Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS
|
|
|
- Joleen Ball
- 5 years ago
- Views:
Transcription
1 Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada
2 Outline/Objectives: Overview: Value of reference intervals Overview of CALIPER project CALIPER-CHMS collaboration, summary of a Canadian reference interval database
3 Central Role of Laboratory Medicine In Healthcare Delivery Laboratory Medicine Laboratory Medicine is part of the multi-disciplinary team at the centre of healthcare Identify risk factors & symptoms Evaluate response LAB Diagnose disease Determine appropriate treatment The quality of the Clinical Laboratory Service is critically dependent on accurate interpretation of lab results based on accurate reference intervals or decision limits
4 Reference intervals: Major Gaps Most available reference intervals determined on older/less accurate laboratory instruments/methodologies Many reference intervals incomplete or unavailable for different age groups Most available only for Caucasian populations Limited/no data for many new and emerging disease biomarkers Available data from samples collected from hospitalized adults and children
5 Development over time: Physiological changes over time may influence analyte levels Adult reference intervals often based on narrow window of time and may not be representative of other developmental stages Dramatic physiological changes take place over the course of development and aging
6 Children are not small adults & Geriatrics are not old adults Body weight doubles by 6 months of age and triples by the first birthday Body length increases by 50% by 1 year Major organ systems grow and mature Accelerated growth and sexual maturation occur during puberty Bones decrease in density Muscle mass decreases in strength Organ function declines Stiffening of blood vessels and heart Decreased immune function
7 Gaps in accurate reference intervals pose a serious risk to patient care and outcomes Use of inappropriate reference intervals >>> risk of further blood collection, infection risk, pain and anxiety, lengthier stays, and unpleasant or invasive diagnostic procedures Inadequate reference intervals >>> costly and devastating, and can contribute to erroneous/delayed diagnosis of many diseases Reviewed in: Critical Reviews in Clinical Laboratory Sciences (2013)
8 CALIPER Initiative To develop a comprehensive database of covariate stratified pediatric reference intervals To disseminate study results to pediatric healthcare community worldwide using novel knowledge translation strategies
9 CALIPER Reference Database I. Biochemical Markers (Chemistry, Proteins, Enzymes) Clinical Chemistry 2012 II. Immunoassays/Endocrine/Fertility Clinical Chemistry 2013a Clinical Chemistry 2013b III. Special Chemistry/Tumor Markers Clinical Chemistry 2014a Clinical Chemistry 2014b Clinical Chemistry 2014c (Abbott Architect c8000) Online Database Current: >100 Biomarkers
10 The Canadian Health Measures Survey: CALIPER-CHMS Collaboration Expand CALIPER RI database: pediatric, adult and geriatric reference intervals established Observed fluctuations in analyte levels over the course of a lifetime (3-79 years)
11 What is the CHMS? The Canadian Health Measures Survey (CHMS) is a Canadawide health information survey conducted by Statistics Canada Launched in 2007 Cycle 1: Cycle 2: Cycle 3: Cycle 4: Determine health status, identify relationships between disease risk factors and health status, and explore emerging public health issues
12 CHMS: A Canadian Representative Sample 16 collection sites: Atlantic (2), Quebec (4), Ontario (6), Prairies (2), British Columbia (2) Terrace Kitimat Edmonton Saguenay St Hyacinthe Fredericton Kelowna Regina Thunder Bay Lava l Montreal Brockville Shelburn e Kitchener-Waterloo Toronto (2) Hamilton
13 CHMS: Sample Acquisition ~12,000 Canadians (11 age-gender groups, per group, per cycle) 3-79 years old Collects important health information through: Household interview (nutrition, smoking, alcohol, medical history) Direct physical measurements (blood pressure, height, weight) Blood and urine samples
14 CHMS: Laboratory Measures Blood General: Complete blood count (CBC), blood chemistry panel Cardiovascular health: C- reactive protein (high sensitivity), HDL, LDL, total cholesterol, triglycerides and fatty acids Diabetes: Fasting, non-fasting and random glucose, fasting insulin and HbA1 c Nutritional status: Ferritin, RBC folate, vitamin B12 and vitamin D Urine Kidney function: Creatinine and microalbumin Nutritional status: Iodine
15 Exclusion Criteria: Participants were excluded from the analysis on the basis of: Diagnosed serious/chronic medical illness Use of prescription medication within past month Pregnant
16 Statistical Analysis Exclude Respondents based on defined exclusion criteria Generate scatter plot and remove extreme outliers using visual inspection Inspect Partitions using scatterplots to identify trends in age and sex Determine Partitions by testing with the Harris & Boyd method Check Normality using Q-Q Plot and Shapiro Wilk test Transform Data using Box-Cox Method Normal Data: remove outliers using Tukey test twice Skewed Data: remove outliers using adjusted Tukey test twice Calculate Reference Interval using non-parametric rank method Calculate 90% Confidence Interval and Median
17 Excluded Participants: Age Range 3-18 y y y Average portion of individuals excluded + outliers removed 20% 42% 78% Definition of health with aging?
18 Clinical Chemistry 2015 (August Issue) CHMS Reference Database
19 CALIPER-CHMS Collaboration Clinical Chemistry 2015a
20 CALIPER-CHMS Collaboration Clinical Chemistry 2015a
21 CALIPER-CHMS Collaboration Clinical Chemistry 2015a
22 CALIPER-CHMS Collaboration Clinical Chemistry 2015b
23 CALIPER-CHMS Collaboration Clinical Chemistry 2015c
24 CALIPER-CHMS Database Chemistry biomarkers: 24 markers alanine aminotransferase (ALT), albumin, alkaline phosphatase (ALKP), aspartate aminotransferase (AST), bicarbonate, bilirubin (total), calcium (total), chloride, cholesterol (total), creatinine (serum), creatinine (urine), glutamyltransferase (GGT), glucose, HDL cholesterol, lactate dehydrogenase (LDH), LDL cholesterol, phosphate, potassium, protein (total), sodium, triglycerides, urea, uric acid, urine iodine Immunoassay/special chemistry: 13 markers apoa1, apob, ferritin, glycohemoglobin (Hb A1c), high-sensitivity C-reactive protein (hscrp), homocysteine, insulin, parathyroid hormone (PTH), red blood cell (RBC) folate, serum folate, urine albumin, vitamin B12, 25-OH vitamin D Hematology: 16 markers hemoglobin, hematocrit, red blood cell (RBC) count, RBC distribution width (RDW), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), platelet count, mean platelet volume (MPV), total white blood cell (WBC) count, neutrophils, lymphocytes, monocytes, eosinophils, basophils, fibrinogen
25 CALIPER-CHMS Collaboration I. Establishment of reference interval database: - Establish pediatric, adult and geriatric reference intervals for analytes tested by CHMS *based on large and representative sample of the Canadian population II. Graphs show population distributions for each analyte - Fluctuations in analyte levels that occur over the course of a lifetime (3-79 yrs)
26 Acknowledgements - Team CALIPER CALIPER co-investigators across Canada St Johns, Montreal, Ottawa, Hamilton, Toronto, Saskatoon, Vancouver SICKKIDS/McMaster Dr. Khosrow Adeli, Michelle Nieuwesteeg, Olivia Virag, Megan Smith, Yunqi Chen, Ashley Cohen, Jennifer Clarke, Caitlyn Daly, Victoria Bevilacqua Sarah Delaney, Man Khun Chan Caitlin Wilkinson Dr. Joseph Macri Dr. David Colantonio Dr. Lianna Kyriakopoulou U of T Clinical Chemistry Fellows Statistics Canada: Suzy Wong David Blais CALIPER Volunteers (>60 University Students) Industry: Dr. David Armbruster (Abbott) Dr. Jack Zakowski (Beckman) Funding: CIHR Abbott, Beckman, Roche, Siemens, Ortho SickKids Foundation DPLM, SickKids
Clinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
Complete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
Rapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
Clinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
NORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
NEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Clinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
ENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
BASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
BC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
Tables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
Results Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
Fullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
Delta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
Research Data Available
Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family
* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
Senior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
Analyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
Inspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
Understanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
Weight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
Weight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
Online catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
GRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
Get to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
Supplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
What Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
Please contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
Get to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
Supplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
ADPedKD: detailed description of data which will be collected in this registry
ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385
WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:
WSLH PT roficiency esting Calibration Verification/ Linearity Products Products provided in partnership with: www.wslhpt.org 800-462-5261 PTService@slh.wisc.edu General Chemistry Ammonia/Ethanol - 5 x
Blood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
Reference Intervals of Hematology and Clinical Chemistry Analytes for 1-Year-Old Korean Children
Original Article General Laboratory Medicine Ann Lab Med 2016;36:481-488 http://dx.doi.org/10.3343/alm.2016.36.5.481 ISSN 2234-3806 eissn 2234-3814 Reference Intervals of Hematology and Clinical Chemistry
SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments
Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that
Test Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
Results Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
Reference Intervals. Graham Jones / Gus Koerbin
Reference Intervals Graham Jones / Gus Koerbin Adult CRI - Harmonisation Harmonisation 1 2012: (13 tests + 1 calculation) Harmonisation 2 2013: Confirm 2012 recommendations. Discussed: albumin, globulin,
15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
COMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.
5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:
Specimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
Multiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
Specimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
Health Screening for Nanyang Technological University (NTU)
Health Screening for Nanyang Technological University (NTU) Health screening packages are offered at corporate rates to NTU staff and dependents at the indicated clinics. Please refer to this document
Basic Blood Chemistry, by Sharlene Peterson CLASS: G610
Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 This is your test but do not try to fill in the blanks! We created a Test Answer Sheet which is easy to download, fill in the answer, and email.
The Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
CERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
CTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
Pediatric reference intervals for biochemical markers: gaps and challenges, recent national initiatives and future perspectives
In this issue: Recent Advances in Pediatric Laboratory Medicine Pediatric reference intervals for biochemical markers: gaps and challenges, recent national initiatives and future perspectives Houman Tahmasebi
What if you could help your team realise their health goals?
What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department Poole Hospital Longfleet Road Poole BH15 2JB Contact: Dr Fergus Jack Tel: +44 (0) 1202 442 497 E-Mail: Fergus.jack@poole.nhs.uk
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
Routine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES
M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK - Cheltenham Hospital Hatherley Lane Cheltenham GL51 6SY Contact: Chris Watson Tel: +44 (0) 1242 246516 E-Mail: chris.watson@nuffieldhealth.com
DIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
The positive side of overdiagnosis
The positive side of overdiagnosis Does an immediate comprehensive panel of laboratory tests in outpatient care improve patient outcomes? Bram Vrijsen, Maarten ten Berg, Christiana Naaktgeboren, Jolande
Pediatric Within-Day Biological Variation and Quality Specifications for 38 Biochemical Markers in the CALIPER Cohort
Papers in Press. Published December 23, 2013 as doi:10.1373/clinchem.2013.214312 The latest version is at http://hwmaint.clinchem.org/cgi/doi/10.1373/clinchem.2013.214312 Clinical Chemistry 60:4 000 000
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
Weight Your weight. Body Mass Index Measure of weight to hei. Waist Circumference The circumference of you
Lab Results for Ben Greenfield Last Test Date: 2015-01-27 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures
Bio-Rad Laboratories EXTERNAL QUALITY ASSURANCE SERVICES EQAS. External Quality Assurance Services
Bio-Rad Laboratories EXTERNAL QUALITY ASSURANCE SERVICES EQAS External Quality Assurance Services Table of Contents About Bio-Rad EQAS EQAS Program Overview.... 3 Online EQAS Resources... 4 Submitting
Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
Evidence Based Commutability: Bias 2 Study. Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA
Evidence Based Commutability: Bias 2 Study Janice Gill Manager RCPAQAP Chemical Pathology Adelaide SA Australian Bias Studies conducted by Gus Koerbin, ACT Pathology on behalf of AACB Harmonisation Committee
no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
Questionnaire. Traceability in EQA. Traceability
Questionnaire in EQA QUESTIONNAIRE ON TRACEABILITY QUESTIONNAIRE ON TRACEABILITY GENERAL INFORMATION Name EQA organisation Country Specify the total number of measurands in the schemes of your EQA organisation
HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE
HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website: