E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
|
|
|
- Baldwin Dickerson
- 5 years ago
- Views:
Transcription
1 442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro Hosoya, Yukio Kadooka, Chizuru Asada, Toshiaki Uchida and Hiroshi Kawakami Technology and Research Institute, Snow Brand Milk Products Co., Ltd., ++, Minamidai, Kawagoe, Saitama -/*++0/ Lactoferrin can solubilize over,** molar equivalents of iron, and is expected as a natural iron solubilizer for food products and nutraceuticals from the viewpoints of bioavailability, safety, and productivity. To investigate the availability of iron solubilized by lactoferrin (FeLF) in humans, we recruited thirteen volunteers with serum hemoglobin values below +- g/dl blood and/or ferritin levels below./ ng/dl serum and served them a supplement containing FeLF (1./ mg of iron) every day for twelve weeks. Significant increases in blood hemoglobin (Hb), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and serum ferritin concentrations were observed during the FeLf supplementation period. The hemoglobin level of three anemia subjects improved significantly during the period of FeLf supplementation, and, conversely, decreased after discontinuation of the supplementation. No side e#ects attributable to FeLf supplementation were observed either during or after the supplementation period. Thus, the results suggest that FeLf could be a useful food product for iron fortification to prevent anemia without the risk of toxicity often encountered with general iron supplementation. (Received Feb. +.,,**1 ; Accepted Jul. -+,,**1) Keywords : anemia, iron, lactoferrin, food, iron status : +0 /* /* +/ ngml +, -1 +.* mg, mg +* mg 23 LF -/*++0/ ++, Corresponding author yr-emilie@snowbrand.co.jp +*++ LF FeLF ++ FeLF + WHO Hb +-.* gdl +,.* g dl +, Holyoake 2. +,./ ngml +-
2 19 : 443 WHO Hb +- gdl./ngdl +- 1/ FeLF ++,+./,,**0.. 3 / :,** , Hb +- gdl./ ngdl FeLF +. :LF/* mg, 1./ mg ph + /* ml g - Hb +- gdl./ ngdl +- 1./ mg +, 0 0 +, 0 0 +, 0. Hb Tf Ht MCV MCH MCHC UIBC TIBC Tf GOT, GPT, g-gtp, HDL CRP. t paired t-test / + FeLF - g 1./ mg +, 0 1./ mg n++ ; 0 ** : p*.*+, paired t-test +-, 2/ Hb MCV MCH Tf Hb WHO +, - 0 +,, TIBC UIBC MCH MCHC Ht Tf + MCH Ht Tf + Hb
3 444 /. +*,**1 +* , 0 WBC RBC Hb Ht MCV MCH MCHC Plt Ret TP ALB AST ALT LDH ALP g-gtp ChE T-Bil UN UA CR CPK TCHO HDLC TG FFA PL Na K Cl Ca IP Fe TIBC UIBC CRP Ferritin Tf l l gdl fl pg l gdl gdl Ul Ul Ul Ul Ul Ul mgdl mgdl mgdl mgdl Ul mgdl mgdl mgdl meql mgdl meql meql meql mgdl mgdl gdl gdl gdl mgdl ngdl mgdl -/**3 1** -10/+0 ++4,+/4, -.4-./4, 2*+*+, *4+,40 04/24, -41/4/ +*.* /./ +,*,./ +* /**2 *** *4,+ 2,* 1 *4-+4, /*,+* +/*,+3.*3* /*+.3 *4+*42+ +/*,/* +-/+./ -4// 32+*2 24,+*,4/.4/ /*+1*,/*.0* ++*.,/ *4./ /+/1 +3*-,* / ,/4-.-14/*,/4/* +,4..* ,,4,/ */,24.2,4.* -,4*3*43*,/4*/04*- +4*.* *4.+.4/1*4,*,* /40.04,*,* */ /42,-42..3/24//3*,40. *40,*4, ,.4-1*411 *4/**4,, 224** **,/ /4* ,34-. *4/3* , **+4//.4-.*4/, +*-4-0+4,3 34*2*4+3-4/+* *3/*4,/.* / -, *4+0* , , /, *,+43* +,411*433**.*4+0,4-2*** 3*4//04-/**,2411,4-, -+411*433,.4-// *4-- 14//*4--.4/3*4, * +.4*3/433* ,34/3 +1-4,1-34, *4* * *401*4,3 ++42* *42- *4/** / , 024**-/40/ *403*4-* +3,42,,/4,, +.*4//* ,*4./** +**42,+4,/*** 34/**4..** -420*41-3.4* *14*3/34/2 -*/ *. *4,-*4.*,,4+2+,4.2*,114//.14*.** 0 +0*4*+ +.14,.-04.*,.4+* +,40/*42/ -3403,4,/* 3+4*3/43,**,34*.,4+2* -+420*413,-4,,/421** +4*0* *4.1.4/3*4,. +142,,4/,* +.4** *40.+/4/1 +0.4**-24*,** +/4+2-4,2.//.4-03.*4/,*** *40+*4,. +,4*/,4.-.4+,*40* *4//* ** ,-4.* 004+2,* **,.4-2 *4/.*4+3 +3/43+, *421.4*1*4./ +*,4,1+4.,* 34*-*4,/ -4--*4./ 3*4,1/14+1.**40.//40+ -+* *4+** /-+*4,+,2-4*3-14-2*** 0 -,34+, * *,*4** +,40++4*/ -34//, ,/40****,34,/,4,,** ,-,-4,-/4/0 +4+,*4.1 14,1*4/..4.-*4,/** +24.0,41** +.4+2/4,+ +2+4* ,.-40* //3-04,. *4/3*4+0 +,42*, *422 *4.0* * +1,4** **+24, ,343/ *41** **, ,4** /*4-, +*,40.+4/1 34++*4-/ -4//*4., ,/ -334// ,,4*32*40+ *4,+*4+1,,4*,+-4,.,214,1/-4.2 WBC, White blood cell ; RBC, Red blood cell ; Hb, Hemoglobin ; Ht, Hematocrit ; MCV, mean corpyuscular volume ; MCH, Mean corpuscular hemoglobin ; MCHC, Mean corpuscular hemoglobin concentration ; Plt, Platelet ; Ret, Reticulocyte count ; TP, Total Protein ; ALB, Albumin ; AST, L-asparate, oxoglutarate aminotransferase ; ALT, L-alanine, oxoglut arate aminotransferase ; LDH, Leucine aminop eptidase ; ALP, Alkaline phosphatase ; g-gtp, g-glutamyl transpeptidase ; ChE, Cholinesterase ; T-B il, Total bilirubin ; UN, Blood urea nitrogen ; UA, Uric acid ; CPK, Creatine phospho kinase ; TCHO, Total cholesterol ; HDLC, High density lipoproteincholesterol ; TG, Triglceri de ; FFA, Free fatty acid ; PL, Phospholipid ; IP, Inorganic phosphorus ; Fe, Serum iron ; TIBC, Total iron binding capacity ; UIBC, Unsaturatediron-binding capacity ; CRP, C-reactive protein ; Tf, transferrin4 n++ *: p airedt-test * p*4*/ ** p*4*+ *** p*4**+4
4 21 : Hb MCHC 1+/ Hb FeLF 1./ mg Hb, MCV 0 +, 0 Hb Hb 1 0 Hb +, WHO - FeLF 0 +, Hb, FeLF, Hb +- gdl 0 +, 0 Hb FeLF Paesano LF LF,** mg, 2.2 mg +/0 mg LF Hb, WHO FeLF - g 1./ mg 1./ mg WHO +, g dl n- *: p*.*/, paired t-test +3 LF,* FeLF FeLF FeLF FeLF +, FeLF Hb +- g dl./ ngdl Hb MCV MCH FeLF
5 446 /. +*,**1 +* 22 +,**/,**/, +0,**0 - Greengard, J., Iron poisoning in children, Clinical Toxicology., 2, /1/31 (+31/).. Genzernik,W., Schmaman, A. and Chappel, JS., Corrosive gastritis as a result of ferrous sulphate ingestion, South African Medical Journal.,,, +/+/ (+32*). / Powell, LA. and Halliday, JW., Iron absorption and iron overload, Clinics in Gastroenterology., +*, 1*1-/ (+32+). 0 1 pp. +0+*, /, S,- 2+/,- +33* +* Kawakami, H., Dosako, S. and Nakajima, I., E#ect of lactoferrin on iron solubility under neutral conditions, Bioscience Biotechnology Biochemistry., /1, (+33-). ++ Uchida, T., Oda, T., Sato, K. and Kawakami, H., Availability of lactoferrin as a natural solubilizer of iron for food products, International Dairy Journal., +0, 3/+*+ (,**0). +, WHO, Iron Deficiency Anemia. Assessment, Prevention, and Control, A Guide for Programme Managers., (,**+). +- Holyoake, TL., Stott, DJ., Mckay, PJ., Hendry, A., Mac- Donald, JB. and Lucie, NP., Use of plasma ferritin concentration to diagnose iron deficiency in elderly patients, J Clin Pathol.,.0, 2/10* (+33-). +. Milk Science., /- +2-0,**. +/ +* pp. / Bothwell, TH. and Charlton, RW., Iron deficiency in women. A report of the international Nutritional Anemia Consultative Group (INACG), The Nutrition Foundation (Washington DC) (+32+) pp. -,..+,**, +2 Mehta, BC., Iron deficiency amongst nursing students, Indian J Med Sci., /2, (,**.). +3 Paesano, R., Francesco, T., Francesca, B., Enrica, P., Valeria, E., Massimo, M. and Piera, V., Oral administration of lactoferrin increases hemoglobin and total serum iron in pregnant women, Biochem Cell Biol., 2., -112* (,**0).,* Bo Lonnerdal, FFI,++ pp..*0.+-,**0 +3,
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
Rapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
NORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
Supplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
Tables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
Clinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
Understanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
Complete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
Clinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
ACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
VITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation
Showa Univ J Med Sci 26 2, 169 173, June 2014 Case Report A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Takahiro UMEMOTO 1, Yoshikuni HARADA 1, Makiko SAKATA 1, Gaku KIGAWA
10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
BC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
Analyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura
Complex Intervention For Hemodialysis Patient Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura TCTAP 2012 Case A 77 year old female had been treated with hemodialysis(hd) for chronic
ENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
NEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
Evaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
Delta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
Clinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Hemochromatosis Information KIT for NEWBIES
Hemochromatosis Information KIT for NEWBIES Your KIT includes first steps for a complete diagnosis, next steps for appropriate treatment, next steps to inform family members and helpful items developed
*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
LABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and
Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and 3-31-09 Normal Ranges / 12-30-08 Christy O Brien, MT (ASCP) CHEMISTRY Acetone None detected Albumin, g/dl 3.5-5.0 Adult
Test Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
TRACEABILITY and UNCERTAINTY
ACP Acid phosphatase total 1-naphthyl phosphate NPP Acid phosphatase, non-prostatic 1-naphthyl phosphate (Inhib.:tartrate) ACP-P Acid phosphatase, prostatic 1-naphthyl phosphate (Inhib.:tartrate) ALB Albumin
Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
Supporting Materials for a 31-Day Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects
Supporting Materials for a 31- Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects Brent L. Finley a, Kenneth M. Unice b, Brent D. Kerger c, Joanne M. Otani a, Dennis
Roche/Hitachi - PreciControl ClinChem Multi 2
ATRYP Antitrypsin alpha 1 ERM-DA470k/IFCC 9 136 1.36 1.84 0.0184 GPROT Acid glycoprotein alpha 1 CRM 470 2 90.1 0.901 0.890 0.00890 ACP Acid phosphatase total 1-naphthyl phosphate 0.720 43.1 0.00703 0.421
Senior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
Provider: TONY BOGGESS DO 1310 S Main St Ann Arbor, MI Account No: Results
DOB: 03.17.1969 Fasting: Yes ACC/AHA Risk Score: BMI: 28.9 Info: 1310 S Main St Ann Arbor, MI 48104 Requisition No: Received Date & Time: 09.09.2017 11:46 AM Collection Date & Time: 09.08.2017 NOT GIVEN
i. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
Ascend Clinical Reference Ranges (November 2018) Chemistry
24 Hour Urine Creatinine mg/24 hr 800-2000 (Male) 600-1800 (Female) Kinetic Alkaline Picrate (Jaffe Reaction) for Creatinine 24 hour Urine Creatinine Clearence (Creatinine ml/min/1.73m^2 85-125 (Male)
BS-230. Clinical Chemistry Analyzer
BS-230 Clinical Chemistry Analyzer Flexible loading: 80 sample positions, Up to 80 reagent positions. Up to (40 fixed + 40 interchangeable) μl minimum reaction volume Disposable Cuvettes to avoid contamination
Ascend Clinical Reference Ranges (July 2018) Chemistry
24 Hour Urine Creatinine mg/24 hr 800-2000 (Male) Kinetic Alkaline Picrate (Jaffe Reaction) for 24 hour Urine Creatinine Clearence (Creatinine ml/min/1.73m^2 Clearance) 600-1800 (Female) 85-125 (Male)
What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
Inspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
Case conference. TAKUGA HINOSHITA 2 nd resident ONMC
Case conference TAKUGA HINOSHITA 2 nd resident ONMC 38 y/o female, Japanese CC: Dyspnea, Muscle clump, Numbness HPI Since 1 week PTA, she s been complaining of fever around 38, chills, cold sweat and nocturnal
HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
Controls & Calibrators Clinical Chemistry
Controls & Calibrators Clinical Chemistry Clinical Chemistry Controls & Lipids Clinical Chemistry and lipid quality controls have been manufactured from true human serum to ensure they perform the same
TRACEABILITY and UNCERTAINTY
Cat. No. 0 79 0 90 ACP Acid phosphatase total -naphthyl phosphate NPP Acid phosphatase, non-prostatic -naphthyl phosphate (Inhib.:tartrate) ALB Albumin BCG plus ALB Albumin BCP ALP Alkaline phosphatase
GRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385
REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018
Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
BASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
Control Data of Rat
BrlHan:WIST@Tac(GALAS) Control Data of BrlHan:WIST@Tac(GALAS) Rat Taconic Biosciences -1- BrlHan:WIST@Tac(GALAS) Environmental Conditions and Investigation Items Environmental Conditions (Isolated Barrier
Soy isoflavones inducing overt hypothyroidism in a patient with chronic lymphocytic thyroiditis: a case report
Nakamura et al. Journal of Medical Case Reports (2017) 11:253 DOI 10.1186/s13256-017-1418-9 CASE REPORT Open Access Soy isoflavones inducing overt hypothyroidism in a patient with chronic lymphocytic thyroiditis:
Research Article Thirteen-Week Study of PM014 Subchronic Oral Toxicity in Rats
Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 214, Article ID 189673, 8 pages http://dx.doi.org/1.1155/214/189673 Research Article Thirteen-Week Study of PM14
THREE CASES OF THINNER-SNIFFING AND ESTIMATING THE FATAL CONCENTRATION OF TOLUENE BY TOXICOKINETICS
THREE CASES OF THINNER-SNIFFING AND ESTIMATING THE FATAL CONCENTRATION OF TOLUENE BY TOXICOKINETICS Tatsuya HOBARA, Masayuki OKUDA, Masayuki GOTOH, Kouichi OKI, Hiroyuki SEGAWA, Ichiro KUNITSUGU Department
Mineral Panel, Urine. Mineral/Lytes Panel, Urine. Metabolic Profile Test Panel Urea NEFA AST BHB. Non-Mammalian Chem Panel
CHEMISTRY PANELS Bilirubin Panel Bilirubin, Total Bilirubin, Direct Bilirubin, Indirect Canine Chemistry Panel See Small Animal Chemistry Panel Electrolyte Panel (NA) (K) (CL) Electrolyte Panel, Urine*
CLINICAL CHEMISTRY REAGENTS. Product Profile
Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting
COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
Get to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
Blood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
PEDIATRIC CARDIOLOGY and CARDIAC SURGERY VOL. 25 NO. 1 (56 60) 1 1 1 2 2 3 4 1 2 3 4 Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
Sternoclavicular joint septic arthritis with chest wall abscess in a healthy adult: a case report
Tanaka et al. Journal of Medical Case Reports (2016) 10:69 DOI 10.1186/s13256-016-0856-0 CASE REPORT Open Access Sternoclavicular joint septic arthritis with chest wall abscess in a healthy adult: a case
Symptoms and Signs in Hematology (2)/ 2013
Symptoms and Signs in Hematology (2)/ 2013 Abdallah Abbadi.MD.FRCP Professor of Medicine,Hematology & Oncology University of Jordan & JUH Email: abdalla.awidi@gmail.com Case one: A 24 yr old female complains
Evaluation of the Subchronic Toxicity of Dietary Administered Equisetum arvense in F344 Rats
J Toxicol Pathol 2010; 23: 245 251 Original Evaluation of the Subchronic Toxicity of Dietary Administered Equisetum arvense in F344 Rats Yoshiyuki Tago 1, Min Wei 1, Naomi Ishii 1, Anna Kakehashi 1, and
BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550
Reagents on COBAS INTEGRA Systems
within specification within specification Lipemia AAGP α1-acid Glycoprotein X X no no no no no no no AAGP2 α1-acid Glycoprotein Gen.2 X X X 60 60 1000 1026 1026 621 700 AAT2 α1-antitrypsin ver.2 X X X
Reference Intervals of Hematology and Clinical Chemistry Analytes for 1-Year-Old Korean Children
Original Article General Laboratory Medicine Ann Lab Med 2016;36:481-488 http://dx.doi.org/10.3343/alm.2016.36.5.481 ISSN 2234-3806 eissn 2234-3814 Reference Intervals of Hematology and Clinical Chemistry
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
Get to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
2013/11/29 Version 2
1 2013/11/29 Version 2 2 3 4 5 6 7 8 9 99 1 2 3 4 5 6 7 8 9 10 10 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219 /99.pdf 99 1 2 3 4 5 6 7 8 9 10 11 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219
COBAS INTEGRA / cobas c C.f.a.s.
COBAS INTEGRA / cobas c - C.f.a.s. Cat. No. 0 79 30 90 Roche Diagnostics GmbH May 20 Acid phosphatase total -naphthyl phosphate Gen. 2 Integra 00 plus Acid phosphatase total -naphthyl phosphate Gen. 2
Cholesterol Pericarditis Identified by Increased Cardiothoracic Ratio on Chest Radiography: A Case Report
J Cardiol 2006 Oct; 48 4 : 221 226 X 1 Cholesterol Pericarditis Identified by Increased Cardiothoracic Ratio on Chest Radiography: A Case Report Tomohiko Mitsunobu Masahiro Kazuyuki IWATA, MD MURATA, MD
ROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
Multiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
Bio-Rad Laboratories EXTERNAL QUALITY ASSURANCE SERVICES EQAS. External Quality Assurance Services
Bio-Rad Laboratories EXTERNAL QUALITY ASSURANCE SERVICES EQAS External Quality Assurance Services Table of Contents About Bio-Rad EQAS EQAS Program Overview.... 3 Online EQAS Resources... 4 Submitting
TRACEABILITY and UNCERTAINTY 9
AAT Antitrypsin alpha 1 AAGP Acid glycoprotein alpha 1 immunoturbidimetric Gen. Acid phosphatase total 1-naphthyl phosphate Gen. Acid phosphatase total 1-naphthyl phosphate Gen. Integra 00 plus Acid phosphatase,
I. Definitions. V. Evaluation A. History B. Physical Exam C. Laboratory evaluation D. Bone marrow examination E. Specialty referrals
I. Definitions II. III. Red blood cell life cycle Iron metabolism IV. Causes of anemia A. Kinetic approach 1. decreased production 2. increased destruction 3. blood loss B. Morphologic approach 1. normocytic
Borderline cytopenias. Dr Taku Sugai Consultant Haematologist
Borderline cytopenias Dr Taku Sugai Consultant Haematologist Borderline cytopenias Neutropenia Thrombocytopenia Anaemia with normal haematinics Two recent cases of cytopenias Neutropenia ANC of more than