Vol. 24 No DIC CAL IVIG. cm 32.0 cm DIC. 4 1 Bil 16.5 mg dl IVIG IVIG SD IL 6
|
|
|
- Edwin Sutton
- 5 years ago
- Views:
Transcription
1 2012 Vol. 24No DIC DIC IL6 CAL IVIG DIC IVIG IVIG 1 2 IUGR APGAR ,090 g 2.0 SD 43.5 cm2.3 SD 32.0 cm 32.0 cm 4 1 Bil 16.5 mgdl SD Key wordsil
2 WBC 21,700l AST 35 IUl Neu 68.9 ALT 17 IUl Lymp 24.5 LDH 328 IUl RBC 367 l ALP 2,937 IUl Hb 11.1 gdl ChE 330 IUl Hct 32 CK 165 IUl Plt 58.9 l TBil 3.1 mgdl day 2 DBil 0.3 mgdl 1l AMY 17 IUl 32.4 mgdl TP 6.1 gdl 72.4 mgdl Alb 4.2 gdl Na 135 meql MSSA 3 K 5.1 meql Cl 104 meql Ca 8.9 mgdl UN 5.6 mgdl Cr 0.2 mgdl Glu 139 mgdl CRP 2.07 mgdl ,692 g2.0 SD 54.9 cm2.0 SD SpO 2 99room air 1 CRP 2.07 mgdl capillary refilling time 5 SpO 2 IVIG 200 mgkg CT 4 PTINR 1.69aPTT 36.9 Fib 179AT 25.0DDimer mcl DIC AT3 4 6 IVIG 1 gkg IVIG 2 gkg CRP 10 mgdl IL6 2,300 pgmlhuman IL6 CLEIA Fujirebio 4 pgml IVIG 8 2 MP30 mgkg 9 CRP 14.2 mgdlil6 113 pgml 10 CRP 11.4 mgdlil6 133 pg ml MP MP 1112 IVIG 2 g kg ml500 ml ml 90
3 2012 Vol. 24No l l l l l l l l 13 CRP 8.9 mgdlil pgml 14 CRP 5.9 mgdl IL6 332 pgml 1516 MP 17 MP CRP 2032 mgdlil pgml IVIG 2 gkg
4 D 38.3 pgml MP B CT IL6 CRP MP CT Na 114 meql Na 170 meql Na X 4 mm hanp 655 pgmlbnp 2,990 pgml Na IVIG 2 gkg P DOA P 4 DOA DOA 33 DOA RCA 4.2 mm LMT 3.4 mmlad 2.6 mmlcx 2.4 mm 63 3DCT 27 IVIG 28 IVIG 1 gkg 37.5 IL pgml 27 33,400lCRP mgdlil6 1,095 pgml 30 7,200l5.94 mgdl7.4 pg ml 15.2 gkg IgG PE 30 3,550 mgdl IgG mgdl IgG B 8,400l 58.4 CD ,570l 10 IgG 513 mgdl B kgh 42 AT3 2 kgh 38 E1 2.5 g RCA 1.9 mmlmt 2.2 mmlad 2.1 mm MRI 1
5 2012 Vol. 24No CAL Mishima, ASA, IVIG ASA, IVIG ASA, IVIG IVIG ASA, IVIG ASA, IVIG, MP, PE mitral valve plasty medium size vessel 10, IL Na
6 Westphalen, 1987 Tomita, 1992 Van Planta, 1995 Chang, 1999 Brenner, 2000 Krohn, 2002 Bonte, 2005 Durall, 2006 O Connor, 2007 Dogan, 2007 Kim, ASAIVIG ASAIVIG ASAIVIG ASAIVIG ASAIVIG ASAIVIG ASA ASAIVIGMP ASAIVIG ASAIVIG ASAIVIG ASAIVIG ASAIVIG ASAIVIG ASAIVIGMP ASA IVIG MP PE PGE1 PGE1 TPA PGE1iloprost TPA MPabciximab MP ilomedine DEXMTX PGE1 PGE1AT3 Xa IVIGintravenous immunoglobulinmpmethylprednisolone pulse 30 mgkgpeplasma exchangedoadopaminelamplipoamphotericin B BASAacetylsalicylic acidladleft anterior descending coronary artery branchrcaright coronary arterypslprednisolonepge1prostaglandin E1 E1 CAL 7 7 IVIG DIC 20
7 2012 Vol. 24No IVIGMPlipo PGE E D IL6 CRP IL6 IL6 MP 15 20,00030,000l IL6 CRP IVIG IVIG 10 IVIG MP IL6 4 Mori IVIGPE IVIG 2 IL Kanegaye JT, et alrecognition of a Kawasaki disease shock syndrome. Pediatrics 123e783789, Progress in Medicine Progress in Medicine
8 Progress in Medicine Progress in Medicine Medical Postgraduates Westphalen MA, et alkawasaki disease with severe peripheral ischemiatreatment with prostaglandin E1 infusion. J Pediatr , von Planta M, et alatypical Kawasaki disease with peripheral gangrene and myocardial infarctiontherapeutic implications. Eur J Pediatr , Chang JS, et alkawasaki disease complicated by peripheral gangrene. Pediatr Cardiol , Krohn C, et almultiple intestinal stenoses and peripheral gangrenea combination of two rare surgical complications in a child with Kawasaki disease. J Pediatr Surg , Bonte I, et alperipheral gangrene in adultonset Kawasaki disease. Scand J Rheumatol , Durall AL, et alinfantile Kawasaki disease and peripheral gangrene. J Pediatr , Dogan OF, et alperipheral gangrene associated with Kawasaki disease and successful management using prostacycline analoguea case report. Heart Surg Forum 10E7072, O Connor MJ, et alincomplete and atypical Kawasaki disease in a young infantsevere, recalcitrant disease responsive to infliximab. Clin PediatrPhila , Kim NY, et ala case of refractory Kawasaki disease complicated by peripheral ischemia. Pediatr Cardiol , Tomita S, et alperipheral gangrene associated with Kawasaki disease. Clin Infect Dis , Mori M, et alefficacy of plasma exchange therapy for Kawasaki disease intractable to intravenous gammaglobulin. Mod Rheumatol , Burns JCKawasaki Disease update. Indian J Pediatr , 2009 Refractory Kawasaki disease complicated by convulsions, DIC, peripheral gangrene, and rupture of the chordae tendineae of the mitral valve Junichi ISHIKAWA, Yoshiaki SHIKAMA, Kunihiko AKAGI Division of Infection, Immunology and Rheumatology, Kanagawa Children s Medical Center We describe a case of Kawasaki disease in a 2monthold girl complicated by convulsions, DIC, peripheral gangrene, and acute heart failure due to the rupture of the chordae tendineae of the mitral valve, in which severe inflammation persisted for four weeks. This severe disease was refractory to multiple doses of intravenous immunoglobulinivig, intravenous methylprednisolone, and plasmapheresis, but finally responded to an additional infusion of IVIG 27 days after the onset of fever. Mild coronary abnormalities resolved after ten months. Realtime serum levels of interleukin6 were of great value in monitoring the effects of treatment. This article reviewed the literature relevant to Kawasaki disease complicated by peripheral gangrene or the rupture of the chordae tendineae of the mitral valve, and discussed the treatment of refractory Kawasaki disease
Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura
Complex Intervention For Hemodialysis Patient Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura TCTAP 2012 Case A 77 year old female had been treated with hemodialysis(hd) for chronic
Vol. 25 No CT. Mycoplasma pneumoniae. Mycoplasma pneumoniae. Key words Mycoplasma pneumoniae
2013 Vol. 25No. 3247 1 1 2 1 3 1 6 11 X 20 CT Mycoplasma pneumoniae 1 Mycoplasma pneumoniae 1 6 11 C Key wordsmycoplasma pneumoniae 1 2 1428666 158 3 248 2013 1 WBC 4,200l 43.0 46.0 2.0 8.0 1.0 RBC 38410
Usefulness intravenous immunoglobulin therapy
Usefulness of initial single intravenous immunoglobulin therapy for Kawasaki disease Toshimasa Nakada Department of Pediatrics, Aomori Prefectural Central Hospital Kawasaki disease Kawasaki disease is
Kawasaki Disease: What you need to know from the 2017 Guidelines
Kawasaki Disease: What you need to know from the 2017 Guidelines S. Kristen Sexson Tejtel, MD, PhD, MPH Pediatric Preventive Cardiology TCHAPP Conference April 4, 2019 No disclosures to report Outline
Kawasaki disease (KD) is associated with
Intravenous immunoglobulin 1 g/kg as the initial treatment for Kawasaki disease Hirohiko Shiraishi, Mayu Iino, Masaru Hoshina, Kou Ichihashi, Mariko Y Momoi Tochigi, Japan Background: Coronary artery lesion
Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
PEDIATRIC CARDIOLOGY and CARDIAC SURGERY VOL. 25 NO. 1 (56 60) 1 1 1 2 2 3 4 1 2 3 4 Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation
Showa Univ J Med Sci 26 2, 169 173, June 2014 Case Report A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Takahiro UMEMOTO 1, Yoshikuni HARADA 1, Makiko SAKATA 1, Gaku KIGAWA
A Patient with Severe Pancreatitis Successfully Treated by. Takaya Tanaka, Kenji Suzuki, Nobuaki Matsuo, Fumihiro Nozu,
A Patient with Severe Pancreatitis Successfully Treated by Continuous Peritoneal Dialysis Takaya Tanaka, Kenji Suzuki, Nobuaki Matsuo, Fumihiro Nozu, Kazunobu Yamagami and Naoshi Takeyama Emergency Care
Shoshin Beriberi Complicating Severe Pulmonary Hypertension: A Case Report
J Cardiol 2007 Jun; 49 6 : 361 365 1 Shoshin Beriberi Complicating Severe Pulmonary Hypertension: A Case Report Yuko Masaki Masaaki Masamichi Takakazu Jun-ichi Tetsuya Toshinari Osamu Fusako Shinsuke Seiki
Kawasaki disease (KD) is an acute inflammatory
ORIGINAL ARTICLE Evaluation of Kawasaki Disease Risk Scoring System in a Single Center Experience from Japan Miho Ashiarai, Asami Shinbo, Kazuaki Matsumoto, Hisae Nakatani, Keiko Onda, Mari Okada, Masako
Cholesterol Pericarditis Identified by Increased Cardiothoracic Ratio on Chest Radiography: A Case Report
J Cardiol 2006 Oct; 48 4 : 221 226 X 1 Cholesterol Pericarditis Identified by Increased Cardiothoracic Ratio on Chest Radiography: A Case Report Tomohiko Mitsunobu Masahiro Kazuyuki IWATA, MD MURATA, MD
Primary adrenal lymphoma with adrenal insufficiency : report of three cases and review of literature
Primary adrenal lymphoma with adrenal insufficiency : report of three cases and review of literature Masumi Ogawa 1, Naoki Edo 1, Takuji Matsuo 1, Tadashi Yamamoto 1, Satoshi Takahashi 1, Yamato Mashimo
Age-adjusted plasma N-terminal pro-brain natriuretic peptide level in Kawasaki disease
Original article Jun Korean H, et J Pediatr al. Age-adjusted 2016;59(7):298-302 plasma NT-proBNP level and Kawasaki disease pissn 1738-1061 eissn 2092-7258 Korean J Pediatr Age-adjusted plasma N-terminal
,**2 AIDS +, + CMV AIDS : CMV +* :,**,*/,**2 HIV CMV CMV ,**0,,**1 - S -,/ -2.* +.* CMV : *0* *2+/ +/ CMV ,**2 1 +.
**2 The Japanese Society for AIDS Research The Journal of AIDS Research AIDS + + + + + + + - : CMV CMV AIDS : /1 **1 - CMV HIV : CMV CMV : AIDS HIV +* : ** */ **2 CMV AIDS CT + CMV CMV + CRP AST AIDS LDH
Preemptive Kidney Transplantation ~ Case study ~
16/06/2016 Yokohama APCN/JSN CME course 2016 Preemptive Kidney Transplantation ~ Case study ~ Nagoya Daini Red Cross Hospital Department of Transplant Surgery Makoto Tsujita Statement of Disclosure The
Coronary Artery Embolism From Ruptured Plaque in the Left Main Trunks With Difficulty in Detection of Culprit Lesion: A Case Report
J Cardiol 2005 Mar; 453: 115 121 1 Coronary Artery Embolism From Ruptured Plaque in the Left Main Trunks With Difficulty in Detection of Culprit Lesion: A Case Report Takatomi Eiji Shinya Yasuhiro Kazuo
Corynebacterium striatum
小児感染免疫 Vol. 26 No. 3 359 Corynebacterium striatum 1 Corynebacterium striatum 1 0 C. striatum 1 Stage Corynebacterium striatum 1 Corynebacterium C. striatum 0 32 1 0 Cefotiam hexetil 3 2 38.6 cefditoren
Left Ventricular Dysfunction Without Brain Natriuretic Peptide Elevation:
J Cardiol 2007 Mar; 49 3 : 149 153 2 Left Ventricular Dysfunction Without Brain Natriuretic Peptide Elevation: Two Case Reports Yuko Hajime Tomoharu Yasumichi Takeya Shunsuke Shohei Shuji Junichi TOGANE,
Scedosporium apiospermum
223 Scedosporium apiospermum 1 1) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 7 14 16 10 12 Candida Aspergillus 82 2000 10 2001 1 12 MRI 2 1 Scedosporium apiospermum Key words: Scedosporium apiospermum, Aspergillus,
2018/6/7 APSN/JSN CME Course Division of Nephrology St. Luke s International Hospital Raku Son M.D., PGY6
2018/6/7 APSN/JSN CME Course 2018 Division of Nephrology St. Luke s International Hospital Raku Son M.D., PGY6 Case1 77F Left leg pain Na 112 Case2 39M Seizure Na 117 Case3 73M General malaise Na 120 Case1
cm 8 1 / Computed Tomography CT Fig Tel:
12 103 107 2003 1 1 1 1 2 1 25 1.5 1.2cm 8 1 / 3 12 103 107 2003 1 2 5 25 1999 Computed Tomography CT 2000 1Tel: 03-5803-5253 2 113-8519 1-5-45 2002 8 26 2003 4 1 11 16 162.4cm 46kg 37.2 C 102 / 66mmHg72
E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro
Efficacy and safety of plasma exchange for Kawasaki disease with coronary artery dilatation
Kaida et al. Renal Replacement Therapy (2017) 3:50 DOI 10.1186/s41100-017-0130-y RESEARCH Open Access Efficacy and safety of plasma exchange for Kawasaki disease with coronary artery dilatation Yusuke
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
Non-Responders to Intravenous Immunoglobulin and Coronary Artery Dilatation in Kawasaki Disease: Predictive Parameters in Korean Children
Original Article Print ISSN 1738-5520 On-line ISSN 1738-5555 Korean Circulation Journal Non-Responders to Intravenous Immunoglobulin and Coronary Artery Dilatation in Kawasaki Disease: Predictive Parameters
Clinical Characteristics of Kawasaki Disease in Infants Younger than Six Months: A Single-Center Study
Original Article Print ISSN 1738-5520 On-line ISSN 1738-5555 Korean Circulation Journal Clinical Characteristics of Kawasaki Disease in Infants Younger than Six Months: A Single-Center Study You Min Yoon,
Intravenous immunoglobulin therapy for infants with Kawasaki diseaseyounger than 6 months
IOSR Journal Of Pharmacywww.iosrphr.org (e)-issn: 220-303, (p)-issn: 239-29 Volume 6, Issue 2 Version. (Dec 206), PP. -6 Intravenous immunoglobulin therapy for infants with Kawasaki diseaseyounger than
VAD. ALT TP Glb Ca CT MRI. . mg/dl X X A CT VAD VAD. GdhDTPA T.
VAD h h h hh ALTTPGlbCa CTMRI MP Ca VAD QOL VAD MP MP VAD MP VAD kg PCV.;RPI.WBC,/l ALT IU/l TP. g/dlglb. g/dl Ca. mg/dl X X A CT MRI CT BCT MRI T T GdhDTPAT T ChF h h hh FAX hh E-mail : sayochan@vet.osakafu-u.ac.jp
Coronary artery status of patients with transient fever h after first IVIG infusion did not differ from that seen in responsive patients
Baek et al. Pediatric Rheumatology (2018) 16:83 https://doi.org/10.1186/s12969-018-0301-6 RESEARCH ARTICLE Coronary artery status of patients with transient fever 24 36 h after first IVIG infusion did
AIDS. 1) Mycobacterium avium MRI (T2WI) HTLV-1 AIDS. Key words: Mycobacterium avium AIDS. Mycobacterium. complex MAC M. avium M.
2008 193 AIDS Mycobacterium avium 1) 2) 3) 4) 4) 3) 3) 3) 5) 1) 6) 1) 2) 3) 4) 5) 6) 20 1 30 20 6 13 46 MRI (T2WI) MRI 5 Mycobacterium avium M. avium HIV HTLV-1 AIDS AIDS Key words: Mycobacterium avium
Shunpei Hama, 1 Fumiaki Inori, 1 Dai Momose, 2 and Sadahiko Konishi Introduction. 2. Case Report
Case Reports in Orthopedics Volume 2015, Article ID 469879, 4 pages http://dx.doi.org/10.1155/2015/469879 Case Report Total Hip Arthroplasty for Rapidly Destructive Coxarthrosis in a Patient with Severe
Hyperaldosteronemia and hypogammaglobulinemia secondary to atopic dermatitis-induced exudation in an infant presenting with growth failure
Tokai J Exp Clin Med., Vol. 32, No. 1, pp. 18-22, 2007 Hyperaldosteronemia and hypogammaglobulinemia secondary to atopic dermatitis-induced exudation in an infant presenting with growth failure Tsuyoshi
Rapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
Infection & Chemotherapy. Original Article. Hye Rim Park 1, Mi Young Han 2, Kyung Lim Yoon 2, Sung-Ho Cha 1, Sung Kyoung Moon 3, and Hae Woon Jung 1
Original Article https://doi.org/10.3947/ic.2017.49.1.38 Infect Chemother 2017;49(1):38-43 ISSN 2093-2340 (Print) ISSN 2092-6448 (Online) Infection & Chemotherapy Mycoplasma Infection as a Cause of Persistent
Understanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
Continuous Infusion of Cyclosporin A in Intravenous Immunoglobulin Resistant Kawasaki Disease Patients
Case Report Continuous Infusion of Cyclosporin A in Intravenous Immunoglobulin Resistant Kawasaki Disease Patients Takaomi Minami, Hirohiko Shiraishi, Kensuke Oka, Jun Odaka, Tomoyuki Ishii, Akiko Takata,
Hiroyuki Kamiya 1), Soichiro Ikushima 1), Tetsu Sakamoto 1), Kozo Morimoto 1), Tsunehiro Ando 1), Masaru Oritsu 1), Atsuo Goto 2), Tamiko Takemura 3)
29 2001 ACE39.7IU/l X TBLB 2002 11 Langhans [ ] A Case of Granulomatous Interstitial Nephritis with Progressive Renal Impairment Due to Sarcoidosis in the Course of Spontaneous Improvement of Pulmonary
Perforation of a Duodenal Diverticulum. Elective Student S. C.
Perforation of a Duodenal Diverticulum 2008 4 Elective Student S. C. Case History An elderly male presented to the Emergency Department with abdominal pain. Chief Complaint: Worsening, diffuse abdominal
, copies ml PSL .. -0,2 HIV HCV. ml, HIV- HIV HIV-TP HCV-RNA. HIV ddi, -TC. AZT TDF FTC ratv ,**3 : HIV HIV-TP HIV HIV HIV-TP +
,** The Japanese Society for AIDS Research The Journal of AIDS Research HIV HIV + : HIV HIV-TP HIV HIV HIV-TP + :.. + A,2 HIVHCV -* CD. ddi -., / ml, HIV-RNA +**.** copyml.+ HIV-RNA ++*** copiesml ***
Case 4: 7- year- old boy. [Chief complaint] Gross Hematuria
![Case 4: 7- year- old boy. [Chief complaint] Gross Hematuria](/thumbs/89/98875170.jpg "Case 4: 7- year- old boy. [Chief complaint] Gross Hematuria")
Case 4: 7- year- old boy [Chief complaint] Gross Hematuria [History of present illness] He visited an urological clinic because of gross hematuria from one day before the consulta?on. A renal tumor with
Acute respiratory failure in a healthy adult with human parvovirus B19 infection
Open Journal of Clinical & Medical Case Reports Volume 3 (2017) Issue 19 Acute respiratory failure in a healthy adult with human parvovirus B19 infection ISSN 2379-1039 * Toyoshi Yanagihara ; Saaka Hamano;
Sternoclavicular joint septic arthritis with chest wall abscess in a healthy adult: a case report
Tanaka et al. Journal of Medical Case Reports (2016) 10:69 DOI 10.1186/s13256-016-0856-0 CASE REPORT Open Access Sternoclavicular joint septic arthritis with chest wall abscess in a healthy adult: a case
Nodular Muscular Sarcoidosis Extending to All Limb Muscles
47 1997 CD4/8 MRI T1 T2 74.6 IU/l 46.0 µg/ml MRI [ ] MRI Nodular Muscular Sarcoidosis Extending to All Limb Muscles Takahiro Nishitake, Eishi Miyazaki, Masaru Ando, Tetsujiro Fukami, Osamu Matsuno, Takuya
The Sequential Development of Antiglomerular Basement Membrane Nephritis and Myeloperoxidase-antineutrophil Cytoplasmic Antibody-associated Vasculitis
doi: 10.2169/internalmedicine.8757-16 http://internmed.jp CASE REPORT The Sequential Development of Antiglomerular Basement Membrane Nephritis and Myeloperoxidase-antineutrophil Cytoplasmic Antibody-associated
NORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
Common Codes for ICD-10
Common Codes for ICD-10 Specialty: Cardiology *Always utilize more specific codes first. ABNORMALITIES OF HEART RHYTHM ICD-9-CM Codes: 427.81, 427.89, 785.0, 785.1, 785.3 R00.0 Tachycardia, unspecified
ACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
Case conference. Welcome Dr. Lawrence Tierney
Case conference Welcome Dr. Lawrence Tierney Case: 18 year-old male CC) hamatomesis, Fever and cough HPI) 1 st admission One month ago, he admitted to our hospital because of hematemesis. He had weight
Clinical Guidance. Kawasaki disease. Summary This guideline includes therapy and follow up including investigations (echocardiography, MRI).
Clinical Guidance Kawasaki disease Summary This guideline includes therapy and follow up including investigations (echocardiography, MRI). Document Detail Document type Clinical Guideline Document name
Thyroid Storm Complicated by Bicytopenia and Disseminated Intravascular Coagulation
ISSN 1941-5923 DOI: 10.12659/AJCR.890519 Received: 2014.02.12 Accepted: 2014.03.14 Published: 2014.07.24 Thyroid Storm Complicated by Bicytopenia and Disseminated Intravascular Coagulation Authors Contribution:
Takuya SAKODA* ), Yoshiaki MURAKAMI, Naru KONDO, Kenichiro UEMURA, Yasushi HASHIMOTO, Naoya NAKAGAWA and Taijiro SUEDA ABSTRACT
Hiroshima J. Med. Sci. Vol. 64, No. 3, 45~49, September, 2015 HIJM 64 8 45 Takuya SAKODA* ), Yoshiaki MURAKAMI, Naru KONDO, Kenichiro UEMURA, Yasushi HASHIMOTO, Naoya NAKAGAWA and Taijiro SUEDA Department
IL-6) (Kawasaki disease) -α(tumor necrosis factor-α, TNF-α) -6(interleukin-6, ; 27: DOI: / [4] [5] [1,2] [6]
![IL-6) (Kawasaki disease) -α(tumor necrosis factor-α, TNF-α) -6(interleukin-6, ; 27: DOI: / [4] [5] [1,2] [6]](/thumbs/92/108301500.jpg "IL-6) (Kawasaki disease) -α(tumor necrosis factor-α, TNF-α) -6(interleukin-6, ; 27: DOI: / [4] [5] [1,2] [6]")
[] 57 1 林 2 1 540 107 5 5-7 10 2017; 27: 57-64 DOI: 10.3966/168232812017032701008 (Kawasaki disease) [1,2] 1967 [1] 1976 [3] -α(tumor necrosis factor-α, TNF-α)-6(interleukin-6, IL-6) [4] 10 5 19 [5] 1996
Kawasaki Disease. 1:45 2:30 p.m. James Nocton, MD Benjamin Goot, MD. Children s Specialty Group. All rights reserved.
Kawasaki Disease 1:45 2:30 p.m. James Nocton, MD Benjamin Goot, MD Disclosures We have no relevant financial relationships to disclose. Objectives Describe the characteristic signs and symptoms of Kawasaki
THE PATIENT WAS a 66-year-old man who experienced
Acute Medicine & Surgery 2018; 5: 189 193 doi: 10.1002/ams2.324 Case Report Treatment of a patient with acute aortic dissection using extracorporeal cardiopulmonary resuscitation after an out-of-hospital
A case of acute liver failure in HIV/HBV co-infection
A case of acute liver failure in HIV/HBV co-infection Lukun zhang Department of Infectious Disease The Third People s Hospital of Shenzhen May 12th,2017 History of present illness Patient basic information
HM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
What is Your Diagnosis?
What is Your Diagnosis? A STORM R Dulgheru, Liege, Belgium Faculty disclosure Raluca Dulgheru I have no financial relationships to disclose. Case presentation 52 years old male Ongoing oppressive chest
Medium-dose IVIG (1 g/kg) as an initial treatment of Kawasaki disease
Original article Moon Korean KP, J Pediatr et al. 2016;59(4):178-182 Medium-dose IVIG (1 g/kg) as an initial treatment of Kawasaki disease pissn 1738-1061 eissn 2092-7258 Korean J Pediatr Prediction of
Introduction. Case Reports 18/08/2011. Intravenous Immunoglobulin (IVIg) Prepared from large pools of plasma.
Introduction Intravenous Immunoglobulin (IVIg) Prepared from large pools of plasma. By Friend Maviza Consists of IgG with minimal levels of other immunoglobulin classes. IVIg is prescribed for several
Controls & Calibrators Clinical Chemistry
Controls & Calibrators Clinical Chemistry Clinical Chemistry Controls & Lipids Clinical Chemistry and lipid quality controls have been manufactured from true human serum to ensure they perform the same
Abaxis Piccolo xpress TM
Abaxis Piccolo xpress TM A breakthrough in point-of care diagnostics A breakthrough in point of care diagnostics Fast, easy, accurate on-site testing The Piccolo xpress TM is a fully automated system,
YOSHIKAWA, MD 1 HASHIMOTO, MD,FJCC
1 Interstitial Pneumonitis Followed by Syndrome of Inappropriate Antidiuretic Hormone Secretion Induced by Amiodarone Therapy for Dilated Cardiomyopathy : A Case Report 1 2 Shunji Makoto Naoaki Shunichi
Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
My Special Cytosorb Case. Fabio Silvio TACCONE Dpt of Intensive Care Hôpital Erasme ULB Brussels (BE)
My Special Cytosorb Case Fabio Silvio TACCONE Dpt of Intensive Care Hôpital Erasme ULB Brussels (BE) Conflicts of Interest Clinical Case - 1! 27 yo woman, 45 Kgs (Belgian Vietnam origin)! Blank medical
Borderline cytopenias. Dr Taku Sugai Consultant Haematologist
Borderline cytopenias Dr Taku Sugai Consultant Haematologist Borderline cytopenias Neutropenia Thrombocytopenia Anaemia with normal haematinics Two recent cases of cytopenias Neutropenia ANC of more than
Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours
Vol. 22 No ,2. coarse crackle. Key words
2010 Vol. 22 No. 3227 1 1,2 1 1 1 1 1 2 5 8 1 4 X CT 5 10 5 8 1 1 3 40 1 39 40 2009 5 21 4 13 kg 39.2 129 38 po 2 91 92 98 100 coarse crackle Key words 1 2 113 8421 2 1 1 228 2010 1 WBC 13,100l 71.4 18.3
Reactivation of Occult Hepatitis B Virus Infection 27 Months after the End of Chemotherapy Including Rituximab for Malignant Lymphoma
CASE REPORT Reactivation of Occult Hepatitis B Virus Infection 27 Months after the End of Chemotherapy Including Rituximab for Malignant Lymphoma Junichi Muraishi, Michihiko Shibata, Yuichi Honma, Masaaki
CASE A 58-year-old woman, office worker CC : fatigue and weakness
CASE A 58-year-old woman, office worker CC : fatigue and weakness HISTORY OF PRESENT ILLNESS About 7 days before admission, she lost her appetite and had a sensation of thirst. She had difficulties to
Case Report Development of Colonic Perforation during Calcium Polystyrene Sulfonate Administration: A Case Report
Case Reports in Medicine Volume 2013, Article ID 102614, 5 pages http://dx.doi.org/10.1155/2013/102614 Case Report Development of Colonic Perforation during Calcium Polystyrene Sulfonate Administration:
No social problems noted No past med hx Mother had spontaneous rupture of fetal membranes SB born on Needed to be resuscitated at birth
No social problems noted No past med hx Mother had spontaneous rupture of fetal membranes SB born on 9-16-2011 Needed to be resuscitated at birth (included assisted vent) Had generalized edema and possible
Implementation of disease and safety predictors during disease management in UC
Implementation of disease and safety predictors during disease management in UC DR ARIELLA SHITRIT DIGESTIVE DISEASES INSTITUTE SHAARE ZEDEK MEDICAL CENTER JERUSALEM Case presentation A 52 year old male
Clinical Case. Dr. Akif BAYYİĞİT Dr. İlker Nihat ÖKTEN Dr. Serkan DUMANLI
Clinical Case Dr. Akif BAYYİĞİT Dr. İlker Nihat ÖKTEN Dr. Serkan DUMANLI Case: Mr. A.D. 44 Male Abdominal pain and fever Past Medical History: Facial paralyses 20 years ago Splenomegaly? Family History:
1.3 What is the mechanism of action of adrenaline in anaphylactic shock? (20 marks)
DCH Examination -Short Answer Questions Time - Two and half hours Model paper 1.1 A 10 month old child presented with urticaria within one hour following ingestion of an egg. Mother claims that a week
Subject ID: I N D # # U A * Consent Date: Day Month Year
IND Study # Eligibility Checklist Pg 1 of 15 Instructions: Check the appropriate box for each Inclusion and Exclusion Criterion below. Each criterion must be marked and all protocol criteria have to be
FBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
Genetic programming applied to Collagen disease & thrombosis.
Genetic programming applied to Collagen disease & thrombosis. James Cunha Werner, Terence C. Fogarty SCISM South Bank University 103 Borough Road London SE1 0AA {werner,fogarttc}@sbu.ac.uk Abstract. This
LifeBridge Health Transfusion Service Sinai Hospital of Baltimore Northwest Hospital Center BQA Transfusion Criteria Version#2 POLICY NO.
LifeBridge Health Transfusion Service Sinai Hospital of Baltimore Northwest Hospital Center BQA 1011.02 Transfusion Criteria Version#2 Department POLICY NO. PAGE NO. Blood Bank Quality Assurance Manual
Patient: Becky Smith DOB: 01/26/XXXX Age: 5 y/o Attending: Dr. D. Miles Allergies: NKA MR#: 203. Patient Chart #203 Becky Smith
Patient Chart #203 Becky Smith 1 Property of CSCLV CSCLV Rev: 06/04/2018 Chief Complaint: Abdominal pain. Informant: Parents. HISTORY & PHYSICAL HPI: Ill looking patient, healthy until 2 days ago when
Laboratory diagnosis of plasma proteins and plasma enzymes
Laboratory diagnosis of plasma proteins and plasma enzymes Functions of plasma proteins Function: transport humoral immunity enzymes protease inhibitors maintenance of oncotic pressure buffering Example:
Tables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
Massive pulmonary embolism with ST-elevation in the inferior leads and other interesting ECG findings
CASE REPORT Massive pulmonary embolism with ST-elevation in the inferior leads and other interesting ECG findings Said Alsidawi 1, Mouhamad Abdalla 2, Tarek Helmy 2 1. Department of Internal Medicine,
Citation Acta Medica Nagasakiensia. 1992, 37
NAOSITE: Nagasaki University's Ac Title Author(s) An Autopsy Case of Acute Intermitte Murase, Kunihiko; Makiyama, Kazuya; Nonaka, Shigeru Citation Acta Medica Nagasakiensia. 1992, 37 Issue Date 1992-12-25
Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
CTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
Case Presentation. By Eman El Sharkawy Ass. Professor of cardiology Alexandria University
Case Presentation By Eman El Sharkawy Ass. Professor of cardiology Alexandria University 6m old baby girl Past history : - At the age of 2m attack of fever, diarrhea, mouth ulcers, difficult breast feeding
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
A case of hypothalamic hypopituitarism accompanied by recurrent severe hypoglycemia
Takai et al. SpringerPlus (2015) 4:173 DOI 10.1186/s40064-015-0934-6 a SpringerOpen Journal CASE STUDY Open Access A case of hypothalamic hypopituitarism accompanied by recurrent severe hypoglycemia Maiko
Acute encephalopathy with callosal, subcortical and thalamic lesions
Neurology Asia 205; 20() : 85 89 Acute encephalopathy with callosal, subcortical and thalamic lesions Yuko Nakano MD, Yukifumi Monden MD PhD, 2 Masashi Mizuguchi MD PhD, Masako Nagashima MD, Yasunori Koike
Advanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
Case Rep Gastroenterol 2010;4: DOI: /
261 Very-Low-Dose Pegylated Interferon α2a Plus Ribavirin Therapy for Advanced Liver Cirrhosis Type C: A Possible Therapeutic Alternative without Splenic Intervention Shogo Ohkoshi Satoshi Yamagiwa Masahiko
Session 1: Circuit, Anticoagulation and Monitoring. Ashita Tolwani, MD, MSc Noel Oabel, BSN, RN, CNN 2019
Session 1: Circuit, Anticoagulation and Monitoring Ashita Tolwani, MD, MSc Noel Oabel, BSN, RN, CNN 2019 Goals n Learn how to set up citrate anticoagulation for CVVH, CVVHD, CVVHDF using Prismaflex n Determine
Aortic Stenosis and Mitral Regurgitation Complicated by Hemolytic Anemia and Positive Direct Coombs Test: A Case Report
J Cardiol 2005 Sep; 46 3 : 119 124 1 Aortic Stenosis and Mitral Regurgitation Complicated by Hemolytic Anemia and Positive Direct Coombs Test: A Case Report Shinjiro Hiroaki Naohito Makoto Toru Yoshihisa
Clinical Significance of Plasma Ammonia in Patients with Generalized Convulsion
ORIGINAL ARTICLE Clinical Significance of Plasma Ammonia in Patients with Generalized Convulsion Kouichi Tomita 1,NorioOtani 2,FumioOmata 3,4 and Shinichi Ishimatsu 1,2 Abstract Background Plasma ammonia
Kawasaki disease (KD) is an acute systemic vasculitis of unknown etiology that primarily affects small- and mediumsized
N-Terminal Pro-Brain Natriuretic Peptide and Risk of Coronary Artery Lesions and Resistance to Intravenous Immunoglobulin in Kawasaki Disease Ken Yoshimura, MD, Takahisa Kimata, MD, Kenji Mine, MD, Takamichi
Kawasaki Disease: An Update
Kawasaki Disease: An Update Mary Beth Son, MD Boston Children s Hospital September 23 rd, 2018 No disclosures relevant to this talk Outline of Talk Signs and Symptoms of KD Diagnosis Treatment knowns and