Evaluation of new MiniCollect Z Serum (Separator) Tubes

Size: px
Start display at page:

Download "Evaluation of new MiniCollect Z Serum (Separator) Tubes"

Transcription

1 Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube is that capillaries and funnels are not needed to facilitate blood transfer from the puncture site into the MiniCollect tube. The MiniCollect Z Serum Separator capillary blood collection tube is also featured with a comolded cap which can easily be removed during the collection and sampling process. The interior of the tube is coated with spray-dried blood clotting activator (SiO ). The blood clotting activator speeds up the clotting process. MiniCollect Clot Activator Separator tubes contain an inert, acrylic gel barrier in the bottom of the tube. The specific gravity of the gel lies between the cells and serum. This separation allows serum to be aspirated directly from the MiniCollect tube eliminating the need to transfer serum into another vessel. MiniCollect Z Serum (Separator) Tubes are used to collect, transport, separate and process capillary blood for testing serum in the clinical laboratory. Study Objective: A clinical evaluation was carried out to compare the performance of the MiniCollect Z Serum Separator tube with new design in comparison to old design of MiniCollect Z Serum Separator tube including healthy and pathological subjects. Study design: The following tube types were used in this study: Sample ID A B Description MiniCollect Z Serum Sep.. ml (item No.: ), old design MiniCollect Z Serum Sep..-. ml (item No.: ), new design The study has been approved by Ethics Commission. Informed consent has been given by all participants. Directly after blood collection with venous blood, the tubes were carefully inverted times according to the instructions for use for MiniCollect blood collection tubes. After blood collection, the tubes were allowed to sit for min in an upright position. The listed analytes were tested using an AU and DxI from Beckman Coulter. Analysis was performed with the instrument s accompanying reagents. page /

2 Determined parameters: Albumin Lactate Dehydrogenase (LDH) Aspartate Transaminase (AST) Alanine-Transaminase (ALT) Gamma-glutamyl Transferase (GGT) Alkaline Phosphatase (ALP) Uric Acid Total Bilirubin Cholesterol Triglyceride Sodium Potassium Chloride Calcium Phosphate Magnesium Iron Urea Estradiol Creatine Kinase Total Protein free Triiodothyronine (ft ) free Thyroxine (ft ) Thyroid-Stimulating Hormone (TSH) Cortisol Glucose Progesterone Ferritin Conclusion: Performance of the new MiniCollect Z Serum Separator tube has been demonstrated in comparison to the old MiniCollect Z Serum Separator tube on the basis of the analytes tested. For three samples (B, A, B) from pathological subjects, the sample amount was not sufficient in order to determine all parameters. Several visually hemolytic samples have been detected: A, B / A, B / A, B / A, B / A, B / A, B / A, B. Due to very low absolute values, rather higher analytical deviations have been found for Estradiol and, Progesterone by including male and female subjects. Deviations as found for total bilirubin might be due to the light sensitivity. All systematic deviations that occurred in the measurement of potassium, AST, CK, total bilirubin and phosphate are considered to be without clinical significance. As the new design of MiniCollect Z Serum Separator tubes reduces the likelihood of nonvisible hemolysis, slightly systematically lower values have been found for LDH and potassium. In summary, despite the deviations and results that have been found, none are clinically significant. The MiniCollect Z Serum Separator with the new design is substantially equivalent to the MiniCollect Z Serum Separator with the old design. page /

3 References: () Greiner Bio-One. MiniCollect Z Serum Tubes. Instructions for Use. Kremsmünster, Austria.. () Greiner Bio-One. MiniCollect Product Manual. Kremsmünster, Austria.. () Guideline published by the Chamber Association for Medical Practitioners of the State of Germany concerning the quality assurance of quantitative analyses of Medical Laboratories, Germany (). Rev. () ISO :(E), Single-use containers for venous blood specimen collection. International Standard. () EP-A: Interference Testing in Clinical Chemistry; Approved Guideline Second Edition, CLSI. () EP-A-IR: Method Comparison and Bias Estimation Using Patient Samples; Approved Guideline Second Edition (Interim Revision). CLSI. () H-A: Tubes and Additives for Venous and Capillary Blood Specimen Collection; Approved Standard Sixth Edition CLSI () H-A: Procedures and Devices for the Collection of Diagnostic Capillary Blood Specimens Approved Standard Sixth Edition CLSO () RILIBÄK: Guideline of the German Medical Association for Quality Assurance Results: Results in detail: Albumin Normal range: - g/l ALB g/l Ah ALB g/l Bh ALB [g/l] Ah ALB [g/l] Bh g/l g/l Correlation: r =, Correlation: r =, ALB g/l Bh ALB [g/l] Bh ALB g/l Ah, Conf.Int. ALB [g/l] Ah, Conf.Int. page /

4 Creatine Kinase Normal range: (f) (m) CK A h CK B h CK [] Ah CK [] Bh Correlation: r =, Correlation: r =, CK Bh CK [] Bh CK Ah, Conf.Int. CK [] Ah, Conf.Int. Lactate Dehydrogenase (LDH) Normal range: (f) < (m) < L DH A h L DH B h LDH [ ] Ah LDH [ ] Bh Correlation: r =, Correlation: r =, LDH Bh LDH [] Bh LDH Ah, Conf.Int. LDH [] Ah, Conf.Int. page /

5 Alanine transaminase (ALT) Normal range: (m) < (f) < ALT Ah ALT Bh ALT [] Ah ALT [] Bh Correlation: r =, Correlation: r =, ALT Bh ALT [] Bh ALT Ah, Conf.Int. ALT [] Ah, Conf.Int. Aspartate transaminase (AST) Normal range: (m) < (f) < AST Ah AST Bh AST [] Ah AST [] Bh Correlation: r =, Correlation: r =, AST Bh AST [] Bh AST Ah, Conf.Int. AST [] Ah, Conf.Int. page /

6 Gamma-glutamyl Transpeptidase (GGT) Normal range: (f) < (m) < GGT Ah GGT Bh GGT [] Ah GGT [] Bh Correlation: r =, Correlation: r =, GGT Bh GGT [] Bh GGT Ah, Conf.Int. GGT [] Ah, Conf.Int. Alkaline Phosphatase (ALP) Normal range: - ALP Ah ALP Bh ALP [] Ah ALP [] Bh Correlation: r =, Correlation: r =, ALP Bh ALP [] Bh ALP Ah, Conf.Int. ALP [] Ah, Conf.Int. page /

7 Uric Acid (UA) Normal range: (f). -. (m). -. UA Ah UA Bh UA [] Ah UA [] Bh Correlation: r =, Correlation: r =, UA Bh UA [] Bh UA Ah, Conf.Int. UA [] Ah, Conf.Int. Total Bilirubin (TBili) Normal range:. -.,,,,,,, TBIL Ah TBIL Bh, TBIL [] Ah, TBIL [] Bh,,,,,,,,,,,,,,,, TBIL Bh Correlation: r =,,,,,,,,,,,,,,,,,,,,,,,,,,, TBIL Ah, Conf.Int. TBIL [] Bh Correlation: r =,,,,,,,,,,,,,,,,,,,,,,, TBIL [] Ah, Conf.Int. page /

8 Cholesterol (Chol) Normal range: < CHOL Ah CHOL Bh CHOL [] Ah CHOL [] Bh Correlation: r =, Correlation: r =, CHOL Bh CHOL Ah, Conf.Int. CHOL [] Bh CHOL [] Ah, Conf.Int. Triglyceride (TG) Normal range: normal < borderline high < high < very high TG Ah TG Bh TG [] Ah TG [] Bh Correlation: r =, Correlation: r =, TG Bh TG [] Bh TG Ah, Conf.Int. TG [] Ah, Conf.Int. page /

9 Sodium (Na) Normal range: - NA Ah NA Bh NA [] Ah NA [] Bh Correlation: r =, Correlation: r =, NA Bh NA [] Bh NA Ah, Conf.Int. NA [] Ah, Conf.Int. Potassium (K) Normal range: Serum. -. K Ah K Bh K [] Ah K [] Bh K Bh Correlation: r =,,,,,,,,,,,,,,,, K Ah, Conf.Int. K [] Bh Correlation: r =,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, K [] Ah, Conf.Int. page /

10 Chloride (Cl) Normal range: - CL Ah CL Bh CL [] Ah CL [] Bh Correlation: r =, Correlation: r =, CL Bh CL [] Bh CL Ah, Conf.Int. CL [] Ah, Conf.Int. Calcium (Ca) Normal range:. -., CA Ah CA Bh,,,,,,,,,,,,,, CA [] Ah CA [] Bh,,,,,,,,,,,,,, Correlation: r =,, Correlation: r =,,,,,, CA Bh,,, CA [] Bh,,,,,,,,,,,,,,,,,,,,,,,,,,,,, CA Ah, Conf.Int. CA [] Ah, Conf.Int. page /

11 Phosphate (IP) Normal range:. -.,, IP Ah IP Bh, IP [] Ah IP [] Bh,,,,,,,,,,,,,,, Correlation: r =,, Correlation: r =,,,,,, IP Bh,, IP [] Bh,,,,,,,,,,,,,,,,,, IP Ah, Conf.Int.,,,,,,,,,,,, IP [] Ah, Conf.Int. Magnesium (Mg) Normal range: (f). -. (m). -., MG Ah MG Bh, MG [] Ah MG [] Bh,,,,,,,,,,,, Correlation: r =,, Correlation: r =,,,,,, MG Bh,,,,,, MG [] Bh,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, MG Ah, Conf.Int. MG [] Ah, Conf.Int. page /

12 Iron (Fe) Normal range: (f). -. µmol/l (m). -. µmol/l FE umol/l Ah FE umol/l Bh FE [umol/l] Ah FE [umol/l] Bh µmol/l umol/l Correlation: r =, Correlation: r =, FE umol/l Bh FE [umol/l] Bh FE umol/l Ah, Conf.Int. FE [umol/l] Ah, Conf.Int. Urea Normal range: - UREA Ah UREA Bh UREA [] Ah UREA [] Bh Correlation: r =, Correlation: r =, UREA Bh UREA [] Bh UREA Ah, Conf.Int. UREA [] Ah, Conf.Int. page /

13 Total Protein (TP) Normal range: - g/l TP g/l Ah TP g/l Bh TP [g/l] Ah TP [g/l] Bh g/l g/l Correlation: r =, Correlation: r =, TP g/l Bh TP [g/l] Bh TP g/l Ah, Conf.Int. TP [g/l] Ah, Conf.Int. Free Triiodothyronine (ft ) Normal range:. -. pg/ml FT pg/ml Ah FT pg/ml Bh FT [pg/ml] Ah FT [pg/ml] Bh pg/ml pg/ml,, Correlation: r =, Correlation: r =,, FT pg/ml Bh,, FT [pg/ml] Bh,,,,,,,,,,,,,,,,,,,, FT pg/ml Ah, Conf.Int. FT [pg/ml] Ah, Conf.Int. page /

14 Free Thyroxine (ft ) Normal range:. -. ng/dl ng/dl, FRT ng/dl Ah FRT ng/dl Bh,,,,,, ng/dl,, FRT [ng/dl] Ah FRT [ng/dl] Bh,,,,,,,,,,,,,,, Correlation: r =,, Correlation: r =,,,, FRT ng/dl Bh,,, FRT [ng/dl] Bh,,,,,,,,,,,,,,,,,,,, FRT ng/dl Ah, Conf.Int.,,,,,,,,,,,,,,,, FRT [ng/dl] Ah, Conf.Int. Thyroid-stimulating Hormone (TSH) Normal range:. -. μiu/ml,,, ftsh uiu/ml Ah ftsh uiu/ml Bh TSH [µlu/m l] Ah TSH [µlu/m l] Bh, µlu/ml, uiu/ml,,, ftsh uiu/ml Bh Correlation: r =,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, TSH [uiu/ml] Bh Correlation: r =, - - ftsh uiu/ml Ah, Conf.Int. TSH [uiu/ml] Ah, Conf.Int. page /

15 Cortisol Normal range: morning. -. µg/dl afternoon > µg/dl µg/dl Cortisol ug/dl Ah Cortisol ug/dl Bh ug/dl Cortisol [ug/dl] Ah Cortisol [ug/dl] Bh Correlation: r =, Correlation: r =, Cortisol ug/dl Bh Cortisol [ug/dl] Bh Cortisol ug/dl Ah, Conf.Int. Cortisol [ug/dl] Ah, Conf.Int. Estradiol Normal range: (m) - pg/ml (f) - pg/ml pg/ml OESTRADIOL pg/ml Ah OESTRADIOL pg/ml Bh pg/ml OESTRADIOL [pg/ml] Ah OESTRADIOL [pg/ml] Bh OESTRADIOL pg/ml Bh Correlation: r =, - - OESTRADIOL [pg/ml] Bh Correlation: r =, - - OESTRADIOL pg/ml Ah, Conf.Int. OESTRADIOL [pg/ml] Ah, Conf.Int. page /

16 Progesterone Normal range: (f). -. ng/ml(m) age dependent Prog ng/ml Ah Prog ng/ml Bh Prog [ng/ml] Ah Prog [ng/ml] Bh ng/ml ng/ml Correlation: r =, Correlation: r =, Prog ng/ml Bh Prog [ng/ml] Bh - - Prog ng/ml Ah, Conf.Int. - - Prog [ng/ml] Ah, Conf.Int. Ferritin Normal range: (f). -. µg/l (m). -. µg/l FER_DX ng/ml Ah FER_DX ng/ml Bh FER_AU [ng/ml] Ah FER_AU [ng/ml] Bh µg/l ng/ml Correlation: r =, Correlation: r =, FER_DX ng/ml Bh FER_AU [ng/ml] Bh - - FER_DX ng/ml Ah, Conf.Int. - - FER_AU [ng/ml] Ah, Conf.Int. page /

17 Glucose Normal range: - GLUK Ah GLUK Bh GLUK [] Ah GLUK [] Bh Correlation: r =, Correlation: r =, GLUK Bh GLUK [] Bh GLUK Ah, Conf.Int. GLUK [] Ah, Conf.Int. ENT Rev. page /

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood

More information

The study has been approved by Ethics Commission. Informed consent has been given by all participants.

The study has been approved by Ethics Commission. Informed consent has been given by all participants. Evaluation of new 9NC Coagulation Tubes Background: Venous blood with sodium citrate is the most commonly obtained examination sample for coagulation determinations. The additive functions as an anticoagulant

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Evaluation of VACUETTE SECONDARY Tubes

Evaluation of VACUETTE SECONDARY Tubes Evaluation of VACUETTE SECODARY Tubes Background VACUETTE SECODARY Tubes are used as a secondary container for aliquoting, storing and transporting blood, blood components and urine from the primary tube

More information

Controls & Calibrators Clinical Chemistry

Controls & Calibrators Clinical Chemistry Controls & Calibrators Clinical Chemistry Clinical Chemistry Controls & Lipids Clinical Chemistry and lipid quality controls have been manufactured from true human serum to ensure they perform the same

More information

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr. 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

Analyte Specimen Demographic Reference Range Units

Analyte Specimen Demographic Reference Range Units Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3

More information

VITROS MicroSlide Assay Summary

VITROS MicroSlide Assay Summary ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300 Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Stability of common biochemical analytes in serum gel tubes subjected to various storage temperatures and times pre-centrifugation

Stability of common biochemical analytes in serum gel tubes subjected to various storage temperatures and times pre-centrifugation Original Article Stability of common biochemical analytes in serum gel tubes subjected to various storage temperatures and times pre-centrifugation Melissa Tanner 1, Neil Kent 1, Brian Smith 2, Stephen

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA -

External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA - External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA - Anja Kessler Bonn, Germany 1 RELA Surveys www.dgkl-rfb.de 2 RELA Annual Process Each participant receives two different

More information

Authorised: JSWoodford, Lead of Speciality. Biochemistry Reference Intervals, October Page 1 of 5

Authorised: JSWoodford, Lead of Speciality. Biochemistry Reference Intervals, October Page 1 of 5 AFP All All < 15 ug/l Albumin All 0-3M 25-40 g/l Albumin All 3-12M 32-45 g/l Albumin All 1-70Y 34-48 g/l Albumin All >70Y 32-46 g/l Alk Phos All 0-10Y 80-350 U/L Alk Phos M 10-14Y 45-400 U/L Alk Phos F

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION LANCET KENYA LIMITED UPPERHILL NAIROBI LABORATORY Co. Reg. No.: C168507 Facility Accreditation Number: is a South African National Accreditation System accredited laboratory

More information

Biochemistry Adult Reference Ranges

Biochemistry Adult Reference Ranges Certified correct on 28/06/2016 Biochemistry Adult Reference Ranges Test Reference range Units Reference range from Traceable to standard reference material Albumin 35 50 g/l Pathology IRMM ERM-DA470k/IFCC

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department Poole Hospital Longfleet Road Poole BH15 2JB Contact: Dr Fergus Jack Tel: +44 (0) 1202 442 497 E-Mail: Fergus.jack@poole.nhs.uk

More information

General Chemistry Scheme Guide

General Chemistry Scheme Guide General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Evidence Based Commutability: Bias 2 Study. Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA

Evidence Based Commutability: Bias 2 Study. Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA Evidence Based Commutability: Bias 2 Study Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA Australian Bias Studies conducted by Gus Koerbin, ACT Pathology on behalf of AACB Harmonisation Committee

More information

TRACEABILITY and UNCERTAINTY

TRACEABILITY and UNCERTAINTY ACP Acid phosphatase total 1-naphthyl phosphate NPP Acid phosphatase, non-prostatic 1-naphthyl phosphate (Inhib.:tartrate) ACP-P Acid phosphatase, prostatic 1-naphthyl phosphate (Inhib.:tartrate) ALB Albumin

More information

Roche/Hitachi - PreciControl ClinChem Multi 2

Roche/Hitachi - PreciControl ClinChem Multi 2 ATRYP Antitrypsin alpha 1 ERM-DA470k/IFCC 9 136 1.36 1.84 0.0184 GPROT Acid glycoprotein alpha 1 CRM 470 2 90.1 0.901 0.890 0.00890 ACP Acid phosphatase total 1-naphthyl phosphate 0.720 43.1 0.00703 0.421

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

Comparison of VACUETTE Serum Gel Z Tubes with VACUETTE Serum Gel Tubes for Hormones

Comparison of VACUETTE Serum Gel Z Tubes with VACUETTE Serum Gel Tubes for Hormones Comparison of VACUETTE Serum Gel Z Tubes with VACUETTE Serum Gel Tubes for Hormones Background: Greiner-Bio-One, Austria has sold plastic evacuated tubes (VACUETTE ) for venous blood collection since 1986.

More information

MEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.

MEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently. MEMORANDUM Originating Department Chemical Pathology Issued By: Issued To: Subject: Details: Dr. Shari Srinivasan All Laboratory Service Users Change in Chemical Pathology Analysers Dear Colleague, As

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

TRACEABILITY and UNCERTAINTY

TRACEABILITY and UNCERTAINTY Cat. No. 0 79 0 90 ACP Acid phosphatase total -naphthyl phosphate NPP Acid phosphatase, non-prostatic -naphthyl phosphate (Inhib.:tartrate) ALB Albumin BCG plus ALB Albumin BCP ALP Alkaline phosphatase

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Coping with Analytical Interferences

Coping with Analytical Interferences Coping with Analytical Interferences (Handling Icteric, Hemolytic and Lipaemic Samples) Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney Surabaya Indonesia 2016 Acknowledgements

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

Annex to the Accreditation Certificate D-ML according to ISO 15189:2012

Annex to the Accreditation Certificate D-ML according to ISO 15189:2012 Deutsche Akkreditierungsstelle GmbH according to ISO 15189:2012 Period of validity: 31.10.2016 to 30.10.2021 Date of issue: 31.10.2016 Holder of certificate: Medlab Ghana Limited 17 Ridge Road, Roman Ridge,

More information

Serodos and Serodos plus

Serodos and Serodos plus Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Bio-Rad Laboratories EQAS. External Quality Assurance Services

Bio-Rad Laboratories EQAS. External Quality Assurance Services Bio-Rad Laboratories EXternal QUALITY ASSURANCE SERVICES EQAS External Quality Assurance Services Bio-Rad Laboratories EXternal QUALITY ASSURANCE SERVICES Participate in an internationally recognized quality

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Types of target values, acceptable ranges

Types of target values, acceptable ranges Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

TRACEABILITY and UNCERTAINTY 7

TRACEABILITY and UNCERTAINTY 7 Routine Method COBAS INTEGRA systems Acid phosphatase total 1-naphthyl phosphate Integra 00 plus Acid phosphatase total 1-naphthyl phosphate Acid phosphatase, non-prostatic Integra 00 plus Acid phosphatase,

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with: WSLH PT roficiency esting Calibration Verification/ Linearity Products Products provided in partnership with: www.wslhpt.org 800-462-5261 PTService@slh.wisc.edu General Chemistry Ammonia/Ethanol - 5 x

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Hammersmith Medicines Research Limited Cumberland Avenue Park Royal London NW10 7EW Contact: Juan Naveda Tel: +44 (0) 20 8961 4130 Fax: +44

More information

Minimum Whole Blood Volumes for Microcollection Tubes for Neonates, Pediatrics, Patients less than 45 kg (100 lb) and Difficult Collections

Minimum Whole Blood Volumes for Microcollection Tubes for Neonates, Pediatrics, Patients less than 45 kg (100 lb) and Difficult Collections The following table outlines the minimum whole blood volume that must be drawn into a microcollection tube (unless otherwise stated) for an individual test on a neonate, pediatric, patient weighing less

More information

Setting of quality standards

Setting of quality standards Setting of quality standards Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney AACB ASM Adelaide October 2014 Setting of Quality Standards - 2013 The 2013 QC workshop revealed

More information

COBAS INTEGRA / cobas c C.f.a.s.

COBAS INTEGRA / cobas c C.f.a.s. COBAS INTEGRA / cobas c - C.f.a.s. Cat. No. 0 79 30 90 Roche Diagnostics GmbH May 20 Acid phosphatase total -naphthyl phosphate Gen. 2 Integra 00 plus Acid phosphatase total -naphthyl phosphate Gen. 2

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Breakout Session C: Harmonisation of the Alert Table.

Breakout Session C: Harmonisation of the Alert Table. Breakout Session C: Harmonisation of the Alert Table. RCPA-AACB High Risk Results Working Party Andrew Georgiou Craig Campbell Grahame Caldwell Hans Schneider Penelope Coates Que Lam Rita Horvath Robert

More information

Special issue: Six Sigma metrics Original papers

Special issue: Six Sigma metrics Original papers Special issue: Six Sigma metrics Original papers Risk analysis and assessment based on Sigma metrics and intended use Yong Xia 1, Hao Xue 1, Cunliang Yan 1, Bowen Li 2, ShuQiong Zhang 1, Mingyang Li 1,

More information

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016 ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment

Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment P.C.G. Gontard 1, L.I. Stankevich 1, B.G. Gorodetsky 1 SUMMARY Clinical laboratories across the globe operate in

More information

S Potassium K mmol/l Up to 1m m - 1y >1y /07/2010. S Chloride CL mmol/l Up to 3m > 3m /07/2010

S Potassium K mmol/l Up to 1m m - 1y >1y /07/2010. S Chloride CL mmol/l Up to 3m > 3m /07/2010 Northumbria Healthcare NHS Trust Clinical Chemistry Deartment Reference Ranges Reference Ranges in use in Telepath Laboratory System at July 2005 unless indicated otherwise Last date Amended; 20/08/2010

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

Saskatchewan ND Price List

Saskatchewan ND Price List Saskatchewan ND Price List Note: There is a $55 per requisition documentation fee. Prices valid only in Saskatchewan. PANEL Healthy Living Assessment Panel $115.00 Enhanced Healthy Living Assessment Panel

More information

TEST LIST SAMPLE REQUIREMENT. 1 ml serum None

TEST LIST SAMPLE REQUIREMENT. 1 ml serum None ALBUMIN TEST NAME ALKALINE PHOSPHATASE ALLERGY PROFILE, FOOD 30 allergens ALLERGY PROFILE, INHALANT 30 Allergens ALT AMYLASE ANA ANTI- TG ANTI-GLIADIN IGG ANTI-GLIADIN IGA ANTI-HBS ANTI-HCV ANTI-TPO APOLIPOPROTEIN

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

ACCREDITATION DOCUMENT

ACCREDITATION DOCUMENT Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018

Manufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018 Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Please contact the Client Services Team if you require further information.

Please contact the Client Services Team if you require further information. Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used

More information

Questionnaire. Traceability in EQA. Traceability

Questionnaire. Traceability in EQA. Traceability Questionnaire in EQA QUESTIONNAIRE ON TRACEABILITY QUESTIONNAIRE ON TRACEABILITY GENERAL INFORMATION Name EQA organisation Country Specify the total number of measurands in the schemes of your EQA organisation

More information

Basic Blood Chemistry, by Sharlene Peterson CLASS: G610

Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 This is your test but do not try to fill in the blanks! We created a Test Answer Sheet which is easy to download, fill in the answer, and email.

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800) ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain

More information

Laboratory Medicine Standardization Activity in Japan

Laboratory Medicine Standardization Activity in Japan JCTLM 15/11/2005 Sevres, Paris oratory Medicine Standardization Activity in Japan National Institute Metrology of Japan (NMIJ) Koichi Chiba Fujirebio Inc. Katsuhiko Yamamoto University of Tsukuba Katsuhiko

More information

Reference Intervals. Graham Jones / Gus Koerbin

Reference Intervals. Graham Jones / Gus Koerbin Reference Intervals Graham Jones / Gus Koerbin Adult CRI - Harmonisation Harmonisation 1 2012: (13 tests + 1 calculation) Harmonisation 2 2013: Confirm 2012 recommendations. Discussed: albumin, globulin,

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department University Hospital of North Durham Durham County Durham DH1 5TW Contact: Dr Tim Lang Tel: +44 (0) 191 333 2694 Fax:

More information

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test

More information

CLINICAL CHEMISTRY REAGENTS. Product Profile

CLINICAL CHEMISTRY REAGENTS. Product Profile Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting

More information

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry Lot: 1711232000 Level 1: 230680 Level 2: 230700 C Standatrol S-E 2 niveles Lyophilized serum for precision control in clinical chemistry USES Standatrol S-E 2 niveles is adaptable to different uses: -

More information

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry Lot: 1702210520 Level 1: 201920 Level 2: 201930 C Standatrol S-E 2 niveles Lyophilized serum for precision control in clinical chemistry USES Standatrol S-E 2 niveles is adaptable to different uses: -

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385

More information

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry

Standatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry Lot: 1404137860 (Exp.: 2016/04) Level 1: 137860 (Exp.: 2016/04) Level 2: 137860 (Exp.: 2016/04) C Standatrol S-E 2 niveles Lyophilized serum for precision control in clinical chemistry USES Standatrol

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com

More information

LIQUID ASSAYED CHEMISTRY CONTROL PREMIUM PLUS - LEVEL 1 (LIQ CHEM ASY PREMIUM PLUS 1)

LIQUID ASSAYED CHEMISTRY CONTROL PREMIUM PLUS - LEVEL 1 (LIQ CHEM ASY PREMIUM PLUS 1) 0086 LIQUID ASSAYED CHEMISTRY CONTROL PREMIUM PLUS - LEVEL 1 (LIQ CHEM ASY PREMIUM PLUS 1) CAT. NO. LAL 4213 LOT NO. 238UL SIZE: 12 x 5 ml EXPIRY: 2018-04-28 GTIN: 05055273209006 INTENDED USE This product

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: 60 Whitfield Street London W1N 4EU Contact:

More information

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2)

HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2) 0843 HUMAN ASSAYED MULTI-SERA - LEVEL 2 (HUM ASY CONTROL 2) CAT. NO. HN1530 / HS2611 LOT NO. 899UN SIZE: 20 x 5ml / 5 x 5ml EXPIRY: 2018-02 INTENDED USE This product is intended for in vitro diagnostic

More information

BS-230. Clinical Chemistry Analyzer

BS-230. Clinical Chemistry Analyzer BS-230 Clinical Chemistry Analyzer Flexible loading: 80 sample positions, Up to 80 reagent positions. Up to (40 fixed + 40 interchangeable) μl minimum reaction volume Disposable Cuvettes to avoid contamination

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information