71 % Foods (processed foods, margarine, chocolate, etc.) 24 % Consumer products (Detergent, cosmetic, candles, etc.)
|
|
- Marybeth Fletcher
- 5 years ago
- Views:
Transcription
1 111!1 Jr... The University1 of Nottingha1m UNITED KINGDOM CHINA MALAYSIA Early defence responses in Elaeis guineensis lignin biosynthesis pathwayduring pathoge esis of Ganoderma boninense Carmen Goh Kar Mun, Matthew Dickinson, Kinya Hotta, Christina V. Supramaniam School of Biosciences, Faculty of Sciences, The University of Nottingham Malaysia Campus 1
2 71 % Foods (processed foods, margarine, chocolate, etc.) 24 % Consumer products (Detergent, cosmetic, candles, etc.) 5 % Energy Source (Electricity, heating, fuels, etc.) 2
3 Collapse of oil palm trees Decaying of internal bole tissue Emergence of G. boninense fruiting bodies Poor in foliar development 3
4 Deposition of lignin polymers on plant cell walls Roles: Rigidity, support and delay pathogen penetration Lignin: Complex racemic aromatic heteropolymer (Boerjan et al., 2003) Oil palm s lignin composition (Suzuki et al., 1998) Aryl ether-linked syringyl units (S) p-hydroxybenzoic acid (H) Vanillin and vanillic acids (G) 4
5 Biosynlhesis ~atbway Ugnin HO HO N tti PAL,,?, ::::,._ CoA.,s O CoA"S O CoA"S C4H cinnamic acid 4CL OH -+ OH OH OH p-coumaric p-coumaroyl CoA caffeoyl CoA acid..j,.ccr feruloyl CoA Phenylalanine ammonia lyase (PAL) First enzyme involvedh 0 O O -+~1-+ phenylalanine O..J,.ccR H 0 0 H 0 anoi d Catalyze the entry of phenylalanine into the p he nylprop CAld5H and lignin biosynth esis pathway (Vanh olme et al., 2010 ) COMT OMo-+HO H OMo--+:.o OMo OH OH OH H e (C4H) Cinnamate 4-hydroxylaOs o d mapraeldn ehd ydee nt monoconx ifeyrag ldehyda e ses5-hydroxysinapaldehyde LiCgyntoinchrome P450p--codue coniferaldehyde Bio sycnathaleyszeis second reaction of the pathway to produce pcoumaric acid (Chapple, 1998; Dixon and Paiva, 1995) +CAD p-coumaryl alcohol +CAD coniferyl alcohol + H-Lignin G-Lignin +CAD sinapyl alcohol + S-Lignin Figure 1 The main monolignols biosynthetic pathway (Vanholme et al., 2010) 5
6 T o s tu ud yy the oiil al m pa d efen nc e e sponses iin rre pon iin el attiioonn t o lliigniiin biio syntthheessisis up n fectiioonn b y rre Gaan n od d errm aa b onin n eennssee iin n a n iin viittr o sy y stem. 6
7 Treatments on oil palm seedlings Physiological Pathology T1, non-inoculatedand + non-wounded T2, non-inoculated + wounded Studies of Oil Palm in an In T3, inoculated + wounded Vitro System Duration of experiment: 8 days Molecular and Biochemical Studies of Treated Oil Palm Impacts of G. boninense Pathogenesis on Lignin Biosynthesis 7
8 la Vitro lnlection ol Dll Palm Seedlln1s G. boninense (GBLS) mycelium & Oil palm seedlings Artificial wounding on seedlings stem Acquire GBLS mycelium Inoculation of GBLS mycelium Assembly of Incu tissue culture jar Incubation in growth chamber (27 C, 16 h daylight, 50 % humidity) 8
9 Gene Expression Studies Biochemical Enzymes Assay Total RNA Extraction Lignin Biosynthesis Enzymes Extraction - I. c" DNA Synthesis b y Reverse Transcriptase Relative quantification of lignin biosynthesis genes expression EgPALTee and EgC4HTee (Tee et al., 2013) Reference gene: EgActin and EgCyP Total Protein Assay Quantification of Lignin Biosynthesis Enzymes Activities 9
10 Impacts ol a. boaloea6e Pathogenesis on Lilldn Biosyntbesis Quantification of Total Lignin Contents [Lignothioglycolic Acid (LTGA) Assay] Sample Preparation for Histochemical Staining Fixation Dehydration - Infiltration Impregnation Mounting - Sectioning using microtome Histochemical Staining of Oil Palm Seedlings - Toluidine blue O - Maúle reagents - Phloroglucinol-HCl 10
11 DerivatiKe Mell Curw:e Analysis Oeriv tivemeft Derivative Melt.,.,, EgActin EgCyP S i I r I... i ~!r 6.'0 o.15 I A o.os.. NTC _. ",. " T,tfflOC"ll!loff" C" AB 60.. NTC_... DefivativeM~t.. 90 Derivative Me-It <US OJO EgPAL ().)() 75 IO T m~r,1t1,1t ("C) 70.,. EgC4H 02S i I OlO o.20!r ,.! I..,.... ODS A C.. ",. NTC " _. l-t)ef" b.w ("() AD " " 70 NTC _. T.-,,Pff tur1t("() Figure 1 Derivative melt curves (A) EgActin, (B) EgCyP, (C) EgPAL and (D) EgC4H genes amplified from treated oil palm seedlings in real time PCR amplification. 11
12 Phenylalanine A1nmonia Lyase A B Relative Expression of EgPAL in Treated Oil Palm Seedlings Phenylalanine ammonia lyase (PAL) level in treated oil palm seedlings c 'ai g 3.5 -:...u 0... I Cl mt2 GI 11 -~ o E,.. I 2.0 mt3 ~1:~ + T1 + T2 + T3 Q.,.... c IJ x o 2.5 w..c GI Cl c: e 1.5 c Days of Treatment Days oftreatment Fig urtreans2 i(a tivestiemu xprelassion (B)ALenzym actioun vitding ies en) trrelaapid tion andof EgP upone w ofand PALininfecttreaion ted. oil palm seedlings within 8 days of incubation. Error bars: standard error of mean (SEM) of repliecgp elys atale readiexpngress sion from w thraseecrlosound asofso PALts. enzyme activity excperiatied men Postpone of PAL peak production Post-transcriptional modifications ability of PAL was reduced 2006) (Ballester et al., 12
13 B Relative Expression of EgC4H in Treated Oil Palm Seedlings A Cinnamate 4-hydroxylase (C4H) level in treated oil palm seedlings c: '.a..l. c :...c. 0.2 QI ~ ~ )( s: WU QI 'ti >-0.., LL Ill... TI 8 TI E c:... T3 ';" 6 e 4 ci o QI a: + T1.. T2 ';" C) o.o,......, Days of Treatment """T"'"" ~ Day of Treatment Figure 3 Cinnamate 4-hydroxylase (C4H) (A) relative expression and (B) enzyme actievg sesdeeadtlianglas tw erithtiim incuwboatuionnd.eedrr& itice4s Hineoxilppre alsm n 8e dcaoyusrose f in or ibnafe rsc:tsetd ansdeaer dleinrrgosr. of mean (SEM) of replicate readings from three rounds of experiments. Transcriptional regulation of C4H enzymes controlled by multiple EgC4H homologs. C4H genes exist as a multigene family in many plants 1995; Betz et al., 2001) (Lu et al., 2006; Potter et al., 13
14 Total lignin in T3 seedlings were significantly higher (29 % on Day 8) Lignin concentration was increased in rice (Taheri et al., 2014), date palm (Saidi et al., 2013), tomato (Mohr and Cahill, 2007) rapidly upon infection Reduction of lignin on Day 4 in T3 seedlings Suppression of phenolic and phenylpropanoid metabolites by fungus during initial infection development (Latreche and Rahmania, 2011; Saidi et al., 2013) Figure 4 Quantification of total lignin contents in treated oil palm seedlings on a time course after artificial infection of seedlings with G. boninense. Error bars: standard error of mean (SEM) of replicate readings from three rounds of experiments. 14
15 Figure 5 TBO staining of lignin in oil palm basal stem cross section between different treatments (Bars, 100 µm. EP, epidermis; C, collenchyma; CU, cuticle layer; VB, vascular bundle. Arrows showed intensive staining of respective dyes on specimens) TBO stained lignified elements in green to blue-green colour (Yeung, 1998) Lignin accumulated in an increasing order upon infection (Musetti et al., 2000; Pannecoucque and Höfte, 2009). Blue staining on vascular bundles (T1, T2 & T3), collenchyma & cuticle layer (T3) 15
16 Figure 6 Maúle staining of lignin in oil palm basal stem cross section between different treatments (Bars, 100 µm. EP, epidermis; C, collenchyma; CU, cuticle layer; VB, vascular bundle. Arrows showed intensive staining of respective dyes on specimens) Maúle reagent detects syringyl-lignin (S) in wine-red to brown response (Sewalt et al., 1997) Higher amount of S lignin in infected tissues (Saidi et al., 2013; Eynck et al., 2012) 16
17 Early induction of lignin biosynthesis genes and enzymes (PAL and C4H) in oil palm seedlings during wounding and infection by G. boninense Total lignin contents in wounded and infected seedlings were increased, with greater staining of TBO and Maúle reagent. A positive correlation between lignin contents and biosynthesis intermediates 17
18 Development of oil palm cultivars with induced resistance towards BSR Up-regulation of lignin biosynthesis genes (mirna-mediated upregulation) (Orang et al., 2014) Selective breeding for inducible resistance (Tamiru et al., 2015) Further focus on phytoalexin and oxidative burst resistances in oil palm 18
19 1. Ballester, AR, Lafuente, MT & González-Candelas, L (2006) Postharvest Biology and Technology, 39(2), Betz, C, McCollum, TG & Mayer, RT (2001) Plant Molecular Biology, 46(6), Boerjan, W, Ralph, J & Baucher, M (2003) Annual Review of Plant Biology, 54, Chapple, C (1998) Annual Review of Plant Physiology and Plant Molecular Biology, 49, Dixon, RA & Paiva, NL (1995) The Plant Cell, 7(7), Eynck, C, Séguin-Swartz, G, Clarke, WE & Parkin, IAP (2012) Molecular Plant Pathology, 13(8), Latreche, K & Rahmania, F (2011) Physiological and Molecular Plant Pathology, 76(2), Lu, S, Zhou, Y, Li, L & Chiang, VL (2006) Plant & Cell Physiology, 47(7), Mohr, PG & Cahill, DM (2007) Functional & Integrative Genomics, 7(3), Musetti, R, Favali, MA & Pressacco, L (2000) Cytobios, 102(401), Orang AV, Safaralizadeh doi: /2014/ R, Bavili MK (2014) International Journal of Genomics, 12. Pannecoucque, J & Höfte, M (2009) BMC Plant Biology, 9(1), Potter, S, Moreland, DE, Kreuz, K & Ward, E (1995) Drug Metabolism and Drug Interactions, 12(3-4), Saidi, MN, Bouaziz, D, Hammami, I, Namsi, A, Drira, N & Gargouri-Bouzid, R (2013) Plant Science, 211, Sewalt, V, Ni, W, Blount, JW, Jung, HG, Masoud, SA, Howles, PA & Dixon, RA (1997) Plant Physiology, 115(1), Suzuki, S, Shintani, H, Park, S, Saito, K & Laemsak, NM (1998) INIST-CNRS, 52(4), Taheri, P, Irannejad, A, Goldani, M & Tarighi, S (2014) European Journal of Plant Pathology, 140(4), Tamiru A, Khan ZR, Bruce TJA (2015) Current Opinion in Insect Science, 9, Tee, SS, Tan, YC, Abdullah, F, Ong-Abdullah, M & Ho, CL (2013) Tree Genetics & Genomes, 9(2), Vanholme, R, Demedts, B, Morreel, K, Ralph, J & Boerjan, W (2010) Plant Physiology, 153(3), Yeung, EC (1998) In SJ Karcher (Ed.), Tested Studies for Laboratory Teaching, pp
20 Special thanks to:ms. Christina Supramaniam Prof. Matthew Dickinson Dr. Kinya Hotta Ms. Siti Norazlin Mr. Jonathan Foong Ms. Jennie Choo Chin Nee (Applied Agricultural Resources Sdn. Bhd.) Pn. Rosna Bt Angsor (Tissue Culturist - MPOB) Friends and family 20
Lignin and the General Phenylpropanoid Pathway. Introduction and Importance:
Lignin and the General Phenylpropanoid Pathway 13. Phenolics and Lignin p. 1 Introduction and Importance: Phenolic: a compound consisting of an aromatic ring plus at least one hydroxyl [= phenyl group],
More informationRe-Designing Alfalfa f for
Re-Designing Alfalfa f for Increased Yield and Quality Trait Targets Agronomic Traits (input traits) Herbicide tolerance Pest resistance Abiotic stress tolerance Increased yield per se Quality Traits (output
More informationLignin Monomers from Outside the Canonical Monolignol Biosynthetic Pathway
Lignin Monomers from utside the Canonical Monolignol Biosynthetic Pathway José C. del Río: Research Scientist, IRNAS-CSIC, Spain, delrio@irnase.csic.es Jorge Rencoret: Research Scientist, IRNAS-CSIC, Spain,
More information0.5. Normalized 95% gray value interval h
Normalized 95% gray value interval.5.4.3.2.1 h Supplemental Figure 1: Symptom score of root samples used in the proteomics study. For each time point, the normalized 95% gray value interval is an averaged
More informationHigh Resolution LC-MS Data Output and Analysis
High Resolution LC-MS Data Output and Analysis Software for comparing full-scan datasets MetAlign method Software for comparing full-scan datasets MetAlign method Base line correction and peak pickingnew
More informationSTEFES GMBH D Hamburg, Wendenstr. 21b Tel +49(0) Fax +49(0)
Sanovita Produktions- und Vertriebs GmbH D-78532 Tuttlingen, Bahnhofstrasse 71 Telefon: +49 (0) 7461 9335-0 Telefax: +49 (0) 7461 9335-44 info@sanovita-gmbh.de www.sanovita-gmbh.de STEFES GMBH D- 20097
More informationLignin Modification via Expression of a Tyrosine Rich Cell Wall Peptide in Hybrid Poplar. The Pennsylvania State University, USA
Lignin Modification via Expression of a Tyrosine Rich Cell Wall Peptide in Hybrid Poplar John Carlson 1, Yajun Ya 2, Xinli Xia 2, Weilun Yin 2, Haiying Liang 3, Chris Frost 1, icole Brown 1, Ming Tien
More informationTailoring lignin biosynthesis for emerging bioenergy and bioproduct applications. Scott Sattler
Tailoring lignin biosynthesis for emerging bioenergy and bioproduct applications Scott Sattler Wheat, Sorghum and Forage Research Unit USDA-ARS Lincoln, Nebraska USA Scott.Sattler@ars.usda.gov Sorghum:
More informationRoadmap of Phenylpropanoids (Fig 18.1)
Roadmap of Phenylpropanoids (Fig 18.1) Phenolics and Phenylpropanoids (non- lignin) These are considered secondary plant metabolites (SPMs) = "small organic plant cons/tuents, not required for day- to-
More information6 CHAPTER-6 TOTAL PHENOLIC AND FLAVONOID CONTENT DETERMINATION
6 CHAPTER-6 TOTAL PHENOLIC AND FLAVONOID CONTENT DETERMINATION 6.1 PHENOLIC COMPOUNDS Phenolic compounds are a group of chemical compounds that are widely distributed in nature. They are simple compounds
More informationChanges in Cell Wall Polymers and Degradability in Maize Mutants Lacking and 5 0 -O-Methyltransferases Involved in Lignin Biosynthesis
Regular Paper Changes in Cell Wall Polymers and Degradability in Maize Mutants Lacking 3 - and 5 --Methyltransferases Involved in Lignin Biosynthesis Silvia Fornalé 1, Jorge Rencoret 2, Laura García-Calvo
More informationNano-Sized Delivery For Agricultural Chemicals
Nano-Sized Delivery For Agricultural Chemicals Min Zhao 1, Lei Liu 1, Robert Ehr 1, Tom Kalantar 2, Dale Schmidt 2, Todd Mathieson 1, Mike Tolley 1, Kerrm Yau 1, Steven Wensing 1 1 Dow AgroSciences LLC.,
More informationTranscript Level Analysis of Lignin and Flavonoid Biosynthesis Related Genes in
American Journal of Plant Sciences, 2014, 5, 2764-2772 Published Online August 2014 in SciRes. http://www.scirp.org/journal/ajps http://dx.doi.org/10.4236/ajps.2014.518293 Transcript Level Analysis of
More informationOnline Resource 11. Unrooted phylogenetic trees of functional lignin biosynthesis-related proteins, involved in shikimate, aromatic amino acid,
1 Online Resource 11. Unrooted phylogenetic trees of functional lignin biosynthesis-related proteins, involved in shikimate, aromatic amino acid, monolignol and C 1 -metabolism pathways, of jute fibres
More information9/21/2016. Composition and Compositional Changes During Development: Part II. V. Major Components of Fruits and Vegetables.
Composition and Compositional Changes During Development: Part II Dr. Jeffrey K. Brecht Horticultural Sciences Department, Gainesville Dr. Mark A. Ritenour Indian River Research and Education Center, Fort
More informationMolecular and metabolic analyses in developing olive fruit in relation to different water regimes
Molecular and metabolic analyses in developing olive fruit in relation to different water regimes F. Martinelli, L. Sebastiani and P. Tonutti BioLabs, Scuola Superiore Sant Anna Piazza Martiri della Libertà
More informationFunctional genomics reveal that the serine synthesis pathway is essential in breast cancer
Functional genomics reveal that the serine synthesis pathway is essential in breast cancer Results Presented by Stacey Lin Lloyd Lab http://www.amsbio.com/expression-ready-lentiviral-particles.aspx Overview
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. AtMYB12 antibody detects both Arabidopsis and tomato MYB12 protein. (a) AtMYB12 antibody detects both SlMYB12 and AtMYB12 in tomato fruit. Both WT and AtMYB12
More informationSupplemental data. Uppalapati et al. (2012) Plant Cell /tpc
PAL Control P. emaculata 0 8 24 48 8 24 48 OPR Control P. emaculata 0 8 24 48 8 24 48 CHS PR3 CHR PR5 CHI PR10 IFS IFR Supplemental Figure 1. Expression profiles for selected genes in phenylpropanoid pathway
More informationLignin biosynthesis during wound healing of potato tubers in response to gamma irradiation
Postharvest Biology and Technology 18 (2000) 267 272 www.elsevier.com/locate/postharvbio Short communication Lignin biosynthesis during wound healing of potato tubers in response to gamma irradiation M.S.
More informationFinal Report for Tufts Institute of the Environment Graduate Fellowship
Final Report for Tufts Institute of the Environment Graduate Fellowship TITLE: Using Jasmonates to Enhance Long-Term Sequestration of Atmospheric Carbon. Benjamin A. Babst, Ph. D. Department of Biology,
More informationRice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants
Rice in vivo RN structurome reveals RN secondary structure conservation and divergence in plants Hongjing Deng 1,2,,5, Jitender heema 3, Hang Zhang 2, Hugh Woolfenden 2, Matthew Norris 2, Zhenshan Liu
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. PL gene expression in tomato fruit.
Supplementary Figure 1 PL gene expression in tomato fruit. Relative expression of five PL-coding genes measured in at least three fruit of each genotype (cv. Alisa Craig) at four stages of development,
More informationSALK_ SALK_ SALK_ GABI_692H09 G A G A SALK_ CL1.3 4CL1.1 4CL1.2 SM_3_ CL1.3 4CL1.1 4CL1.
Supplemental Data. Vanholme et al. Plant Cell. (212). 1.115/tpc.112.12574 pal1-2 pal1-3 pal2-2 SALK_357 5 3 SALK_2284 5 3 SALK_92252 5 3 GABI_692H9 residual expression -5.3-4.6-4.5 pal2-3 c4h-2 5 3 c4h-3*
More informationThe benefits of using seafood processing waste as a soil amendment in potato production
The benefits of using seafood processing waste as a soil amendment in potato production Rick D. Peters Agriculture and Agri-Food Canada, Charlottetown, PE C1A 4N6, Canada Compost Council of Canada Charlottetown,
More informationEfficient Biomass Conversion: Delineating the Best Lignin Monomer-Substitutes
Efficient iomass onversion: Delineating the est Lignin Monomer-Substitutes Investigators John Ralph, Professor, iochemistry; Xuejun Pan, Professor, iological Systems Engineering; Sara Patterson, Professor,
More informationDifferential accumulation of monolignol-derived compounds in elicited flax (Linum usitatissimum) cell suspension cultures
Planta (2006) 223: 975 989 DI 10.1007/s00425-005-0156-1 RIGINAL ARTICLE C. Hano Æ M. Addi Æ L. Bensaddek Æ D. Croˆnier S. Baltora-Rosset Æ J. Doussot Æ S. Maury Æ F. Mesnard B. Chabbert Æ S. Hawkins Æ
More informationPhenolic Profiling of Caffeic Acid O-Methyltransferase-Deficient Poplar Reveals Novel Benzodioxane Oligolignols 1
Phenolic Profiling of Caffeic Acid O-Methyltransferase-Deficient Poplar Reveals Novel Benzodioxane Oligolignols 1 Kris Morreel 2,JohnRalph 2, Fachuang Lu, Geert Goeminne, Roger Busson, Piet Herdewijn,
More informationSuggested homework problems: 8.8, 8.13, ,
Chapter 8 Outline: Haloalakanes, Halogenation, & Radical reactions Cover 8.1-8.3 on your own 1. Halogenation of Alkanes A. Mechanism of Halogenation B. Regioselectivity & Stereoselectivity of Halogenation
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationTitleAbstracts Author(s) Citation Wood research : bulletin of the Woo University (1979), 65: 111-114 Issue Date 1979-03-24 URL http://hdl.handle.net/2433/53362 Right Type Others Textversion publisher Kyoto
More informationThe Lipid Underground: Dissecting the Alkyl Hydroxycinnamate Pathway
The Lipid Underground: Dissecting the Hydroxycinnamate Pathway Dylan K Kosma, Adam Rice, Isabel Molina, Owen Rowland, Frédéric Domergue, John Ohlrogge, Mike Pollard Department of Plant Biology, Michigan
More informationDepartment of Genetics and Department of Biochemistry, North Carolina State University, Raleigh, North Carolina
The Plant Cell, Vol. 7, 1001-1013, July 1995 O 1995 American Society of Plant Physiologists Lignin Biosynthesis Ross Whettena9 and Ron SederoffaVb a Forest Biotechnology Group, Department of Forestry,
More informationMechanochemical Modification of Lignin and Application of the Modified Lignin for Polymer Materials
Mechanochemical Modification of Lignin and Application of the Modified Lignin for Polymer Materials Jinwen Zhang Composite Materials and Engineering Center Washington State University Significance Petroleum-based
More informationUnisooth PN-47 A complete reduction of pro-inflammatory factors for an instant soothing
Unisooth PN-47 A complete reduction of pro-inflammatory factors for an instant soothing Skin irritation is amplified and controlled by various signaling pathways. By acting directly on the causes of skin
More informationStone formation in peach fruit exhibits spatial coordination of the lignin and flavonoid pathways and similarity to Arabidopsis dehiscence
Stone formation in peach fruit exhibits spatial coordination of the lignin and flavonoid pathways and similarity to Arabidopsis dehiscence Christopher D Dardick 1 *, Ann M Callahan 1, Remo Chiozzotto 2,
More informationPotential use of High iron and low phytate GM rice and their Bio-safety Assessment
Potential use of High iron and low phytate GM rice and their Bio-safety Assessment Dr. Karabi Datta University of Calcutta, India Background High iron rice and iron bioavailability Micronutrient deficiency
More informationRpp-Mediated Gene Expression in Resistant and Susceptible Soybean Lines
Rpp-Mediated Gene Expression in Resistant and Susceptible Soybean Lines Katherine Schneider USDA-ARS, Foreign Disease-Weed Science Research Unit Martijn van de Mortel Iowa State University, Department
More informationCHARACTERIZATION OF LIGNIN PRECIPITATED FROM THE SODA BLACK LIQUOR OF OIL PALM EMPTY FRUIT BUNCH FIBERS BY VARIOUS MINERAL ACIDS
AJSTD Vol. 21 Issue AJSTD 1 pp. Vol. 57-67 21 Issue (2004) 1 CHARACTERIZATION OF LIGNIN PRECIPITATED FROM THE SODA BLACK LIQUOR OF OIL PALM EMPTY FRUIT BUNCH FIBERS BY VARIOUS MINERAL ACIDS M.N. Mohamad
More informationOrganic and biochemical synthesis of monolignol biosynthetic pathway intermediates
Jie Liu 2012-2-8 Organic and biochemical synthesis of monolignol biosynthetic pathway intermediates 1. Organic synthesis of 5-hydroxyferulic acid Malonic acid 3, 4-Dihydroxy-5-methoxy-benzaldehyde 0.1
More informationExploring DAPG and Phenazine producing PGPR strains and fungal antagonists for the management of Noni diseases
WNRF Technical Bulletin : 11 Exploring DAPG and Phenazine producing PGPR strains and fungal antagonists for the management of Noni diseases by Tamil Nadu Agricultural University, Coimbatore- 641 003 &
More informationRapid induction by fungal elicitor of the synthesis of cinnamyl-alcohol dehydrogenase, a specific enzyme of lignin synthesis
Eur. J. Biochem. 169, 73-77 (1987) c) FEBS 1987 Rapid induction by fungal elicitor of the synthesis of cinnamyl-alcohol dehydrogenase, a specific enzyme of lignin synthesis Claude GRAND'. ', Farid SARNI'
More informationReducing Soil-Borne Diseases of Potatoes using Shellfish Processing Waste and Compost
Reducing Soil-Borne Diseases of Potatoes using Shellfish Processing Waste and Compost R Henry 1, R.D. Peters 1 *, J.A. MacLeod 1, and A.V. Sturz 2 1 Agriculture and Agri-Food Canada, Crops and Livestock
More informationEvolution and current status of research in phenolic compounds
Available online at www.sciencedirect.com PHYTOCHEMISTRY Phytochemistry 68 (2007) 2722 2735 Review Evolution and current status of research in phenolic compounds Alain-Michel Boudet * UMR CNRS-UPS 5546
More informationFORMATION AND STRUCTURE OF LIGNIFIED PLANT CELL WALL - FACTORS CONTROLLING LIGNIN STRUCTURE DURING ITS FORMATION
69 FORMATION AND STRUCTURE OF LIGNIFIED PLANT CELL WALL - FACTORS CONTROLLING LIGNIN STRUCTURE DURING ITS FORMATION Noritsugu Terashima and Rajai H. Atalla USDA Forest Products Laboratory, One Gifford
More informationCarbon Dioxide induced Changes in Color and Anthocyanin Synthesis of Stored Strawberry Fruit
HORTSCIENCE 34(7):1244 1248. 1999. Carbon Dioxide induced Changes in Color and Anthocyanin Synthesis of Stored Strawberry Fruit Deirdre M. Holcroft 1 and Adel A. Kader 2 Department of Pomology, University
More informationInstitute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao , China
The Plant Journal (216) 88, 26 42 doi: 1.1111/tpj.13229 UDP-glycosyltransferase 72B1 catalyzes the glucose conjugation of monolignols and is essential for the normal cell wall lignification in Arabidopsis
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationA putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus
Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and
More informationLook back over the studies of lignin biochemistry
J Wood Sci (2006) 52:2 8 The Japan Wood Research Society 2006 DOI 10.1007/s10086-005-0790-z REVIEW ARTICLE Takayoshi Higuchi Look back over the studies of lignin biochemistry Received: October 19, 2005
More informationKazusa DNA Res Inst. Daisuke Shibata
Workshop Argentina-Japan Bioscience and Biotechnology for the promotion of Agricutulure and Food Production August 3 rd to 7 th 2009- Metabolite Metabolomics Databases approaches for Plant for Agro-Biotechnology
More informationBiosynthesis and functions of free and combined fatty alcohols associated with suberin
Laboratoire Biosynthesis and functions of free and combined fatty alcohols associated with suberin Collaborating Laboratories: Dr. Owen Rowland Sollapura Vishwanath PhD Candidate Department of Biology
More informationRNAi-mediated suppression of p-coumaroyl-coa 3 -hydroxylase in hybrid poplar impacts lignin deposition and soluble secondary metabolism
RNAi-mediated suppression of p-coumaroyl-coa 3 -hydroxylase in hybrid poplar impacts lignin deposition and soluble secondary metabolism Heather D. Coleman*, Ji-Young Park*, Ramesh Nair, Clint Chapple,
More informationAmbient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays
Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays C. Litterst 1, H. Martinez, B. Iverson and R. Nuňez 1 Bio-Rad Laboratories, Life Science
More informationEvidence for an Alternative Glycolytic Pathway in Rapidly Proliferating Cells. Matthew G. Vander Heiden, et al. Science 2010
Evidence for an Alternative Glycolytic Pathway in Rapidly Proliferating Cells Matthew G. Vander Heiden, et al. Science 2010 Introduction The Warburg Effect Cancer cells metabolize glucose differently Primarily
More informationEnzymes of the Phenylpropanoid Pathway in Soybean Infected with Meloidogyne Incognita or Heterodera Glycines 1
J urn al ftnee~loa~ el~ygoy fin7 (e3~ a2tgo~o~ 0 t3s 1995. 95 " Enzymes of the Phenylpropanoid Pathway in Soybean Infected with Meloidogyne Incognita or Heterodera Glycines 1 R. M. EDENS, 2 S. C. ANAND,
More informationThe N-end rule pathway regulates pathogen responses. in plants
SUPPLEMENTARY INFORMATION The N-end rule pathway regulates pathogen responses in plants Rémi de Marchi 1,2, Maud Sorel 1, Brian Mooney 1, Isabelle Fudal 3, Kevin Goslin 1, Kamila Kwaśniewska 4, Patrick
More informationPlasmonic blood glucose monitor based on enzymatic. etching of gold nanorods
Plasmonic blood glucose monitor based on enzymatic etching of gold nanorods Xin Liu, Shuya Zhang, Penglong Tan, Jiang Zhou, Yan Huang, Zhou Nie* and Shouzhuo Yao State Key Laboratory of Chemo/Biosensing
More informationArthropod Pest Response to Plant Nutrient Concentration
Arthropod Pest Response to Plant Nutrient Concentration Michael J. Costello Wine and Viticulture Department California Polytechnic State University, San Luis Obispo Arthropod herbivores (insects and mites)
More informationEvaluation of the significance of cell wall polymers in flax infected with a pathogenic strain of Fusarium oxysporum
Wojtasik et al. BMC Plant Biology (2016) 16:75 DOI 10.1186/s12870-016-0762-z RESEARCH ARTICLE Evaluation of the significance of cell wall polymers in flax infected with a pathogenic strain of Fusarium
More informationTable S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
More informationA CRISPR/Cas9-mediated gene editing to enhance the expression of the Solanum lycopersicum MYB12 gene and the nutritional value of tomato
A CRISPR/Cas9-mediated gene editing to enhance the expression of the Solanum lycopersicum MYB12 gene and the nutritional value of tomato Dr. Aurelia Scarano Napoli, 22 Dicembre 2017 Phenylalanine Phenolic
More informationSupplemental Data. Deinlein et al. Plant Cell. (2012) /tpc
µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant
More informationInfluenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
More information9/22/2015. Points to cover. As we all know, there are many factors. The pioneer work in the area of fresh-cut
Points to cover Elucidating the Wound Signal Mechanism in Fresh cut Produce: Scientific Implications and Opportunities for Practical Applications and Novel Technologies Luis Cisneros-Zevallos, Ph.D. Dept.
More informationWork-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples:
Dr. Sanjeeva Srivastava IIT Bombay Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Sample preparation for serum proteome analysis Sample
More informationCinnamic Acid Increases Lignin Production and Inhibits Soybean Root Growth
Cinnamic Acid Increases Lignin Production and Inhibits Soybean Root Growth Victor Hugo Salvador, Rogério Barbosa Lima, Wanderley Dantas dos Santos, Anderson Ricardo Soares, Paulo Alfredo Feitoza Böhm,
More information* This work was supported by the Department of Energy Great Lakes Bioenergy Research Center Office of Science Grant DE-FC02-07ER64494.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 11, pp. 8347 8355, March 9, 2012 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Identification of Grass-specific
More informationYara Saddam. Amr Alkhatib. Ihsan
1 Yara Saddam Amr Alkhatib Ihsan NOTE: Yellow highlighting=correction/addition to the previous version of the sheet. Histology (micro anatomy) :- the study of tissues and how they are arranged into organs.
More informationBrowning Reactions. Maillard browning. Caramelization high temps. Enzymatic browning. + flavors. brown pigments. + flavors.
Browning Reactions Maillard browning reducing sugar + amine Caramelization sugar high temps Enzymatic browning phenolics polyphenoloxidase brown pigments + flavors brown pigments + flavors brown pigments
More informationPowdery mildew management for melons: Fungicide mode of action. Melon powdery mildew caused by: Powdery Mildew Management
Powdery mildew management for melons: Fungicide mode of action Mike Matheron Extension Plant Pathologist University of Arizona Yuma Agricultural Center Melon powdery mildew caused by: Podosphaera xanthii
More informationSoybean defense mechanisms against Sclerotinia sclerotiorum. Mehdi Kabbage University of Wisconsin-Madison
Soybean defense mechanisms against Sclerotinia sclerotiorum Mehdi Kabbage University of Wisconsin-Madison Sclerotinia sclerotiorum Programmed Cell Death Soybean resistance mechanisms Pathogen virulence
More informationBiosynthesis of Secondary Metabolites
Biosynthesis of Secondary Metabolites Secondary Metabolism Secondary metabolism, metabolic pathways that are not essential for growth, development or reproduction. Secondary metabolites are those chemical
More informationTitle: The Correlation of Firmness Loss with Flavonoid Gene Expression and Pigment Synthesis in Rabbiteye Blueberries (Vaccinium ashei Reade)
Title: The Correlation of Firmness Loss with Flavonoid Gene Expression and Pigment Synthesis in Rabbiteye Blueberries (Vaccinium ashei Reade) Progress Report Grant Code: SRSFC Project # 2011-16 Name, Mailing
More informationPowdery mildew management for melons: Fungicide mode of action
Powdery mildew management for melons: Fungicide mode of action Mike Matheron Extension Plant Pathologist University of Arizona Yuma Agricultural Center Melon powdery mildew caused by: Podosphaera xanthii
More informationSupplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
More informationSupporting Information
Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement
More informationSignaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana
Biochemistry: Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana 38 CAMERON E. NIENABER ʻ04 Abstract Long recognized as essential plant nutrients and metabolites, inorganic and organic
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationEfficient Biomass Conversion: Delineating the Best Lignin Monomer-Substitutes
Efficient Biomass Conversion: Delineating the Best Lignin Monomer-Substitutes Investigators John Ralph, Professor, Biochemistry; Xuejun Pan, Professor, Biological Systems Engineering; Sara Patterson, Professor,
More informationRole of constitutive and induced defences in the resistance of unripe mangoes to Colletotrichum
Role of constitutive and induced defences in the resistance of unripe mangoes to Colletotrichum gloeosporioides Nimal Adikaram, Ganga Sinniah, Chathurika Karunanayake and Charmalie Abayasekara Department
More informationLab Tuesday: Virus Diseases
Lab Tuesday: Virus Diseases Quiz for Bacterial Pathogens lab (pp 67-73) and Biocontrol of Crown Gall (p. 113-117), Observation of Viral Movement in Plants (p. 119), and Intro section for Viruses (pp. 75-77).
More informationTitle and Microbial Degradation of Lignin.
Title Biochemistry of Wood Compon and Microbial Degradation of Lignin Author(s) HIGUCHI, Takayoshi Citation Wood research : bulletin of the Woo University (2002), 89: 43-51 Issue Date 2002-09-30
More informationPlant Physiol. (1997) 115: 41-50
Plant Physiol. (1997) 115: 41-50 Reduced Lignin Content and Altered Lignin Composition in Transgenic Tobacco Down-Regulated in Expression of L-Phenylalanine Ammonia-Lyase or Cinnamate 4-Hydroxylase Vincent
More information-26- MATERIALS AND METHODS
-26- MATERIALS AND METHODS The pollutant : Sevin (1-naphthyl N-methyl carbamate) was used at a concentrations of 0.5 and 1.0 mg/l. At these concentrations, the insecticide was completely soluble in water.
More informationSupporting Information
Supporting Information Harries et al. 1.173/pnas.9923916 A Fig. S1. Disruption of microfilaments within epidermal cells after treatment with 5 M Lat. Images of N. benthamiana cells are from plants expressing
More informationWood Biosynthesis of Natural Products Derived from Shikimic Acid
1 4. Biosynthesis of Natural Products Derived from Shikimic Acid 4.1. Phenyl-Propanoid Natural Products (C 6 -C 3 ) The biosynthesis of the aromatic amino acids occurs through the shikimic acid pathway,
More informationSuppression of Fusarium patch by Phosphite in cool season turfgrasses
Centre for Research in Biosciences Suppression of Fusarium patch by Phosphite in cool season turfgrasses John Dempsey BSc(Hons) Centre for Research in Biosciences, Bristol, UK Greenkeeper since mid 1980
More informationQUANTITATIVE ESTIMATION OF PHYTOSTEROL FROM TWO MEDICINALLY IMPORTANT PLANTS OF CUCURBITACEAE
Int. J. Engg. Res. & Sci. & Tech. 2014 Renu Sarin and Sangeeta Samria, 2014 Research Paper ISSN 2319-5991 www.ijerst.com Vol. 3, No. 2, May 2014 2014 IJERST. All Rights Reserved QUANTITATIVE ESTIMATION
More informationFigure legends of supplementary figures
Figure legends of supplementary figures Figure 1. Phenotypic analysis of rice early flowering1 () plants and enhanced expression of floral identity genes in.. Leaf emergence of,, and plants with complementary
More informationSupplemental Data. Landgraf et al. (2014). Plant Cell /tpc
C ATGTCAAGGATAGTAGCGGAAAATATGTTACAAGGGGGAGAAAATGTACA ATTTTATGATCAAAGAGTACAACAAGCCATGGAGATGTCACAAGCCAGCG CGTACTCTTCACCCACCCTAGGCCAAATGCTAAAGCGCGTGGGAGACGTG AGAAAAGAAGTCACCGGCGACGAAACTCCGGTGCACCGGATTCTCGATAT
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationand Vegetables for Decay Control
Rlvka Barkal-Golan Volcani Institute, Bet Dagan, Israel Douglas J. Phlllips U.S. Department of Agriculture, ARS, Fresno, CA Postharvest Heat Treatment of Fresh Fruits and Vegetables for Decay Control Postharvest
More informationPostharvest Sample Questions
What process captures all the energy that a plant (and ultimately animals) will use to survive? What organic compounds primarily store the energy in plants? What is respiration? Why is compartmentation
More informationTheory Photochem. Anna Horszwald (Michalska)
Theory Photochem Anna Horszwald (Michalska) Free radicals Free radicals inflamation mitochondrial disfuntion Lachance P. A. et al. (2001) Antioxidants an intergarative approach, Nutrition, 17,835-838.
More informationS. Shivashankar 1, M. Sumathi 1,N.K.Krishnakumar 2 &V.K.Rao 1 RESEARCH ARTICLE. Abstract
Annals of Applied Biology ISSN 0003-4746 RESEARCH ARTICLE Role of phenolic acids and enzymes of phenylpropanoid pathway in resistance of chayote fruit (Sechium edule) against infestation by melon fly,
More informationIon fragmentation of small molecules in mass spectrometry
Ion fragmentation of small molecules in mass spectrometry Jeevan Prasain jprasain@uab.edu 6-2612 Nomenclature: the main names and acronyms used in mass spectrometry Molecular ion: Ion formed by addition
More informationThe Institute of Paper Chemistry
The Institute of Paper Chemistry Appleton, Wisconsin Doctor's Dissertation The Methanol-Extractable Aromatic Materials in the Inner Bark of P. Tremuloides Horace Brown Faber, Jr. June, 1959 THE METHANOL-EXTRACTABLE
More informationRole of PAL and PPO Enzyme Activity in Host Pathogen interaction of Chickpea (Cicer Arietinum L) Root Tissue Infected with Fusarium Wilt
Role of PAL and PPO Enzyme Activity in Host Pathogen interaction of Chickpea (Cicer Arietinum L) Root Tissue Infected with Fusarium Wilt Rathod P. J, D. N Vakhariya Department of Biochemistry, College
More informationHIV-1 Viral Load Real Time (RG)
-1 Viral Load Real Time (RG) Real Time RT-PCR type 1 RNA quantification assay MSP Reg. pending Valdense 3616. 11700. Montevideo. Uruguay. phone (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy
More information