Kent BR3 3BS, U.K. and heterologous virus challenge.

Department of Virology, Wellcome Research Laboratories, Langley Court, Beckenham, Kent BR3 3BS, U.K. and heterologous virus challenge. Journal of General Virology (1992), 73, 727-731. Printed in Great Britain 727 Comparison between in vitro neutralization titres and in vivo protetion against homologous and heterologous hallenge indued

More information

Evaluating Lead Bioavailability Data by Means of a Physiologically Based Lead Kinetic Model 1

Evaluating Lead Bioavailability Data by Means of a Physiologically Based Lead Kinetic Model 1 FUNDAMENTAL AND APPLED TOXCOLOGY 29, 63-70 (1996) Artile No. 0006 Evaluating Lead Bioavailaility Data y Means of a Physiologially Based Lead Kineti Model 1 J. POLAK,* E. J. O'FLAHERTY,* G. B. FREEMAN,!

More information

Expression and Significance of p53, Rb, p21/waf-1, p16/ink-4a, and PTEN Tumor Suppressors in Canine Melanoma

Expression and Significance of p53, Rb, p21/waf-1, p16/ink-4a, and PTEN Tumor Suppressors in Canine Melanoma Vet Pathol 39:458 472 (2002) Expression and Signifiane of p53, Rb, p21/waf-1, p16/ink-4a, and PTEN Tumor Suppressors in Canine Melanoma A. KOENIG, S. R. BIANCO, S. FOSMIRE, J. WOJCIESZYN, AND J. F. MODIANO

More information

a-4/b-1 and a-l/b-2 integrins mediate cytokine induced lung leukocyte-epithelial adhesion and injury

a-4/b-1 and a-l/b-2 integrins mediate cytokine induced lung leukocyte-epithelial adhesion and injury British Journal of Pharmaology (27) 152, 915 929 & 27 Nature Publishing Group All rights reserved 7 1188/7 $3. www.brjpharmaol.org RESEARCH PAPER a-4/b-1 and a-l/b-2 integrins mediate ytokine indued lung

More information

THE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER

THE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER J. Cell Si. 30, 117-128 (1978) Printed in Great Britain Company of Biologists Limited igys THE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER STUART HODSON

More information

ab Adipogenesis Assay Kit (Cell-Based)

ab Adipogenesis Assay Kit (Cell-Based) ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended

More information

Fasting induces a subcutaneous-to-visceral fat switch mediated by microrna-149-3p and suppression of PRDM16

Fasting induces a subcutaneous-to-visceral fat switch mediated by microrna-149-3p and suppression of PRDM16 Reeived Ot Aepted 6 Apr 6 Published May 6 DOI:.8/nomms OPEN indues a subutaneous-to-viseral fat swith mediated by mirorna-9-p and suppression of PRDM6 Hanyin Din,, Shasha Zhen,, Daniel Garia-Ruiz, Donxia

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Influenza affects elderly patients

Influenza affects elderly patients INFORMATION FOR THE PHARMACIST This artile was sponsored y Seqirus In. FLUAD (influenza vaine, adjuvanted) to Help Protet Elderly Patients Against Influenza Influenza affets elderly patients disproportionately,

More information

collagen-induced arthritis

collagen-induced arthritis Pro. Natl. Aad. Si. USA Vol. 92, pp. 517-521, January 1995 Medial Sienes Leukotriene B4 plays a ritial role in the progression of ollagen-indued arthritis R. J. GRIFFITHS*, E. R. PETrIPHER, K. KOCH, C.

More information

Recent advances in basic science BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL- LIKE RECEPTORS AND NOD2

Recent advances in basic science BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL- LIKE RECEPTORS AND NOD2 1182 Reent advanes in basi siene BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL- LIKE RECEPTORS AND NOD2 Published online first 19 April 2005 Correspondene to: Dr E Cario, University

More information

Chemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype

Chemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype hemotherapy triggers HIF-1 dependent glutathione synthesis and opper helation that indues the breast aner stem ell phenotype Haiquan Lu a, ebangshu Samanta a, Lisha Xiang a, Huimin Zhang a, Hongxia Hu

More information

Department of Medicine, University of California, Irvine, California, U.S.A.

Department of Medicine, University of California, Irvine, California, U.S.A. PPR 16 RSTRUTON O LOO LOW N TRNSCNNTL MTTON R. VNN,.. WLSON, W.R. SMT, and M. MORTON epartment of Mediine, University of California, rvine, California, U.S.. Mar ked dereases in hepati and renal blood

More information

Normal Human Blood Glucose and Insulin Levels

Normal Human Blood Glucose and Insulin Levels Presented at the COMSOL Conferene 2010 Boston Normal Human Blood Gluose and Insulin Levels In healthy humans, blood gluose levels have to be maintained in a relatively narrow range (3.5 7.0 mm, 60 130

More information

Acute transcriptional up-regulation specific to osteoblasts/osteoclasts in medaka fish

Acute transcriptional up-regulation specific to osteoblasts/osteoclasts in medaka fish 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Aute transriptional up-regulation speifi to osteoblasts/osteolasts in medaka fish immediately after exposure to mirogravity Masahiro Chatani, 1, Hiroya Morimoto,

More information