Prof. Isabelle Six INSERM Unit 1088 Jules Verne University of Picardie Amiens, France. Slide 1. Slide 2
|
|
- June Page
- 5 years ago
- Views:
Transcription
1 Effects of phosphate on vascular function New insights Isabelle Six, Amiens, France Chairs: Griet Glorieux, Ghent, Belgium Alberto Ortiz, Madrid, Spain Prof. Isabelle Six INSERM Unit 1088 Jules Verne University of Picardie Amiens, France Slide 1 Slide 2
2 As you know, high serum phosphorous levels increase risk of death due to cardiovascular disease both in patients with CKD and in people with normal kidney function. Phosphorous concentration in the upper range of normal: greater carotid intima-media thickness, overt atherosclerosis, increased risk of cardiovascular disease and induced endothelial dysfunction. Slide 3 CKD is associated with increased cardiovascular mortality, arterial calcifications, hyperphosphatemia and endothelial dysfunction. Slide 4
3 Several studies have shown Slide 5 that vascular calcification is one of the possible mechanisms linking high phosphate levels to adverse cardiovascular outcomes in patients with chronic renal failure. It has been demonstrated that controlling serum phosphorous slows the progression of vascular calcifications and may have a beneficial impact on the survival of haemodialysis patients. Slide 6
4 The aims of the present study were to investigate the role of phosphate in vascular dysfunction in both CKD and intact renal function and investigate the therapeutic potential of a phosphate binder, Sevelamer to prevent these disturbances. Slide 7 First of all, we tested effects of in vitro exposure to high phosphate concentration. The direct effects on vascular reactivity were analysed by stimulating the cells with increasing concentrations of phosphate and measuring changes in the isometric force. The effects of phosphate on ROS production and Erk activation were analysed using HUVEC, a human vascular smooth muscle cells culture. To study long-term effects of high phosphate concentration autocrines were placed in culture with phosphate for 8 days. Slide 8
5 We investigated the effects of a high phosphate diet on aortic reactivity in non-ckd and CKD mice Slide 9 and compared them with the effects in mice fed a normal diet. The standard diet contained 0.65% of phosphate. We opted for a double amount of phosphate in the diet, 1.3% and an intermediate level 1%.
6 Slide 10 In the second part, we investigated the effects of Sevelamer treatment first of all in vitro. Aortic rings were placed in culture with phosphate for 5 days with addition or not of Sevelamer the last 6 days of culture. Slide 11
7 Sevelamer effects were initiated in vivo in CKD mice. Sevelamer or placebo was administrated as a 3% mix with animal --. Sevelamer treatment was started 2 weeks after CKD induction and continued for 8 weeks. Slide 12 For results the addition of phosphate induced a concentration-dependent vascular constriction, which however was significantly less intensive in 18 weeks from CKD mice than from non-ckd mice. Moreover, the contractions of 18 weeks from non-ckd mice were abolished by --- scavenger of --. Slide 13
8 In models phosphate at concentrations of 2 and 3 mmol increased ROS production only in smooth muscle cells culture. Moreover, phosphate induced a concentration-dependent Erk activation in smooth muscle cells culture. Slide 14 We investigated the effect of a high phosphate diet on aortic reactivity in non-ckd and CKD mice. The high phosphate diet increased constriction in response to Phenylephrine. Slide 15 CKD had no effect on vascular constriction capacity. Slide 16
9 However, CKD-induced endothelial dysfunction as demonstrated by an impairment in relaxation in response to acetylcholine. Similarly, a high phosphate diet induced endothelin dysfunction and dysfunction was not further aggravated by CKD. Slide 17 dysfunction was not further aggravated by CKD. Slide 18
10 In the same model endothelial cells were examined by immunostaining. Slide 19
11 This figure clearly shows that a very high phosphate diet induced endothelial cell loss. Slide 20 In CKD animals, a cell effect was observed with the 1% phosphate diet. Slide 21
12 In the non-ckd 1% phosphate diet group there was no focal detachment or denudation of endothelial cells. However, there were subendothelial vacuoles possibly indicative of imminent endothelial detachment. Slide 22 We examined adhesion molecule expression and we demonstrated that CKD induced an increase in the expression of adhesion molecules VCAM-1 and ICAM-1. In the same manner, a high phosphate diet was associated with an increase in VCAM-1 and ICAM-1 expression. Slide 23
13 In the second part, the therapeutical effect of Sevelamer was investigated. Exposure of aortic rings to 3 mmol of phosphate for 8 days resulted in lower relaxation. Slide 24 This decrease was entirely abolished in the presence of Sevelamer. Slide 25
14 In this model Sevelamer was able to improve deleterious effects Slide 26 of high phosphate concentration. Slide 27
15 In the same model, endothelial immunostaining revealed a loss of endothelial integrity in aortic rings exposed to 3 mmol of phosphate for 8 days with only 70% of endothelial cells remaining present on the luminal surface. The adjunction of Sevelamer reduced the deleterious impact of phosphate on the endothelium with maintenance of integrity of 82%. Slide 28 In this protocol
16 Slide 29 Sevelamer effect was investigated in vivo in CKD mice. CKD under a normal phosphate diet had no effect on vasoconstriction but induced endothelial dysfunction as demonstrated by a weaker response to acetylcholine. Slide 30
17 Sevelamer treatment significantly improved the CKD-induced endothelial dysfunction. Slide 31 In the same model we analysed adhesion molecule expression and we demonstrated that CKD under Slide 32 a normal phosphate diet led to stronger stimulation of endothelial VCAM-1 and ICAM-1
18 expression. Slide 33 Treatment with Sevelamer attenuated the VCAM-1 and ICAM-1 upregulation in CKD mice. Slide 34 To summarise, we demonstrated in this study that increasing phosphate induced a contraction of aortic rings and a decrease in endothelium-dependent relaxation, an increase of ROS expression and Erk activation, a loss of endothelium integrity associated with an increase of adhesion molecule expression.
19 Slide 35 CKD by itself induced an impairment of endothelial-dependent relaxation and an increase of adhesion molecule expression. Sevelamer treatment can improve this phenomenon. Slide 36
20 Sevelamer treatment can improve this phenomenon. Slide 37 In conclusion, changes in extracellular phosphorous concentration may directly modulate vascular function and thereby modulate the vascular smooth muscle response to physiological or pathological stimuli in normal and CKD mice. Perspectives are to establish if serum phosphorous lowering and/or dietary phosphate restriction can improve arterial function in humans. Slide 38
21 To conclude definitively if you need more information about this study, you can check the paper published in Cardiovascular Research. Thank you for your attention. Slide 39 Chairman: Thank your Isabelle for this presentation. The paper is now open for discussion. Are there questions from the audience? Thank you. Question: Maybe it's a stupid question, I'm not an expert at all but if you add Sevelamer to the phosphate, there is eventually no free phosphate available,is this correct? Prof. Six: In which case I wonder whether you should not see no effect at all anymore, in other words it should look like the control without the phosphate on your slides and it doesn't. Can you enlighten me here? We have few protocols, in the first one we put phosphate, in the second one we put Sevelamer in the presence of CKD. If I understand your question, the question is to put Sevelamer and phosphate together? You still have an effect of the phosphate plus Sevelamer versus the control on your slides and I wouldn't expect to see any effects all the phosphate should be gone in the presence of Sevelamer but maybe I don't understand it right. In culture models we put phosphate in the first two days and after we put Sevelamer in the 6 lag days of culture. We have a control with phosphate alone and with Sevelamer alone during the 8 days of culture. Question: OK thanks. We have no effect of course of Sevelamer only in culture.
22 Chairman: Are there any more questions from the audience? Question: I wonder if Sevelamer captures other uremic toxins like when used in a CKD in vivo model? Other things form phosphate? Prof. Six: Yes in the study we targeted just phosphate with Sevelamer but probably we can imagine a pleiotropic effect of Sevelamer in other uremic toxins and it will be great to test the effect of other uremic toxins in this kind of model. Question: Ok thank you. Question: Isabelle in humans in the clinic Sevelamer hydrochloride is associated with acidosis. When you added Sevelamer hydrochloride to the cultures did the ph change? Prof. Six: Nothing, we checked all the parameters in the culture medium and we had no effect on ph and no effect on other parameters. In culture and in the model of vascular reactivity. Question: Another question, in the aortic rings in culture the endothelial cells were lost. Why were they lost? Were they dying? If they were dying what was the mode of cell death? Do you have an idea on that? Prof. Six: The growth of endothelial cells? The endothelial cells were lost in the aortic rings, I understood when you cultured the aortic rings. When you culture the aorta, you have the same effect on endothelial cells as when you pick up minutes before. You have no growth of endothelial ells, you have a perfect aorta when you put the aorta in a cultured --- and no growth of endothelial cells in this aorta in some conditions. Question: OK, maybe I didn't understand correctly but I understood that endothelial cells were lost from the rings, that was not the case ok. Thank you. Chairman: We have time for one more question. Question: But you said ---- to activate --- the question is of phosphate mediated by oxidative stress? In other words if you prevent oxidative stress in the presence of phosphate, would you blunt Erk 1, 2 phosphorylation? Prof. Six: No we didn't block Erk 1, 2 phosphorylation. We proved the effects of phosphate on ROS production. We proved the effect of ROS production on contraction effects but we didn't block Erk activation. We didn't. Question: Thank you. Chairman: Ok thank you.
THE ROLE OF URIC ACID IN THE PROGRESSION OF CKD Mehmet Kanbay, Istanbul, Turkey
THE ROLE OF URIC ACID IN THE PROGRESSION OF CKD Mehmet Kanbay, Istanbul, Turkey Chairs: Gerjan Navis, Groningen, The Netherlands Kamil Serdengecti, Istanbul, Turkey Dr. M. Kanbay Division of Nephrology
More informationThe Study of Endothelial Function in CKD and ESRD
The Study of Endothelial Function in CKD and ESRD Endothelial Diversity in the Human Body Aird WC. Circ Res 2007 Endothelial Diversity in the Human Body The endothelium should be viewed for what it is:
More informationProf. Michel Jadoul Cliniques universitaires St-Luc Université Catholique de Louvain Brussels, Belgium. Slide 1
Phosphate and cardiovascular disease beyond CKD: is phosphate a new cholesterol? Michel Jadoul, Brussels, Belgium Chairs: Pablo Urena Torres, Saint-Ouen, France Carmine Zoccali, Reggio Calabria, Italy
More informationProf. Andrzej Wiecek Department of Nephrology, Endocrinology and Metabolic Diseases Medical University of Silesia Katowice, Poland.
What could be the role of renal denervation in chronic kidney disease? Andrzej Wiecek, Katowice, Poland Chairs: Peter J. Blankestijn, Utrecht, The Netherlands Jonathan Moss, Glasgow, UK Prof. Andrzej Wiecek
More informationThe ERA JUMP Study: Reevaluating the Omega- 3 Index
Transcript Details This is a transcript of an educational program accessible on the ReachMD network. Details about the program and additional media formats for the program are accessible by visiting: https://reachmd.com/programs/lipid-luminations/the-era-jump-study-reevaluating-the-omega-3-
More informationProf. Armando Torres Nephrology Section Hospital Universitario de Canarias University of La Laguna Tenerife, Canary Islands, Spain.
Does RAS blockade improve outcomes after kidney transplantation? Armando Torres, La Laguna, Spain Chairs: Hans De Fijter, Leiden, The Netherlands Armando Torres, La Laguna, Spain Prof. Armando Torres Nephrology
More informationProf. David Wheeler Centre for Nephrology Royal Free Campus University College London Medical School London, UK. Slide 1
LDL-CHOLESTEROL AND CV RISK IN CKD: EPIDEMIOLOGY VS. CLINICAL TRIALS David Wheeler, London, UK Chairs: Maurice Laville, Lyon, France Erling B. Pedersen, Holstebro, Denmark Prof. David Wheeler Centre for
More informationEffects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts
Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts Serena Del Turco, Teresa Navarra, Giuseppina Basta, Raffaele De
More informationEFFECT OF ONLINE HAEMODIAFILTRATION ON ALL- CAUSE MORTALITY AND CARDIOVASCULAR OUTCOMES Ercan Ok, Izmir, Turkey
EFFECT OF ONLINE HAEMODIAFILTRATION ON ALL- CAUSE MORTALITY AND CARDIOVASCULAR OUTCOMES Ercan Ok, Izmir, Turkey Chair: Walter H. Hörl, Vienna, Austria Wojciech Zaluska, Lublin, Poland Prof Ercan Ok Division
More informationThe dynamic regulation of blood vessel caliber
INVITED BASIC SCIENCE REVIEW The dynamic regulation of blood vessel caliber Colleen M. Brophy, MD, Augusta, Ga BACKGROUND The flow of blood to organs is regulated by changes in the diameter of the blood
More informationKDIGO. CKD- MBD: Is the Term S2ll Jus2fied? Tilman B. Drüeke
CKD- MBD: Is the Term S2ll Jus2fied? Tilman B. Drüeke Unité 1088 de l Inserm UFR de Médecine et de Pharmacie Jules Verne University of Picardie Amiens, France Poten2al conflicts of interest Research support:
More informationVascular calcification in stage 5 Chronic Kidney Disease patients on dialysis
Vascular calcification in stage 5 Chronic Kidney Disease patients on dialysis Seoung Woo Lee Div. Of Nephrology and Hypertension, Dept. of Internal Medicine, Inha Unv. College of Medicine, Inchon, Korea
More informationATHEROSCLEROSIS زيد ثامر جابر. Zaid. Th. Jaber
ATHEROSCLEROSIS زيد ثامر جابر Zaid. Th. Jaber Objectives 1- Review the normal histological features of blood vessels walls. 2-define the atherosclerosis. 3- display the risk factors of atherosclerosis.
More informationTitle:Hyperphosphatemia as an Independent Risk Factor of Coronary Artery Calcification Progression in Peritoneal Dialysis Patients
Author's response to reviews Title:Hyperphosphatemia as an Independent Risk Factor of Coronary Artery Calcification Progression in Peritoneal Dialysis Patients Authors: Da Shang (sdshangda@163.com) Qionghong
More informationDr. Mehmet Kanbay Department of Medicine Division of Nephrology Istanbul Medeniyet University School of Medicine Istanbul, Turkey.
The uric acid dilemma: causal risk factor for hypertension and CKD or mere bystander? Mehmet Kanbay, Istanbul, Turkey Chairs: Anton H. van den Meiracker, Rotterdam, The Netherlands Claudia R.C. Van Roeyen,
More informationPharmacology - Problem Drill 11: Vasoactive Agents
Pharmacology - Problem Drill 11: Vasoactive Agents Question No. 1 of 10 1. Vascular smooth muscle contraction is triggered by a rise in. Question #01 (A) Luminal calcium (B) Extracellular calcium (C) Intracellular
More informationProf. Sandrine Florquin Department of Pathology Academic Medical Center University of Amsterdam Amsterdam, The Netherlands. Slide 1.
Interleukin 17 in renal biopsies as risk factor for progression Sandrine Florquin, Amsterdam, The Netherlands Chairs: Mohamed R. Daha, Leiden, The Netherlands Pierre Ronco, Paris, France Prof. Sandrine
More informationCardiovascular Mortality: General Population vs ESRD Dialysis Patients
Cardiovascular Mortality: General Population vs ESRD Dialysis Patients Annual CVD Mortality (%) 100 10 1 0.1 0.01 0.001 25-34 35-44 45-54 55-64 66-74 75-84 >85 Age (years) GP Male GP Female GP Black GP
More informationProf. Michael Joannidis Medical Intensive Care and Emergency Unit Department of Internal Medicine Medical University Innsbruck Innsbruck, Austria
1 di 27 Prevention of AKI: experimental promises and clinical realities Michael Joannidis, Innsbruck, Austria Chairs:Norbert Lameire, Ghent, Belgium Gert Mayer, Innsbruck, Austria Prof. Michael Joannidis
More informationSupplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
More informationSCIENTIFIC DISCUSSION
European Medicines Agency London, 01 June 2007 Product Name : Renagel Procedure No: EMEA/H/C/000254/II/56 SCIENTIFIC DISCUSSION 1/11 1. Introduction Renagel (sevelamer), a non-absorbed, calcium and metal-free
More information1. Distinguish among the types of blood vessels on the basis of their structure and function.
Blood Vessels and Circulation Objectives This chapter describes the structure and functions of the blood vessels Additional subjects contained in Chapter 13 include cardiovascular physiology, regulation,
More informationThoughtful vs. Dogmatic
Debate on Balloon Assisted Maturation The Biology is Wrong: BAM Won t Work BAM Dr. Rapp Debate BIVF Dr. Lawson Jeffrey H. Lawson, M.D., Ph.D. Departments of Surgery and Pathology Duke University Medical
More informationImproved Assessment of Aortic Calcification in Japanese Patients Undergoing Maintenance Hemodialysis
ORIGINAL ARTICLE Improved Assessment of Aortic Calcification in Japanese Patients Undergoing Maintenance Hemodialysis Masaki Ohya 1, Haruhisa Otani 2,KeigoKimura 3, Yasushi Saika 4, Ryoichi Fujii 4, Susumu
More informationShould cinacalcet be used in patients who are not on dialysis?
Should cinacalcet be used in patients who are not on dialysis? Jorge B Cannata-Andía and José Luis Fernández-Martín Affiliations: Bone and Mineral Research Unit. Hospital Universitario Central de Asturias.
More informationThe legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION. 28 March 2012
The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION 28 March 2012 OSVAREN 435 mg/235 mg, film-coated tablet Bottle of 180 (CIP: 382 886 3) Applicant: FRESENIUS MEDICAL
More informationANAEMIA MANAGEMENT: THE KDIGO RECOMMENDATIONS Patrick S. Parfrey, St. John s, Canada
ANAEMIA MANAGEMENT: THE KDIGO RECOMMENDATIONS Patrick S. Parfrey, St. John s, Canada Chair: Kai- Uwe Eckardt, Erlangen, Germany Pierre- Yves Martin, Geneva, Switzerland Prof. Patrick S. Parfrey Division
More informationStructure and organization of blood vessels
The cardiovascular system Structure of the heart The cardiac cycle Structure and organization of blood vessels What is the cardiovascular system? The heart is a double pump heart arteries arterioles veins
More informationmtor inhibitors lights and shadows Giuseppe Grandaliano, Foggia, Italy Chairs: Turgay Arinsoy, Ankara, Turkey Josep M. Grinyo, Barcelona, Spain
mtor inhibitors lights and shadows Giuseppe Grandaliano, Foggia, Italy Chairs: Turgay Arinsoy, Ankara, Turkey Josep M. Grinyo, Barcelona, Spain Prof. Giuseppe Grandaliano Nephrology Department Faculty
More informationPATIENTS AND METHODS:
BACKGROUND: Rheumatoid arthritis (RA) is a chronic systemic inflammatory disease characterized by erosive synovitis that involves peripheral joints and implicates an important influence in the quality
More informationSecondary Hyperparathyroidism: Where are we now?
Secondary Hyperparathyroidism: Where are we now? Dylan M. Barth, Pharm.D. PGY-1 Pharmacy Resident Mayo Clinic 2017 MFMER slide-1 Objectives Identify risk factors for the development of complications caused
More informationProf. Franco Ferrario Nephropathology Unit Department of Pathology San Gerardo Hospital Università Milan Bicocca Monza, Italy.
The role of repeated biopsies in the management of Lupus Nephritis Franco Ferrario, Milan, Italy Chairs: David Jayne, Cambridge, UK Vladimir Tesar, Prague, Czech Republic Prof. Franco Ferrario Nephropathology
More informationChoosing Study Outcomes that Reflect Cardiovascular Disease: From Biomarkers to Burden of Disease. Greg Wellenius Joel Kaufman
Choosing Study Outcomes that Reflect Cardiovascular Disease: From Biomarkers to Burden of Disease Greg Wellenius Joel Kaufman Framework for Choosing Subclinical Outcomes To Study What clinical outcomes
More informationHistology of the myocardium and blood vessels. Prof. Abdulameer Al-Nuaimi
Histology of the myocardium and blood vessels Prof. Abdulameer Al-Nuaimi E-mail: a.al-nuaimi@sheffield.ac.uk E-mail: abdulameerh@yahoo.com Histology of blood vessels The walls of arteries and veins are
More informationUNIT 4: BLOOD VESSELS
UNIT 4: BLOOD VESSELS Dr. Moattar Raza Rizvi NRS237, Physiology Generalized Structure of Blood Vessels 1 Tunica interna (tunica intima) Endothelial layer that lines the lumen of all vessels In vessels
More informationMuscle Cells & Muscle Fiber Contractions. Packet #8
Muscle Cells & Muscle Fiber Contractions Packet #8 Skeletal muscle is attached to bones and is responsible for movement. Introduction Introduction II Skeletal muscle is composed of bundles of muscle fibers
More informationC ardiovascular disease (CVD) and stroke are the main causes of morbidity and
Original Article DOI: 10.22088/cjim.9.4.347 Risk factors associated with aortic calcification in hemodialysis patients Alireza PeyroShabani 1 Mehrdad Nabahati (MD) 2, 3 MohammadAli Saber Sadeghdoust (MD)
More informationEPUB - CALCIUM SUPPLEMENTS AND HEART DOWNLOAD
01 June, 2018 EPUB - CALCIUM SUPPLEMENTS AND HEART DOWNLOAD Document Filetype: PDF 110.34 KB 0 EPUB - CALCIUM SUPPLEMENTS AND HEART DOWNLOAD A new study should put the final nail in the coffin for any
More informationRelaxation responses of aortic rings from salt-loaded high calcium fed rats to potassium chloride, calcium chloride and magnesium sulphate
Pathophysiology 4 (1998) 275 280 Relaxation responses of aortic rings from salt-loaded high calcium fed rats to potassium chloride, calcium chloride and magnesium sulphate B.J. Adegunloye, O.A. Sofola
More informationThe use of pathology surrogate markers in Fabry Disease. Beth L. Thurberg MD PhD Vice President of Pathology Genzyme
Disclaimer: Presentation slides from the Rare Disease Workshop Series are posted by the EveryLife Foundation for Rare Diseases for educational purposes only. They are for use by drug development professionals
More informationArteriosclerosis & Atherosclerosis
Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,
More informationSkeletal Muscle and the Molecular Basis of Contraction. Lanny Shulman, O.D., Ph.D. University of Houston College of Optometry
Skeletal Muscle and the Molecular Basis of Contraction Lanny Shulman, O.D., Ph.D. University of Houston College of Optometry Like neurons, all muscle cells can be excited chemically, electrically, and
More informationClassification of Endothelial Dysfunction. Stefano Taddei Department of Internal Medicine University of Pisa, Italy
Classification of Endothelial Dysfunction Stefano Taddei Department of Internal Medicine University of Pisa, Italy Pathogenesis of atherosclerosis from endothelial dysfunction to clinical disease endothelial
More informationImpact de la convection
Dysfonction Endothéliale, et toxines urémiques des patients dialysés Impact de la convection Ziad A. Massy Ambroise Paré Hospital, University Hospitals Paris Ile de France West, UVSQ, Boulogne Billancourt
More informationVelphoro (sucroferric oxyhydroxide)
STRENGTH DOSAGE FORM ROUTE GPID 500mg chewable tablet oral 36003 MANUFACTURER Fresenius Medical Care North America INDICATION(S) For the control of serum phosphorus levels in patients with chronic kidney
More informationH 2 S: Synthesis and functions
H 2 S: Synthesis and functions 1 Signaling gas molecules: O 2, NO and CO Then, H 2 S - Fourth singling gas molecule after O 2, NO and CO 2 Nothing Rotten About Hydrogen Sulfide s Medical Promise Science
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationOPEN. Masahiro Yoshikawa 1,2, Osamu Takase 1,2, Taro Tsujimura
www.nature.com/scientificreports Received: 26 September 2017 Accepted: 19 March 2018 Published: xx xx xxxx OPEN Long-term effects of low calcium dialysates on the serum calcium levels during maintenance
More informationAnimal Physiology Prof. Mainak Das Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur. Module - 1 Lecture 7
Animal Physiology Prof. Mainak Das Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Module - 1 Lecture 7 Welcome back to the lectures in Animal Physiology in
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular
More informationCardiovascular Complications Of Chronic Kidney Disease. Dr Atir Khan Consultant Physician Diabetes & Endocrinology West Wales Hospital, Carmarthen
Cardiovascular Complications Of Chronic Kidney Disease Dr Atir Khan Consultant Physician Diabetes & Endocrinology West Wales Hospital, Carmarthen Markers of kidney dysfunction Raised Albumin / Creatinine
More informationPHM142 Lecture 4: Platelets + Endothelial Cells
PHM142 Lecture 4: Platelets + Endothelial Cells 1 Hematopoiesis 2 Platelets Critical in clotting - activated by subendothelial matrix proteins (e.g. collagen, fibronectin, von Willebrand factor) and thrombin
More informationROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret
ROLE OF INFLAMMATION IN HYPERTENSION Dr Barasa FA Physician Cardiologist Eldoret Outline Inflammation in CVDs the evidence Basic Science in Cardiovascular inflammation: The Main players Inflammation as
More informationStefanos K. Roumeliotis. Department of Nephrology, Medical School Democritus University of Thrace, Alexandroupolis, Greece. Stefanos K.
Department of Nephrology, Medical School Democritus University of Thrace, Alexandroupolis, Greece Passive, degenerative accumulation process of Ca ++ /P +++ without treatment options Active, complex, condition:
More informationChronic Kidney Disease Mineral and Bone Disorder (CKD-MBD) Dietetic Management Protocol
This is an official Northern Trust policy and should not be edited in any way Chronic Kidney Disease Mineral and Bone Disorder (CKD-MBD) Dietetic Management Protocol Reference Number: NHSCT/12/553 Target
More informationSection 5 Treatment and health service provision
Section Section Treatment and health service provision Chronic Kidney Disease 0 Australian PEEK Study Section Section : Experience of treatment Summary Treatments experienced The most commonly used treatment
More informationPathology of Coronary Artery Disease
Pathology of Coronary Artery Disease Seth J. Kligerman, MD Pathology of Coronary Artery Disease Seth Kligerman, MD Assistant Professor Medical Director of MRI University of Maryland Department of Radiology
More informationBlood flows away from the heart in arteries, to the capillaries and back to the heart in the veins
Cardiovascular System Summary Notes The cardiovascular system includes: The heart, a muscular pump The blood, a fluid connective tissue The blood vessels, arteries, veins and capillaries Blood flows away
More informationReview of Cardiac Imaging Modalities in the Renal Patient. George Youssef
Review of Cardiac Imaging Modalities in the Renal Patient George Youssef ECHO Left ventricular hypertrophy (LVH) assessment Diastolic dysfunction Stress ECHO Cardiac CT angiography Echocardiography - positives
More informationDyslipidemia Endothelial dysfunction Free radicals Immunologic
ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and
More informationIncorporating K/DOQI Using a Novel Algorithm Approach: Regina Qu Appelle s Experience
Incorporating K/DOQI Using a Novel Algorithm Approach: Regina Qu Appelle s Experience Michael Chan, Renal Dietitian Regina Qu Appelle Health Region BC Nephrology Days There is a strong association among
More informationDo We Do Too Many Parathyroidectomies in Dialysis? Sagar Nigwekar MD, MMSc Massachusetts General Hospital
Do We Do Too Many Parathyroidectomies in Dialysis? Sagar Nigwekar MD, MMSc Massachusetts General Hospital E-mail: snigwekar@mgh.harvard.edu March 13, 2017 Disclosures statement: Consultant: Allena, Becker
More informationDate :... Class: A1&2 Time Allowed: 40Minutes Maximum Marks: 25
1 loomfield Hall School 1 Test (Unit 9) Name :... Paper: iolog y Date :... lass: 1& Time llowed: 40Minutes Maximum Marks: 5 TKheory Section: [Total 16 Marks] Fig. 1.1 shows the changes in blood pressure
More informationCardiovascular System Blood Vessels
Cardiovascular System Blood Vessels Structure of Blood Vessels The three layers (tunics) Tunica intima composed of simple squamous epithelium Tunica media sheets of smooth muscle Contraction vasoconstriction
More informationBlood Vessels. Types of Blood Vessels Arteries carry blood away from the heart Capillaries smallest blood vessels. Veins carry blood toward the heart
C H A P T E R Blood Vessels 20 Types of Blood Vessels Arteries carry blood away from the heart Capillaries smallest blood vessels The site of exchange of molecules between blood and tissue fluid Veins
More informationTRANSPARENCY COMMITTEE OPINION. 22 July 2009
The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION 22 July 2009 PHOSPHOSORB 660 mg, film-coated tablet Container of 200 (CIP: 381 466-0) Applicant: FRESENIUS MEDICAL
More informationSupplemental Figure I
Supplemental Figure I Kl ( mmol/l)-induced Force orta M (mn) 1 (mn) 1 Supplemental Figure I. Kl-induced contractions. and, Kl ( mmol/l)-induced contractions of the aorta () and those of mesenteric arteries
More informationTenapanor, a minimally absorbed NHE3 inhibitor, reduces dietary phosphorus absorption in healthy volunteers
, a minimally absorbed NHE3 inhibitor, reduces dietary phosphorus absorption in healthy volunteers David Rosenbaum, 1 Susanne Johansson, 2 Björn Carlsson, 2 Andrew G Spencer, 1 Bergur Stefansson, 2 Mikael
More informationCardiovascular System: Vessels and Circulation (Chapter 21)
Cardiovascular System: Vessels and Circulation (Chapter 21) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Eastern Campus Primary Sources for figures and content: Marieb,
More informationEARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES
EARLY INFLAMMATORY RESPONSES TO VASCULAR DEVICES JAMES M. ANDERSON, MD, PhD DISTINGUISHED UNIVERSITY PROFESSOR DEPARTMENTS OF PATHOLOGY, MACROMOLECULAR SCIENCE, AND BIOMEDICAL ENGINEERING CASE WESTERN
More informationProf. Rosanna Coppo Director of the Nephrology, Dialysis and Transplantation Department Regina Margherita Hospital Turin, Italy. Slide 1.
ROLE OF PATHOLOGY AND CLINICAL FEATURES IN PREDICTING PROGRESSION OF IGA NEPHROPATHY: RESULTS FROM THE ERA-EDTA RESEARCH VALIGA Rosanna Coppo, Turin, Italy Chairs: François Berthoux, Saint-Etienne, France
More informationBIPN100 F15 Human Physiol I (Kristan) Lecture 14 Cardiovascular control mechanisms p. 1
BIPN100 F15 Human Physiol I (Kristan) Lecture 14 Cardiovascular control mechanisms p. 1 Terms you should understand: hemorrhage, intrinsic and extrinsic mechanisms, anoxia, myocardial contractility, residual
More informationCardiovascular Disease in CKD. Parham Eftekhari, D.O., M.Sc. Assistant Clinical Professor Medicine NSUCOM / Broward General Medical Center
Cardiovascular Disease in CKD Parham Eftekhari, D.O., M.Sc. Assistant Clinical Professor Medicine NSUCOM / Broward General Medical Center Objectives Describe prevalence for cardiovascular disease in CKD
More informationSecondary hyperparathyroidism an Update on Pathophysiology and Treatment
Secondary hyperparathyroidism an Update on Pathophysiology and Treatment Klaus Olgaard Copenhagen Budapest Nephrology School August 2007 HPT IN CRF Renal mass Ca 2+ 1,25(OH) 2 D 3 CaR Hyperparathyroidism
More informationEARLY VERSUS LATE STEROID WITHDRAWAL Julio Pascual, Barcelona, Spain Chairs: Ryszard Grenda, Warsaw, Poland
EARLY VERSUS LATE STEROID WITHDRAWAL Julio Pascual, Barcelona, Spain Chairs: Ryszard Grenda, Warsaw, Poland Julio Pascual, Barcelona, Spain Prof. Julio Pascal Hospital del Mar Nephrology Department Barcelona,
More informationTHE IMPACT OF SERUM PHOSPHATE LEVELS IN CKD-MBD PROGRESSION
THE IMPACT OF SERUM PHOSPHATE LEVELS IN CKD-MBD PROGRESSION Mario Cozzolino, MD, PhD, Fellow of the European Renal Association Department of Health Sciences University of Milan Renal Division & Laboratory
More informationA. Incorrect! The left ventricle receives oxygenated blood from the lungs via the left atrium.
Anatomy and Physiology - Problem Drill 16: The Cardiovascular System No. 1 of 10 Instruction: (1) Read the problem statement and answer choices carefully (2) Work the problems on paper as needed (3) Pick
More informationMuscle Tissue. Muscle Tissue Outline. General Function of Muscle Tissue
Muscle Tissue Muscle Tissue Outline General Functions of Muscle Tissue Characteristics of Muscle Tissue Classification of Muscle Tissue Skeletal Muscle Structure and Function Muscle Energetics Muscle Mechanics
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationRole of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis
More informationCarotid Ultrasound Scans for Assessing Cardiovascular Risk
Transcript Details This is a transcript of an educational program accessible on the ReachMD network. Details about the program and additional media formats for the program are accessible by visiting: https://reachmd.com/programs/lipid-luminations/carotid-ultrasound-scans-for-assessing-cardiovascularrisk/4004/
More informationCardiovascular System. Biology 105 Lecture 15 Chapter 12
Cardiovascular System Biology 105 Lecture 15 Chapter 12 Outline I. Functions of cardiovascular system II. Components of the cardiovascular system: I. Blood vessels II. Heart III. Regulation of the heartbeat
More informationControl of Breathing
Physio # 11 Dr. Yanal Shafaqoj Done By: Lejan Al - Dof'at 13/12/13 Control of Breathing We talked previously about Oxygen extraction and CO 2 production, and how these are transfused through blood (in
More informationCirculatory System Review
Circulatory System Review 1. Know the diagrams of the heart, internal and external. a) What is the pericardium? What is myocardium? What is the septum? b) Explain the 4 valves of the heart. What is their
More informationIn the name of GOD. Animal models of cardiovascular diseases: myocardial infarction & hypertension
In the name of GOD Animal models of cardiovascular diseases: myocardial infarction & hypertension 44 Presentation outline: Cardiovascular diseases Acute myocardial infarction Animal models for myocardial
More informationPrognosis in CKD Can we do anything about it? Rodney D Gilbert
Prognosis in CKD Can we do anything about it? Rodney D Gilbert A diagnosis of end stage renal failure implies what degree of loss of life expectancy? A. 10% B. 20% C. 30% D. 40% E. 50% F. 60% 38% 22% 16%
More informationMonth/Year of Review: September 2012 Date of Last Review: September 2010
Copyright 2012 Oregon State University. All Rights Reserved Drug Use Research & Management Program Oregon State University, 500 Summer Street NE, E35, Salem, Oregon 97301-1079 Phone 503-947-5220 Fax 503-947-1119
More informationSKELETAL MUSCLE CHARACTERISTICS
THE MUSCULAR SYSTEM SKELETAL MUSCLE CHARACTERISTICS Most are attached by tendons to bones Cells are multinucleate Striated have visible banding Voluntary subject to conscious control Cells are surrounded
More informationBiology 12 January 2003 Provincial Examination
Biology 12 January 2003 Provincial Examination ANSWER KEY / SCORING GUIDE CURRICULUM: Organizers 1. Cell Biology 2. Cell Processes and Applications 3. Human Biology Sub-Organizers A, B, C, D E, F, G, H
More informationCan seal oil contribute to better human health?
Can seal oil contribute to better human health? Bjarne Østerud and Edel O. Elvevoll, Faculty of Medicine and NFH, University of Tromsø E-mail: bjarne@fagmed. Historical background Old food lore of seafood
More informationThe organs of the human body were created to perform ten functions among which is the function of the kidney to furnish the human being with thought.
The organs of the human body were created to perform ten functions among which is the function of the kidney to furnish the human being with thought. Leviticus Rabba 3 Talmud Berochoth 6 1 b Outline &
More informationCoronary artery calcification and aortic pulse wave velocity in chronic kidney disease patients
Kidney International, Vol. 65 (2004), pp. 1790 1794 Coronary artery calcification and aortic pulse wave velocity in chronic kidney disease patients ALI A. HAYDAR, ADRIAN COVIC, HELEN COLHOUN, MICHAEL RUBENS,
More informationInvited Review. Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular diseases
Histol Histopathol (2000) 15: 557-571 Histology and Histopathology Cellular and Molecular Biology Invited Review Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular
More informationMajor intra and extracellular ions Lec: 1
Major intra and extracellular ions Lec: 1 The body fluids are solutions of inorganic and organic solutes. The concentration balance of the various components is maintained in order for the cell and tissue
More informationThe 10 th International & 15 th National Congress on Quality Improvement in Clinical Laboratories
The 10 th International & 15 th National Congress on Quality Improvement in Clinical Laboratories Cardiac biomarkers in atherosclerosis Najma Asadi MD-APCP Ross and Colleagues in 1973: Response to Injury
More informationBlood Vessels. Dr. Nabila Hamdi MD, PhD
Blood Vessels Dr. Nabila Hamdi MD, PhD ILOs Understand the structure and function of blood vessels. Discuss the different mechanisms of blood pressure regulation. Compare and contrast the following types
More information02/27/2018. Objectives. To Replace or Not to Replace: Nutritional Vitamin D in Dialysis.
To Replace or Not to Replace: Nutritional Vitamin D in Dialysis. Michael Shoemaker-Moyle, M.D. Assistant Professor of Clinical Medicine Objectives Review Vitamin D Physiology Review Current Replacement
More informationThe effect of carotenoids and flavones on oxidative stress in endothelial cells
The effect of carotenoids and flavones on oxidative stress in endothelial cells Esther Paran MD Hypertension Research Center Faculty of Health Sciences Ben-Gurion University Cardiovascular Mortality Risk
More informationThere are many buffers in the kidney, but the main one is the phosphate buffer.
9 Yanal Obada Zalat Renal Control of AcidBase Balance The kidneys play three major roles in the maintenance of normal acidbase balance: 1excretion of H+ (fixed _non volatile H+) 2Reabsorption of filtrated
More informationEnergy sources in skeletal muscle
Energy sources in skeletal muscle Pathway Rate Extent ATP/glucose 1. Direct phosphorylation Extremely fast Very limited - 2. Glycolisis Very fast limited 2-3 3. Oxidative phosphorylation Slow Unlimited
More information