Vol. 25 No CT. Mycoplasma pneumoniae. Mycoplasma pneumoniae. Key words Mycoplasma pneumoniae
|
|
- Chad Thomas
- 5 years ago
- Views:
Transcription
1 2013 Vol. 25No X 20 CT Mycoplasma pneumoniae 1 Mycoplasma pneumoniae C Key wordsmycoplasma pneumoniae
2 WBC 4,200l RBC l Hb 10.6 gdl Ht 34.2 Plt l 1 43 mm 2 73 mm PT 72 APTT 37.4 sec Fib 202 mgdl TP 5.3 gdl Alb 2.8 gdl Tbil 0.4 mgdl Dbil 0.1 mgdl BUN 8.1 mgdl Cr 0.4 mgdl UA 3.1 mgdl Ca 8.1 mgdl ip 2.7 mgdl AST 562 IUl ALT 293 IUl LDH 4,474 IUl ALP 246 IUl GTP 17 IUl CK 72 IUl Amy 69 IUl Na meql K 3.9 meql Cl 99.0 meql CRP 0.5 mgdl HAIgM HBsAg HCVAb IgM IgG CMVIgM CMVIgG A B 3 7 B4 B5 B6 EBV EBNA ph ,048 6 PA 40 10, EIA EIA EIA EIA CF MG Amy 829gl 2,751 IUl30 CF P 95.3 NT NT CF CF CF FA S ACCR ACCRamylase creatinine clearance ratio cm1.67 S.D kg1.38 S.D mmhg70 mmhg 1 X AST 1,289 IUlALT 750 IUl 39.7AST ALT AST 27 IUlALT 32 IUl PA , X 3 a IUl CT 3 b 950 ngml
3 2013 Vol. 25No X 6 lll l 2 A2 1,890 ngdl IUl IUl 10, MRCP IUl
4 a X b CT IUl IUl PA CF 4 PA 320 CF 64 2 X PA , CTMRI 2 13 CT Grade 0 Grade 1 3 PubMed X IgM Mårdh
5 2013 Vol. 25No X Mårdh PenicillinEM 14 42,000IU 2,000IUl Not done 101,280CF MINO U 400U Not done 512CF MINO S6 2 24,960IUl 850IUl Not done 80160CF Yoshimoto MINOAMPC 35 4,600IUl 870IUl Not done 1,280HA MINOEM ,000IU 1,607IU Not done 3264CF 32128CF 7 EMCEZ 9 1,805IU 353IU Not done 3201,280PHA 432CF EMCEZ 6 650IU 144IU Not done 40640PHA 464CF 4 EMCTX IU 1,204IU Not done 1,280PHA CCLASPCMINO 13 4,670IUl 2,459IUl CT 464CF MINOFMOX 12 9,340IUl 379IUl 6402, MINO IUl 1,074IUl Not done 81,024CF CTX 10 3,789IUl 3,010IUl 1,810IUl 1,280PA CT CAMCTX 2 917IUl 238IUl 40160PHA CTMRI 6 MINO 28 3,047IUl 468IUl 63IUl 4010,240PA CT EMerythromycin, MINOminocycline, AMPCamoxicillin, CEZcefazolin, CTXcefotaxime, CCLcefaclor, ASPCaspoxicillin, FMOXflomoxef, CAMclarithromycin bronchopneumonia
6 X ,14 A Mycoplasma pneunomiae Mårdh 8 4 Mycoplasma pneunomiae Tomomasa Mycoplasma pneunomiae 15 Mycoplasma pneunomiae 1 Mycoplasma pneunomiae Mycoplasma pneumoniae Mycoplasma pneumoniae 18 Leinikki Mycoplasma pneumoniae CF Mycoplasma pneumoniae 19 Mycoplasma pneumoniae 20,21 Mycoplasma pneumoniae CF PA 40 10,240 Mycoplasma pneumoniae
7 2013 Vol. 25No loop mediated isothermal amplificationlamp 22 Mycoplasma pneumoniae Mycoplasma pneunomiae Powell DAMycoplasma pneumoniae. Nelson textbook of pediatrics 19th edkliegman RM, et al eds. W.B. Saunders, Philadelphia, 2011, Mårdh PA, et althe occurrence of acute pancreatitis in Mycoplasma pneumoniae infection. Scand J Infect Dis , Yoshimoto M, et alacute pancreatitis complicating Mycoplasma pneumoniae infection in a child. Annales Paediatrici Japonici , Tomomasa T, et alacute pancreatitis in Japanese and Western childrenetiologic comparisons. J Pediatr Gastroneterol Nutr , Waites KB, et almycoplasma pneumoniae and its role as a human pathogen. Clin Microbiol Rev , 2004
8 Parenti DM, et alinfectious causes of acute pancreatitis. Pancreas , Leinikki P, et alantibody response in patient with acute pancreatitis to Mycoplasma pneumoniae. Scand J Gastroenterol , Oderda G, et alrising antibody titer to Mycoplasma pneumoniae in acute pancreatitis. Pediatrics , alAbassi AAcute pancreatitis associated with Mycoplasma pneumoniaea case report of missed diagnosis. Med Princ Pract , LAMPloopmediated isothermal amplification Mycoplasma pneumoniae Badalov N, et aldruginduces acute pancreatitisan evidencebased review. Clin Gastroenterol Hepatol , 2007 Case of a male pediatric patient with mycoplasma pneumonia followed by acute pancreatitis A case report and review of the literature Yoshifusa ABE 1, Shintaro SUZUKI 2, Kazuhiko MATSUHASHI 1, Mai ARAI 1, Shuichiro WATANABE 3, Kazuo ITABASHI 1 1Department of Pediatrics, Showa University School of Medicine 2Division of Respiratory and Allergy, Department of Internal Medicine, Showa University School of Medicine 3Watanabe Children s Clinic The case of a male pediatric patient with mycoplasma pneumonia followed by acute pancreatitis is described. The patient was six years and eleven months old. He was referred to our hospital due to fever and cough. Chest Xray images showed pneumonia and laboratory tests revealed an elevated transaminase level. He was admitted to our hospital because of mycoplasma pneumonia and acute liver dysfunction. Although his symptoms and laboratory data were improving, he had fever and upper abdominal pain on day 20 post admission. The levels of pancreatic enzymes were elevated in the patient s blood and urine, and CT images of the abdomen revealed swelling of the pancreas. Hence, he was diagnosed as having acute pancreatitis. There are several reports on cases of mycoplasma pneumonia followed by acute pancreatitishowever, whether acute pancreatitis is induced by mycoplasma infection remains to be clarified. Therefore, it is important to reconsider this issue. Previous studies and this one suggest that attention should be paid to the incidence of acute pancreatitis after improvement of mycoplasma pneumonia. However, further research is required to clarify the mechanisms underlying this incidence
Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura
Complex Intervention For Hemodialysis Patient Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura TCTAP 2012 Case A 77 year old female had been treated with hemodialysis(hd) for chronic
More informationShoshin Beriberi Complicating Severe Pulmonary Hypertension: A Case Report
J Cardiol 2007 Jun; 49 6 : 361 365 1 Shoshin Beriberi Complicating Severe Pulmonary Hypertension: A Case Report Yuko Masaki Masaaki Masamichi Takakazu Jun-ichi Tetsuya Toshinari Osamu Fusako Shinsuke Seiki
More informationA Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation
Showa Univ J Med Sci 26 2, 169 173, June 2014 Case Report A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Takahiro UMEMOTO 1, Yoshikuni HARADA 1, Makiko SAKATA 1, Gaku KIGAWA
More informationA Patient with Severe Pancreatitis Successfully Treated by. Takaya Tanaka, Kenji Suzuki, Nobuaki Matsuo, Fumihiro Nozu,
A Patient with Severe Pancreatitis Successfully Treated by Continuous Peritoneal Dialysis Takaya Tanaka, Kenji Suzuki, Nobuaki Matsuo, Fumihiro Nozu, Kazunobu Yamagami and Naoshi Takeyama Emergency Care
More informationVol. 24 No DIC CAL IVIG. cm 32.0 cm DIC. 4 1 Bil 16.5 mg dl IVIG IVIG SD IL 6
2012 Vol. 24No. 2163 DIC 1 1 1 1 4 DIC 2 27 27 10 IL6 CAL IVIG DIC IVIG IVIG 1 2 IUGR 31 0 37 5 APGAR 1 8 5 9 2,090 g 2.0 SD 43.5 cm2.3 SD 32.0 cm 32.0 cm 4 1 Bil 16.5 mgdl 8.5 2 8 1 2.0 SD Key wordsil6
More informationVol. 22 No ,2. coarse crackle. Key words
2010 Vol. 22 No. 3227 1 1,2 1 1 1 1 1 2 5 8 1 4 X CT 5 10 5 8 1 1 3 40 1 39 40 2009 5 21 4 13 kg 39.2 129 38 po 2 91 92 98 100 coarse crackle Key words 1 2 113 8421 2 1 1 228 2010 1 WBC 13,100l 71.4 18.3
More informationCorynebacterium striatum
小児感染免疫 Vol. 26 No. 3 359 Corynebacterium striatum 1 Corynebacterium striatum 1 0 C. striatum 1 Stage Corynebacterium striatum 1 Corynebacterium C. striatum 0 32 1 0 Cefotiam hexetil 3 2 38.6 cefditoren
More informationCholesterol Pericarditis Identified by Increased Cardiothoracic Ratio on Chest Radiography: A Case Report
J Cardiol 2006 Oct; 48 4 : 221 226 X 1 Cholesterol Pericarditis Identified by Increased Cardiothoracic Ratio on Chest Radiography: A Case Report Tomohiko Mitsunobu Masahiro Kazuyuki IWATA, MD MURATA, MD
More informationCase conference. Welcome Dr. Lawrence Tierney
Case conference Welcome Dr. Lawrence Tierney Case: 18 year-old male CC) hamatomesis, Fever and cough HPI) 1 st admission One month ago, he admitted to our hospital because of hematemesis. He had weight
More informationA case of acute liver failure in HIV/HBV co-infection
A case of acute liver failure in HIV/HBV co-infection Lukun zhang Department of Infectious Disease The Third People s Hospital of Shenzhen May 12th,2017 History of present illness Patient basic information
More information,**2 AIDS +, + CMV AIDS : CMV +* :,**,*/,**2 HIV CMV CMV ,**0,,**1 - S -,/ -2.* +.* CMV : *0* *2+/ +/ CMV ,**2 1 +.
**2 The Japanese Society for AIDS Research The Journal of AIDS Research AIDS + + + + + + + - : CMV CMV AIDS : /1 **1 - CMV HIV : CMV CMV : AIDS HIV +* : ** */ **2 CMV AIDS CT + CMV CMV + CRP AST AIDS LDH
More informationAIDS. 1) Mycobacterium avium MRI (T2WI) HTLV-1 AIDS. Key words: Mycobacterium avium AIDS. Mycobacterium. complex MAC M. avium M.
2008 193 AIDS Mycobacterium avium 1) 2) 3) 4) 4) 3) 3) 3) 5) 1) 6) 1) 2) 3) 4) 5) 6) 20 1 30 20 6 13 46 MRI (T2WI) MRI 5 Mycobacterium avium M. avium HIV HTLV-1 AIDS AIDS Key words: Mycobacterium avium
More informationHiroyuki Kamiya 1), Soichiro Ikushima 1), Tetsu Sakamoto 1), Kozo Morimoto 1), Tsunehiro Ando 1), Masaru Oritsu 1), Atsuo Goto 2), Tamiko Takemura 3)
29 2001 ACE39.7IU/l X TBLB 2002 11 Langhans [ ] A Case of Granulomatous Interstitial Nephritis with Progressive Renal Impairment Due to Sarcoidosis in the Course of Spontaneous Improvement of Pulmonary
More informationCavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
PEDIATRIC CARDIOLOGY and CARDIAC SURGERY VOL. 25 NO. 1 (56 60) 1 1 1 2 2 3 4 1 2 3 4 Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
More informationPerforation of a Duodenal Diverticulum. Elective Student S. C.
Perforation of a Duodenal Diverticulum 2008 4 Elective Student S. C. Case History An elderly male presented to the Emergency Department with abdominal pain. Chief Complaint: Worsening, diffuse abdominal
More informationPrimary adrenal lymphoma with adrenal insufficiency : report of three cases and review of literature
Primary adrenal lymphoma with adrenal insufficiency : report of three cases and review of literature Masumi Ogawa 1, Naoki Edo 1, Takuji Matsuo 1, Tadashi Yamamoto 1, Satoshi Takahashi 1, Yamato Mashimo
More informationYOSHIKAWA, MD 1 HASHIMOTO, MD,FJCC
1 Interstitial Pneumonitis Followed by Syndrome of Inappropriate Antidiuretic Hormone Secretion Induced by Amiodarone Therapy for Dilated Cardiomyopathy : A Case Report 1 2 Shunji Makoto Naoaki Shunichi
More information, copies ml PSL .. -0,2 HIV HCV. ml, HIV- HIV HIV-TP HCV-RNA. HIV ddi, -TC. AZT TDF FTC ratv ,**3 : HIV HIV-TP HIV HIV HIV-TP +
,** The Japanese Society for AIDS Research The Journal of AIDS Research HIV HIV + : HIV HIV-TP HIV HIV HIV-TP + :.. + A,2 HIVHCV -* CD. ddi -., / ml, HIV-RNA +**.** copyml.+ HIV-RNA ++*** copiesml ***
More informationBRONCHOGENIC CARCINOMA CHALLENGES IN EVALUATION
BRONCHOGENIC CARCINOMA CHALLENGES IN EVALUATION GRAND ROUND WARD 7C DATE: 25 TH MARCH 2015 PRESENTER: DR E. SAYO FACILITATOR: DR J MECHA DEMOGRAPHIC DATA NAME : CM AGE: 69 YEARS ADDRESS : KIAMBU OCCUPATION:
More informationEndoscopic Retrograde Cholangiopanc. Yamada, Masashi; Eguchi, Katsumi. Citation Acta medica Nagasakiensia. 2003, 48
NAOSITE: Nagasaki University's Ac Title Author(s) A Case of Pancreatic Ascites and Pl Pancreatic Duct Contrast Leakage Us Endoscopic Retrograde Cholangiopanc Matsumoto, Kojiro; Tanigawa, Ken; N Yamada,
More informationCoronary Artery Embolism From Ruptured Plaque in the Left Main Trunks With Difficulty in Detection of Culprit Lesion: A Case Report
J Cardiol 2005 Mar; 453: 115 121 1 Coronary Artery Embolism From Ruptured Plaque in the Left Main Trunks With Difficulty in Detection of Culprit Lesion: A Case Report Takatomi Eiji Shinya Yasuhiro Kazuo
More informationE#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro
More informationScedosporium apiospermum
223 Scedosporium apiospermum 1 1) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 7 14 16 10 12 Candida Aspergillus 82 2000 10 2001 1 12 MRI 2 1 Scedosporium apiospermum Key words: Scedosporium apiospermum, Aspergillus,
More information2018/6/7 APSN/JSN CME Course Division of Nephrology St. Luke s International Hospital Raku Son M.D., PGY6
2018/6/7 APSN/JSN CME Course 2018 Division of Nephrology St. Luke s International Hospital Raku Son M.D., PGY6 Case1 77F Left leg pain Na 112 Case2 39M Seizure Na 117 Case3 73M General malaise Na 120 Case1
More informationControls & Calibrators Clinical Chemistry
Controls & Calibrators Clinical Chemistry Clinical Chemistry Controls & Lipids Clinical Chemistry and lipid quality controls have been manufactured from true human serum to ensure they perform the same
More informationNodular Muscular Sarcoidosis Extending to All Limb Muscles
47 1997 CD4/8 MRI T1 T2 74.6 IU/l 46.0 µg/ml MRI [ ] MRI Nodular Muscular Sarcoidosis Extending to All Limb Muscles Takahiro Nishitake, Eishi Miyazaki, Masaru Ando, Tetsujiro Fukami, Osamu Matsuno, Takuya
More informationLeft Ventricular Dysfunction Without Brain Natriuretic Peptide Elevation:
J Cardiol 2007 Mar; 49 3 : 149 153 2 Left Ventricular Dysfunction Without Brain Natriuretic Peptide Elevation: Two Case Reports Yuko Hajime Tomoharu Yasumichi Takeya Shunsuke Shohei Shuji Junichi TOGANE,
More informationCase Rep Gastroenterol 2010;4: DOI: /
261 Very-Low-Dose Pegylated Interferon α2a Plus Ribavirin Therapy for Advanced Liver Cirrhosis Type C: A Possible Therapeutic Alternative without Splenic Intervention Shogo Ohkoshi Satoshi Yamagiwa Masahiko
More informationcm 8 1 / Computed Tomography CT Fig Tel:
12 103 107 2003 1 1 1 1 2 1 25 1.5 1.2cm 8 1 / 3 12 103 107 2003 1 2 5 25 1999 Computed Tomography CT 2000 1Tel: 03-5803-5253 2 113-8519 1-5-45 2002 8 26 2003 4 1 11 16 162.4cm 46kg 37.2 C 102 / 66mmHg72
More informationSubject ID: I N D # # U A * Consent Date: Day Month Year
IND Study # Eligibility Checklist Pg 1 of 15 Instructions: Check the appropriate box for each Inclusion and Exclusion Criterion below. Each criterion must be marked and all protocol criteria have to be
More informationPreemptive Kidney Transplantation ~ Case study ~
16/06/2016 Yokohama APCN/JSN CME course 2016 Preemptive Kidney Transplantation ~ Case study ~ Nagoya Daini Red Cross Hospital Department of Transplant Surgery Makoto Tsujita Statement of Disclosure The
More informationCitation Acta Medica Nagasakiensia. 1992, 37
NAOSITE: Nagasaki University's Ac Title Author(s) An Autopsy Case of Acute Intermitte Murase, Kunihiko; Makiyama, Kazuya; Nonaka, Shigeru Citation Acta Medica Nagasakiensia. 1992, 37 Issue Date 1992-12-25
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationThyroid Storm Complicated by Bicytopenia and Disseminated Intravascular Coagulation
ISSN 1941-5923 DOI: 10.12659/AJCR.890519 Received: 2014.02.12 Accepted: 2014.03.14 Published: 2014.07.24 Thyroid Storm Complicated by Bicytopenia and Disseminated Intravascular Coagulation Authors Contribution:
More informationKohno, Shigeru; Hara, Kohei. Citation Acta medica Nagasakiensia. 1995, 40
NAOSITE: Nagasaki University's Ac Title Author(s) Three Cases of Tsutsugamushi Diseas Clarithromycin. Miura, Naoki; Kudoh, Yuhichi; Osabe Kohno, Shigeru; Hara, Kohei Citation Acta medica Nagasakiensia.
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationManagement of acute alcoholic hepatitis
Management of acute alcoholic hepatitis Yesim ALAHDAB Marmara University Hospital, Istanbul/TURKEY 5 th European Young Hepatologists Workshop August, 27-29, 2015 Moulin de Vernègues, France 1.4L ALCOHOL
More informationTHREE CASES OF THINNER-SNIFFING AND ESTIMATING THE FATAL CONCENTRATION OF TOLUENE BY TOXICOKINETICS
THREE CASES OF THINNER-SNIFFING AND ESTIMATING THE FATAL CONCENTRATION OF TOLUENE BY TOXICOKINETICS Tatsuya HOBARA, Masayuki OKUDA, Masayuki GOTOH, Kouichi OKI, Hiroyuki SEGAWA, Ichiro KUNITSUGU Department
More informationCase 5 15-year-old male
Case 5 15-year-old male Present illness: Six months ago, abnormality of ECG was incidentally detected by annual health check. His blood level of γ-gtp, HbA1c and norepinephrine were elevated; however,
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationThe Efficacy of Corticosteroid Therapy in a Patient with Nonalcoholic Steatohepatitis Overlapping Autoimmune Hepatitis: A Case Report
doi: 10.2169/internalmedicine.8887-17 Intern Med Advance Publication http://internmed.jp CASE REPORT The Efficacy of Corticosteroid Therapy in a Patient with Nonalcoholic Steatohepatitis Overlapping Autoimmune
More informationElevation of Serum Cytokines Preceding Elevation of Liver Enzymes in a Case of Drug-Induced Liver Injury
1 Elevation of Serum Cytokines Preceding Elevation of Liver Enzymes in a Case of Drug-Induced Liver Injury Keisuke Kakisaka 1)2) Yasuhiro Takikawa 2) 1) Department of Gastroenterology, Kazuno Kosei Hospital,
More informationAbaxis Piccolo xpress TM
Abaxis Piccolo xpress TM A breakthrough in point-of care diagnostics A breakthrough in point of care diagnostics Fast, easy, accurate on-site testing The Piccolo xpress TM is a fully automated system,
More informationSternoclavicular joint septic arthritis with chest wall abscess in a healthy adult: a case report
Tanaka et al. Journal of Medical Case Reports (2016) 10:69 DOI 10.1186/s13256-016-0856-0 CASE REPORT Open Access Sternoclavicular joint septic arthritis with chest wall abscess in a healthy adult: a case
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationMechanical versus bioprosthetic valve. Intern: Supervisor: VS
Mechanical versus bioprosthetic valve Intern: Supervisor: VS Patient basic data ID: N102110716 Name: Age: 64 years old Sex: male Occupation: Admission date: 0960528 Chief complaint Exertional dyspnea for
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationHyperaldosteronemia and hypogammaglobulinemia secondary to atopic dermatitis-induced exudation in an infant presenting with growth failure
Tokai J Exp Clin Med., Vol. 32, No. 1, pp. 18-22, 2007 Hyperaldosteronemia and hypogammaglobulinemia secondary to atopic dermatitis-induced exudation in an infant presenting with growth failure Tsuyoshi
More informationSoy isoflavones inducing overt hypothyroidism in a patient with chronic lymphocytic thyroiditis: a case report
Nakamura et al. Journal of Medical Case Reports (2017) 11:253 DOI 10.1186/s13256-017-1418-9 CASE REPORT Open Access Soy isoflavones inducing overt hypothyroidism in a patient with chronic lymphocytic thyroiditis:
More informationComplete Atrioventricular Block Associated with Pembrolizumab-induced Acute Myocarditis: The Need for Close Cardiac Monitoring
doi: 10.2169/internalmedicine.0255-17 http://internmed.jp CASE REPORT Complete Atrioventricular Block Associated with Pembrolizumab-induced Acute Myocarditis: The Need for Close Cardiac Monitoring Yumi
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD II, Session XII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD II April 21, 2014 STUDENT COPY Helpful Resource: ACP Medicine online available through LUHS Library Infectious
More informationSimultaneous and Rapid Detection of Causative Pathogens in Community-acquired Pneumonia by Real-time PCR (1167)
From the Japanese Association of Medical Sciences The Japanese Association for Infectious Diseases Simultaneous and Rapid Detection of Causative Pathogens in Community-acquired Pneumonia by Real-time PCR
More informationSevere Alcoholic Hepatitis Effectively Treated with Vitamin E as an Add-on to Corticosteroids
doi: 10.2169/internalmedicine.8767-16 http://internmed.jp CASE REPORT Severe Alcoholic Hepatitis Effectively Treated with Vitamin E as an Add-on to Corticosteroids Yuichi Miyashima, Michihiko Shibata,
More information2) An 87 year old female who is 2 weeks post TKR presents with a sore swollen knee. She has a history of atrial fibrillation. Her vital signs are:
EMQ - Rheumatology For each clinical vignette match the correct diagnosis. Reiter s syndrome Pseudogout Septic arthritis Gout Haemarthrosis Traumatic effusion Ankylosing spondylitis Rheumatoid arthritis
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationThe East Japan Great Earthquake and Three Cases of Near-Drowning with Tsunami Due to the Earthquake
Open Journal of Clinical Diagnostics, 2014, 4, 145-151 Published Online September 2014 in SciRes. http://www.scirp.org/journal/ojcd http://dx.doi.org/10.4236/ojcd.2014.43023 The East Japan Great Earthquake
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More information2012/3/22. WBC 7400 /µl RBC /µl Hb 10.9 g/dl Plt /µl
Case 3 A case of MPGN type 3, second form Post-meeting material onset and course He has been treated with medication against hypertension, hyperlipidemia, and hyperuricemia in clinics from 1994 (40 yrs
More informationShunpei Hama, 1 Fumiaki Inori, 1 Dai Momose, 2 and Sadahiko Konishi Introduction. 2. Case Report
Case Reports in Orthopedics Volume 2015, Article ID 469879, 4 pages http://dx.doi.org/10.1155/2015/469879 Case Report Total Hip Arthroplasty for Rapidly Destructive Coxarthrosis in a Patient with Severe
More informationA long-lasting FUO. Martial, 34, carpenter
A long-lasting FUO Martial, 34, carpenter No significant medical history Married, wife pregnant 2 healthy children Lives in a rural area Biking, jogging, parachuting 1 pet cat No travel abroad A long story
More informationOriginal Research Article
Medrech ISSN No. 2394-3971 Original Research Article TYPE 2 DIABETES WITH RECURRENT OSTEOPOROTIC FRACTURES, OR CUSHING S SYNDROME? Blertina Dyrmishi¹*; Taulant Olldashi²; Prof Asc Thanas Fureraj 3 ; Prof
More informationDisclosures. Learning Objectives 4/21/2015. Incorporating Nutrition-Focused Physician Assessment into Malnutrition Diagnosis. None
Incorporating Nutrition-Focused Physician Assessment into Malnutrition Diagnosis Robert DeChicco MS, RD, LD, CNSC Manager, Nutrition Support Team Center for Human Nutrition Cleveland Clinic Health System,
More informationACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
More informationReactivation of Occult Hepatitis B Virus Infection 27 Months after the End of Chemotherapy Including Rituximab for Malignant Lymphoma
CASE REPORT Reactivation of Occult Hepatitis B Virus Infection 27 Months after the End of Chemotherapy Including Rituximab for Malignant Lymphoma Junichi Muraishi, Michihiko Shibata, Yuichi Honma, Masaaki
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationTrapianto di fegato e organi solidi. Pierluigi Toniutto Sezione di Epatologia e Trapianto Epatico Università di Udine
Trapianto di fegato e organi solidi Pierluigi Toniutto Sezione di Epatologia e Trapianto Epatico Università di Udine Case 2 53-yr old white man PSC (CTP score 10, MELD 23, status UNOS 2B) HBsAb-, HBcAb-
More informationCitation Acta medica Nagasakiensia. 1996, 41
NAOSITE: Nagasaki University's Ac Title Author(s) Extracorporeal Shock Wave Lithotrip Lithotomy for Pancreatolithiasis : Furukawa, Masato; Okuhama, Yukihiro Kosei; Mine, Yoshikazu; Sasaki, Mak Yoshihiko;
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationMEDIC CENTER. Case 2
Case 2 Case history 57 year old Vietnamese man He lives in HCM city and works as a engineer The patient presented in July 2012 with fatigue Diagnosed with HCV in 2004 Negative for both HBV and HIV antibodies
More informationComparison of Different Scoring System in Predicting the Severity and Prognosis of Acute Pancreatitis
IOSR Journal of Dental and Medical Sciences (IOSR-JDMS) e-issn: 2279-0853, p-issn: 2279-0861.Volume 17, Issue 5 Ver. 3 (May. 2018), PP 56-60 www.iosrjournals.org Comparison of Different Scoring System
More informationGenetic programming applied to Collagen disease & thrombosis.
Genetic programming applied to Collagen disease & thrombosis. James Cunha Werner, Terence C. Fogarty SCISM South Bank University 103 Borough Road London SE1 0AA {werner,fogarttc}@sbu.ac.uk Abstract. This
More informationACVECC Small Animal Benchmark, May 2012
ACVECC Small Animal Benchmark, May 2012 A 25 kg, 9 y MC Labrador Retriever presents with a 2-day history of cough and tachypnea. Physical exam revealed T 101.7 F, HR 120 BPM, pulses strong and synchronous,
More informationCASE A 58-year-old woman, office worker CC : fatigue and weakness
CASE A 58-year-old woman, office worker CC : fatigue and weakness HISTORY OF PRESENT ILLNESS About 7 days before admission, she lost her appetite and had a sensation of thirst. She had difficulties to
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationEvaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
More informationMorbidity Conference. Presented by 肝膽腸胃科張瀚文
Morbidity Conference Presented by 肝膽腸胃科張瀚文 Chief Complaint General weakness for three days Present Illness This 63-year-old female with diabetes and on oral hypoglycemic agents presented with 3-day history
More informationFulminant Type 1 Diabetes Mellitus Presenting 15 Days after Delivery Diagnosed in Cooperation with Obstetricians
doi: 10.2169/internalmedicine.0878-18 Intern Med 57: 2859-2863, 2018 http://internmed.jp CASE REPORT Fulminant Type 1 Diabetes Mellitus Presenting 15 Days after Delivery Diagnosed in Cooperation with Obstetricians
More informationCASE-BASED SMALL GROUP DISCUSSION MHD II
MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby
More informationLaboratory diagnosis of plasma proteins and plasma enzymes
Laboratory diagnosis of plasma proteins and plasma enzymes Functions of plasma proteins Function: transport humoral immunity enzymes protease inhibitors maintenance of oncotic pressure buffering Example:
More informationBIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
More informationEvaluation of liver enzymes in asymptomatic chronic hepatitis B virus infected pregnant women
ORIGINAL ARTICLE Annals of Gastroenterology (2013) 26, 59-65 Evaluation of liver enzymes in asymptomatic chronic hepatitis B virus infected pregnant women Ioannis S. Elefsiniotis a, Hero Brokalaki a, Evangelos
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationB. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle
Radiation Therapy Oncology Group Phase II Study Pre-operative Chemo- Radiation + Panitumumab for Potentially Operable Lung Cancer Concurrent Summary Form AMENDED DATA YES INSTRUCTIONS: Submit all pages
More informationCase Presentation. Rafid Asfar, MD
Case Presentation Rafid Asfar, MD Introduction ANCA associated vasculitis may be localized or systemic, and can involve the eyes Ocular manifestations can occur in the absence of systemic disease in persons
More informationEvaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More informationSession 1: Circuit, Anticoagulation and Monitoring. Ashita Tolwani, MD, MSc Noel Oabel, BSN, RN, CNN 2019
Session 1: Circuit, Anticoagulation and Monitoring Ashita Tolwani, MD, MSc Noel Oabel, BSN, RN, CNN 2019 Goals n Learn how to set up citrate anticoagulation for CVVH, CVVHD, CVVHDF using Prismaflex n Determine
More informationVAD. ALT TP Glb Ca CT MRI. . mg/dl X X A CT VAD VAD. GdhDTPA T.
VAD h h h hh ALTTPGlbCa CTMRI MP Ca VAD QOL VAD MP MP VAD MP VAD kg PCV.;RPI.WBC,/l ALT IU/l TP. g/dlglb. g/dl Ca. mg/dl X X A CT MRI CT BCT MRI T T GdhDTPAT T ChF h h hh FAX hh E-mail : sayochan@vet.osakafu-u.ac.jp
More informationWhat is meant by Thrombotic Microangiopathy (TMA)?
What is meant by Thrombotic Microangiopathy (TMA)? Thrombotic Microangiopathy (TMA) is a group of disorders characterized by injured endothelial cells, microangiopathic hemolytic anemia (MAHA), with its
More informationTakuya SAKODA* ), Yoshiaki MURAKAMI, Naru KONDO, Kenichiro UEMURA, Yasushi HASHIMOTO, Naoya NAKAGAWA and Taijiro SUEDA ABSTRACT
Hiroshima J. Med. Sci. Vol. 64, No. 3, 45~49, September, 2015 HIJM 64 8 45 Takuya SAKODA* ), Yoshiaki MURAKAMI, Naru KONDO, Kenichiro UEMURA, Yasushi HASHIMOTO, Naoya NAKAGAWA and Taijiro SUEDA Department
More informationThe Sequential Development of Antiglomerular Basement Membrane Nephritis and Myeloperoxidase-antineutrophil Cytoplasmic Antibody-associated Vasculitis
doi: 10.2169/internalmedicine.8757-16 http://internmed.jp CASE REPORT The Sequential Development of Antiglomerular Basement Membrane Nephritis and Myeloperoxidase-antineutrophil Cytoplasmic Antibody-associated
More informationIncreased Serum KL-6 Levels Induced by Pulmonary Mycobacterium Avium Complex Infection in a Patient with RA-associated Lung Disease
2016 70 3 217-221 CopyrightC 2016 by Okayama University Medical School. Case Report http ://escholarship.lib.okayama-u.ac.jp/amo/ Increased Serum KL-6 Levels Induced by Pulmonary Mycobacterium Avium Complex
More informationCASE REPORT. Introduction. Case Report. Keisuke Kasuga 1,MinakoSako 1, Shogo Kasai 1, Hiroshi Yoshimoto 1, Kuniko Iihara 2 and Hideaki Miura 1
doi: 10.2169/internalmedicine.9856-17 Intern Med 57: 2585-2590, 2018 http://internmed.jp CASE REPORT Rat Bite Fever Caused by Streptobacillus moniliformis in a Cirrhotic Patient Initially Presenting with
More informationCase report. Yasutsugu Fukushima, 1 Kazuki Obara, 1 Hirokuni Hirata, 1 Kumiya Sugiyama, 1 Takeshi Fukuda 1 and Kazuhiko Takabe 2
Case report Three Japanese patients (mother and two children) with familial Mediterranean fever associated with compound heterozygosity for // and an autosomal true dominant inheritance pattern Yasutsugu
More informationEasy Trick to Spot Leukemia for Pediatricians
Easy Trick to Spot Leukemia for Pediatricians Piya Rujkijyanont, MD Division of Hematology-Oncology Department of Pediatrics Phramongkutklao Hospital Most Common Pediatric Cancers Age 0-14 Leukemia 32%
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO
ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CENTRO MARIO DI NEGRI RICERCHE INSTITUTE CLINICHE FOR PHARMACOLOGICAL PER LE MALATTIE RESEARCH RARE CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES
More informationPancreatic Fistula Extending into the Thigh Caused by the Rupture of an Intraductal Papillary Mucinous Adenoma of the Pancreas
CASE REPORT Pancreatic Fistula Extending into the Thigh Caused by the Rupture of an Intraductal Papillary Mucinous Adenoma of the Pancreas Yuki Shimizu 1, Hiroshi Imaizumi 1, Hiroshi Yamauchi 1, Kosuke
More informationa 62-year-old man, a car driving instructor complaining of thigh purpura NMC resident, General internal medicine
a 62-year-old man, a car driving instructor complaining of thigh purpura MAKOTO INADA NMC resident, General internal medicine Chief complaint purpura at right thigh History of Present Illness He had been
More information