Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Size: px
Start display at page:

Download "Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr."

Transcription

1 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital

2 Introduction: Delivering prompt, customized care is critical to improving the patient experience and ultimately enabling better patient outcomes. Pneumatic tube systems help hospitals meet patient needs by efficiently transporting drugs, documents and specimens to and from nurses stations, labs, inpatient and outpatient pharmacies, blood banks and the ED. The dialysis Hospital has two main pneumatic tube systems. One system is intended to transport patients samples from the dialysis wards to the Clinical Biochemistry Laboratory in the same building. The other pneumatic tube system is used to transport samples from dialysis hospital to Clinical Biochemistry Laboratory in Mubarak Hospital. Comparison Study: The pneumatic tube system linking the Dialysis hospital to Mubarak Hospital was evaluated by analyzing 4 patient samples. Each sample was divided into two aliquots; one aliquot was sent from the Phlebotomy room in Mubarak Hospital to the Clinical Biochemistry Laboratory in Dialysis Hospital by the pneumatic tube system, the other aliquot was sent by porter. Both aliquots were analyzed using the same Beckman UniCel DxC 6 Synchron Clinical System. Comparison results were subjected to linear regression analysis using Microsoft Excel and Bland-Altman difference plots using the MedCal software ( P age

3 Albumin Linear Regression Graph of Albumin y =.985x R² = Albumin Alkaline Phosphatase Linear Regression Graph of ALP y =.89x R² = ALP P age

4 Alanine Aminotransferase Linear Regression Graph of ALT y =.8x +. R² = ALT Aspartate Aminotransferase Linear Regression Graph of AST y =.5x R² = AST P age

5 Calcium Linear Regression Graph of Calcium y =.986x +.4 R² = Calcium Carbon Dioxide Linear Regression Graph of Carbon Dioxide 4 y =.868x R² = Carbon Dioxide P age

6 Chloride Linear Regression Graph of Chloride y =.95x R² = Chloride.9 -. Cholesterol Linear Regression Graph of Total Cholesterol y =.9966x -.59 R² = Bland-Altman Plot TC P age

7 Creatinine 5 5 Linear Regression Graph of Creatinine y =.x +.55 R² = Creatinine Direct Bilirubin 5 5 Linear Regression Graph of DBil y =.999x +.7 R² = Direct Bilirubin P age

8 Gamma Glutamyl Transferase 5 5 Linear Regression Graph of GGT y =.56x +.6 R² = Bland-Altman plot GGT Glucose Linear Regression Graph of Glucose y =.x +.56 R² = Glucose P age

9 Phosphorus Linear Regression Graph of Phosphorus..7 Pneumatic y =.95x +.44 R² = Phosphorus Potassium Linear Regression Graph of Potassium y =.987x +.74 R² = Potassium P age

10 Sodium Linear Regression Graph of Sodium y =.888x +.86 R² = Sodium Total Bilirubin 5 4 Linear Regression Graph of TBil y =.995x -.57 R² = Total Bilirubin P age

11 Total Protein Linear Regression Graph of Total Protein y =.9875x +.74 R² = Total Protein Triglyceride Linear Regression Graph of Triglyceride. Bland-Altman Dofference Plot 4 y =.4x -.5 R² = TG P age

12 Urea Linear Regression Graph of Urea.5 4 y =.57x +.95 R² = Urea Uric Acid Linear Regression Graph of Uric Acid y =.56x -.85 R² = Uric Acid P age

13 Conclusion Comparison of pneumatic tube transport system with porter transport indicated good analytical agreement across the studied clinical biochemistry tests. The Bland-Atman difference plots showed no significant bias between the two methods. Therefore, the Transport System connecting the Dialysis Hospital to Mubarak Hospital is fit for use in the transport of patients samples between the two Hospitals. Dr. Anwaar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Professor Segun Mojiminiyi Consultant and Head of Unit Clinical Biochemistry Laboratory Mubarak Hospital P age

14 Acknowledgement We wish to thank Mrs. Najah Rezqalaah for her major contribution into sample collection and analysis. We are also grateful to Mr. Anwar AlAwadi for his great help in data entry. P age

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Evaluation of new MiniCollect Z Serum (Separator) Tubes

Evaluation of new MiniCollect Z Serum (Separator) Tubes Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test

More information

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

Evidence Based Commutability: Bias 2 Study. Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA

Evidence Based Commutability: Bias 2 Study. Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA Evidence Based Commutability: Bias 2 Study Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA Australian Bias Studies conducted by Gus Koerbin, ACT Pathology on behalf of AACB Harmonisation Committee

More information

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

ROUTINE LAB STUDIES. Routine Clinic Lab Studies ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not

More information

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016 ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID

More information

Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018

Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018 Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase

More information

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated

More information

VITROS MicroSlide Assay Summary

VITROS MicroSlide Assay Summary ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670

More information

DIABETES AND LABORATORY TESTS. Author: Josephine Davis

DIABETES AND LABORATORY TESTS. Author: Josephine Davis DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following

More information

Serodos and Serodos plus

Serodos and Serodos plus Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

General Chemistry Scheme Guide

General Chemistry Scheme Guide General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment P.C.G. Gontard 1, L.I. Stankevich 1, B.G. Gorodetsky 1 SUMMARY Clinical laboratories across the globe operate in

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Evaluation of Cheongmeak DCS TM Reagents for Chemistry Analyzers

Evaluation of Cheongmeak DCS TM Reagents for Chemistry Analyzers 임상검사와정도관리 J Lab Med Qual Assur 2010 ; 32:197-204 ISSN 1225-097X Evaluation of Cheongmeak DCS TM Reagents for Chemistry Analyzers Kyeong Seob Shin, Taek Eun Jeong, and Bo Ra Son Department of Laboratory

More information

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300 Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

DEPARTMENT: Regulatory Compliance Support

DEPARTMENT: Regulatory Compliance Support PAGE: 1 of 5 REPLACES POLICY DATED: 1/16/98, 3/1/99, SCOPE: All Company-affiliated hospitals performing and/or billing laboratory services. Specifically, the following departments: Business Office Admitting/Registration

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

AIDS and insurance. Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you INSURANCE

AIDS and insurance. Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you INSURANCE INSURANCE AIDS and insurance Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you Please read carefully NSW and TAS only What is AIDS? AIDS

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

What if you could help your team realise their health goals?

What if you could help your team realise their health goals? What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make

More information

Controls & Calibrators Clinical Chemistry

Controls & Calibrators Clinical Chemistry Controls & Calibrators Clinical Chemistry Clinical Chemistry Controls & Lipids Clinical Chemistry and lipid quality controls have been manufactured from true human serum to ensure they perform the same

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

TEST LIST SAMPLE REQUIREMENT. 1 ml serum None

TEST LIST SAMPLE REQUIREMENT. 1 ml serum None ALBUMIN TEST NAME ALKALINE PHOSPHATASE ALLERGY PROFILE, FOOD 30 allergens ALLERGY PROFILE, INHALANT 30 Allergens ALT AMYLASE ANA ANTI- TG ANTI-GLIADIN IGG ANTI-GLIADIN IGA ANTI-HBS ANTI-HCV ANTI-TPO APOLIPOPROTEIN

More information

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Original paper. The effect of storage time and freeze-thaw cycles on the stability of serum samples. Introduction

Original paper. The effect of storage time and freeze-thaw cycles on the stability of serum samples. Introduction Original paper The effect of storage time and freeze-thaw cycles on the stability of serum samples Serap Cuhadar* 1, Mehmet Koseoglu 1, Aysenur Atay 1, Ahmet Dirican 2 1 Ataturk Training and Research Hospital,

More information

Analyte Specimen Demographic Reference Range Units

Analyte Specimen Demographic Reference Range Units Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3

More information

External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA -

External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA - External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA - Anja Kessler Bonn, Germany 1 RELA Surveys www.dgkl-rfb.de 2 RELA Annual Process Each participant receives two different

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry Lot: 1702210520 Level 1: 201920 Level 2: 201930 C Standatrol S-E 2 niveles Lyophilized serum for precision control in clinical chemistry USES Standatrol S-E 2 niveles is adaptable to different uses: -

More information

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry Lot: 1711232000 Level 1: 230680 Level 2: 230700 C Standatrol S-E 2 niveles Lyophilized serum for precision control in clinical chemistry USES Standatrol S-E 2 niveles is adaptable to different uses: -

More information

CLINICAL CHEMISTRY REAGENTS. Product Profile

CLINICAL CHEMISTRY REAGENTS. Product Profile Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting

More information

Questionnaire. Traceability in EQA. Traceability

Questionnaire. Traceability in EQA. Traceability Questionnaire in EQA QUESTIONNAIRE ON TRACEABILITY QUESTIONNAIRE ON TRACEABILITY GENERAL INFORMATION Name EQA organisation Country Specify the total number of measurands in the schemes of your EQA organisation

More information

SRI NATHELLA SAMPATHU CHETTY CLINICAL LABORATORY (UNIT OF MEDICAL RESEARCH FOUNDATION) Test Master List

SRI NATHELLA SAMPATHU CHETTY CLINICAL LABORATORY (UNIT OF MEDICAL RESEARCH FOUNDATION) Test Master List S. No Lab/ Ref/ code Name of the Test CLINICAL BIOCHEMISTRY TESTS MASTER LIST Storage of Specimen Anti Reportable examined Required Coagulants interval specimen / (vacutainer) (vacutainer) (TAT) Temp.

More information

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry Lot: 1404137860 (Exp.: 2016/04) Level 1: 137860 (Exp.: 2016/04) Level 2: 137860 (Exp.: 2016/04) C Standatrol S-E 2 niveles Lyophilized serum for precision control in clinical chemistry USES Standatrol

More information

Routine Clinic Lab Studies

Routine Clinic Lab Studies Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection

More information

Hospital laboratories frequently receive requests to add

Hospital laboratories frequently receive requests to add Evaluation of Add-on Testing in the Clinical Chemistry Laboratory of a Large Academic Medical Center Operational Considerations Stacy Foran Melanson, MD, PhD; Brian Hsieh; James G. Flood, PhD; Kent B.

More information

Stability of common biochemical analytes in serum gel tubes subjected to various storage temperatures and times pre-centrifugation

Stability of common biochemical analytes in serum gel tubes subjected to various storage temperatures and times pre-centrifugation Original Article Stability of common biochemical analytes in serum gel tubes subjected to various storage temperatures and times pre-centrifugation Melissa Tanner 1, Neil Kent 1, Brian Smith 2, Stephen

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

Reference Intervals. Graham Jones / Gus Koerbin

Reference Intervals. Graham Jones / Gus Koerbin Reference Intervals Graham Jones / Gus Koerbin Adult CRI - Harmonisation Harmonisation 1 2012: (13 tests + 1 calculation) Harmonisation 2 2013: Confirm 2012 recommendations. Discussed: albumin, globulin,

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

University of Bristol - Explore Bristol Research

University of Bristol - Explore Bristol Research Irvine, K., Burt, K., & Papasouliotis, K. (2016). Evaluation of an in-practice wet chemistry analyser using canine and feline serum samples. Journal of Veterinary Diagnostic Investigation, 28(1), 38-45.

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION LANCET LABORATORIES Registration No: 4120108883 Facility Accreditation Number: MED 006 is a SADCAS accredited Medical Laboratory provided that all SADCAS conditions are complied

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION LANCET KENYA LIMITED UPPERHILL NAIROBI LABORATORY Co. Reg. No.: C168507 Facility Accreditation Number: is a South African National Accreditation System accredited laboratory

More information

Setting of quality standards

Setting of quality standards Setting of quality standards Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney AACB ASM Adelaide October 2014 Setting of Quality Standards - 2013 The 2013 QC workshop revealed

More information

Laboratory Accreditation Programmes

Laboratory Accreditation Programmes Client No. 1609 LABNET Invermay Limited PO Box 371, Mosgiel, 9053 Puddle Alley, RD 2, Mosgiel, 9092 Telephone 03 489-4600 www.gribblesvets.co.nz Fax 03 489-8576 Authorised Representative Ms Denise Carian-Smith

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Test Profiles Time for a Change. Tony Badrick (AACB Harmonisation Committee)

Test Profiles Time for a Change. Tony Badrick (AACB Harmonisation Committee) Test Profiles Time for a Change Tony Badrick (AACB Harmonisation Committee) 1. Why Profiles 2. Profiles A. LFT B. Electrolyte C. Renal D. Bone 3. Summary Same clothes!! Harmonisation! Same car!! Harmonisation!

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

Uni-Asia Scientific Instrument Company Limited. Stanbio Laboratory Product List

Uni-Asia Scientific Instrument Company Limited. Stanbio Laboratory Product List 0130-430 Magnesium LiquiColor Test 0140-050 Sodium Test 0150-250 Calcium (CPC) LiquiColor Test 0153-030 Calcium Standard (10 mg/dl) 0155-225 Calcium (Arsenazo) LiquiColor Test 0160-050 Potassium Test 0210-250

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with: WSLH PT roficiency esting Calibration Verification/ Linearity Products Products provided in partnership with: www.wslhpt.org 800-462-5261 PTService@slh.wisc.edu General Chemistry Ammonia/Ethanol - 5 x

More information

Effect of serum-clot contact time on clinical chemistry laboratory results

Effect of serum-clot contact time on clinical chemistry laboratory results Clinical Chemistry 44:6 1325 1333 (1998) General Clinical Chemistry Effect of serum-clot contact time on clinical chemistry laboratory results Dongbo J. Zhang, 1 R.K. Elswick, 2 W. Greg Miller, 1* and

More information

Evaluation of VACUETTE SECONDARY Tubes

Evaluation of VACUETTE SECONDARY Tubes Evaluation of VACUETTE SECODARY Tubes Background VACUETTE SECODARY Tubes are used as a secondary container for aliquoting, storing and transporting blood, blood components and urine from the primary tube

More information

Clinical Study Thrombin-Accelerated Quick Clotting Serum Tubes: An Evaluation with 22 Common Biochemical Analytes

Clinical Study Thrombin-Accelerated Quick Clotting Serum Tubes: An Evaluation with 22 Common Biochemical Analytes Advances in Hematology Volume 13, Article ID 7979, 8 pages http://dx.doi.org/1.11/13/7979 Clinical Study Thrombin-Accelerated Quick Clotting Serum Tubes: An Evaluation with Common Biochemical Analytes

More information

Senior Wellness Screening Protocol & Guidance Notes

Senior Wellness Screening Protocol & Guidance Notes Senior Wellness Screening Protocol & Guidance Notes Early detection and prevention are the most important reasons why you should screen every pet, every year especially where statistics show 10% of normal

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

Basic Blood Chemistry, by Sharlene Peterson CLASS: G610

Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 This is your test but do not try to fill in the blanks! We created a Test Answer Sheet which is easy to download, fill in the answer, and email.

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Conference. Clinical Chemistry 43: (1997) Oak Ridge

Conference. Clinical Chemistry 43: (1997) Oak Ridge Clinical Chemistry 43:9 1744 1748 (1997) Oak Ridge Conference In vitro effects of a novel hemoglobin-based oxygen carrier on routine chemistry, therapeutic drug, coagulation, hematology, and blood bank

More information

What Does My Blood Test Mean

What Does My Blood Test Mean What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential

More information

LNA-mediated silencing of microrna-122 in African green monkeys

LNA-mediated silencing of microrna-122 in African green monkeys LNA-mediated silencing of microrna-122 in African green monkeys Supplementary information for Elmen and Lindow et al. February 25, 2008 This document contains details about the clinical parameters measured

More information

Age-related reference ranges

Age-related reference ranges Authoriser: Peter Beresford Page 1 of 6 Age-related reference ranges Alkaline Phosphatase (ALP) IU/L Both less than 14 days 90 273 Both 14 days

More information

Basic Metabolic Panel

Basic Metabolic Panel Basic Metabolic Panel Order Name: CHEM 8 Test Number: 2028100 REV DATE:2/5/2008 Glucose Urea Nitrogen, Blood (BUN) Creatinine Sodium Potassium Serum/Plasma Chloride Bicarbonate Calcium Anion Gap Calculated

More information

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation

More information

Health Screening for Nanyang Technological University (NTU)

Health Screening for Nanyang Technological University (NTU) Health Screening for Nanyang Technological University (NTU) Health screening packages are offered at corporate rates to NTU staff and dependents at the indicated clinics. Please refer to this document

More information

EXAM COVER SHEET. Course Code: CLS 432. Course Description: Clinical Biochemistry. Final Exam. Duration: 2 hour. 1st semester 1432/1433.

EXAM COVER SHEET. Course Code: CLS 432. Course Description: Clinical Biochemistry. Final Exam. Duration: 2 hour. 1st semester 1432/1433. EXAM COVER SHEET Course Code: CLS 432 Course Description: Clinical Biochemistry Final Exam Duration: 2 hour 1st semester 1432/1433 Student Name: Student Uni No: Part 1 Multiple choice questions Answer

More information

Special issue: Six Sigma metrics Original papers

Special issue: Six Sigma metrics Original papers Special issue: Six Sigma metrics Original papers Risk analysis and assessment based on Sigma metrics and intended use Yong Xia 1, Hao Xue 1, Cunliang Yan 1, Bowen Li 2, ShuQiong Zhang 1, Mingyang Li 1,

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product: SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating

More information

Impact of Proposed HRI s on Laboratory Report Flagging Rates

Impact of Proposed HRI s on Laboratory Report Flagging Rates Impact of Proposed HRI s on Laboratory Report Flagging Rates A/Prof. Ken Sikaris Melbourne Pathology BSc(Hons), MBBS, FRCPA, FAACB, FFSc CBN 2011 WORKSHOP 2012 WORKSHOP 2013 WORKSHOP 2014 GENERAL CONCEPTS

More information

PRICE LIST RELIABLE ACCURATE COST EFFECTIVE. American Technology Made in India For India. W.E.F April 2018

PRICE LIST RELIABLE ACCURATE COST EFFECTIVE. American Technology Made in India For India. W.E.F April 2018 PRICE LIST W.E.F April 2018 RELIABLE ACCURATE COST EFFECTIVE American Technology Made in India For India +91-44-22541131 www.athenesedx.com info@athenesedx.com Code OnSite Rapid Tests R0061C R0062C R0062C

More information

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED

More information

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800) ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information