SwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4
|
|
- Joshua Joseph
- 6 years ago
- Views:
Transcription
1 P02774 Vitamin D-binding protein precursor Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor Cell communication c, a P02760 AMBP protein precursor [Contains: Alpha-1-microglo Cell communication c, a,b S P02751 Fibronectin precursor Cell communication d S P00450 Ceruloplasmin precursor Cell communication c S,C P02763 Alpha-1-acid glycoprotein 1 precursor Cell communication a S,C P02452 Collagen alpha 1 (I) chain precursor Cell communication d S P02790 Hemopexin precursor Defense response c S,C P04217 Alpha-1B-glycoprotein precursor Defense response c, a S,C P01042 Kininogen precursor Enzyme activity c S,C P02749 Beta-2-glycoprotein I precursor Cell communication S,C P61769 Beta-2-microglobulin precursor Signal transduction c, a P02753 Plasma retinol-binding protein precursor Cell communication S P09486 SPARC precursor Development d S P19652 Alpha-1-acid glycoprotein 2 precursor Cell communication S P00747 Plasminogen precursor Enzyme activity S,C P02771 Alpha-fetoprotein precursor Cell communication b S P01236 Prolactin precursor Signal transduction P02461 Collagen alpha 1 (III) chain precursor Cell communication P02647 Apolipoprotein A-I precursor Cell communication d S,C P80370 Delta-like protein precursor Development P25311 Zinc-alpha-2-glycoprotein precursor Cell proliferation P20908 Collagen alpha 1 (V) chain precursor Cell communication P02765 Alpha-2-HS-glycoprotein precursor Metabolism a,d S,C P13727 Eosinophil granule major basic protein precursor Defense response P04196 Histidine-rich glycoprotein precursor Enzyme activity c S Q16610 Extracellular matrix protein 1 precursor Signal transduction S,C P01033 Metalloproteinase inhibitor 1 precursor Metabolism S P43652 Afamin precursor Cell communication S P08603 Complement factor H precursor Defense response c S,C P12111 Collagen alpha 3 (VI) chain precursor Cell communication c P41222 Prostaglandin-H2 D-isomerase precursor Cell communication S P23142 Fibulin-1 precursor Cell communication c S P17936 Insulin-like growth factor binding protein 3 precursor Development
2 P01034 Cystatin C precursor Enzyme activity P18065 Insulin-like growth factor binding protein 2 precursor Cell communication S Q16270 Insulin-like growth factor binding protein 7 precursor Cell communication d Q12841 Follistatin-related protein 1 precursor Cell proliferation c P01008 Antithrombin-III precursor Enzyme Activity c S,C P98160 Basement membrane-specific heparan sulfate proteo Cell communication c P10451 Osteopontin precursor Cell communication c P09466 Glycodelin precursor Development P12109 Collagen alpha 1 (VI) chain precursor Cell communication d P51884 Lumican precursor Cell communication c S Q14766 Latent transforming growth factor beta binding protein Enzyme activity P22692 Insulin-like growth factor binding protein 4 precursor Metabolism P62328 Thymosin beta Metabolism C Q12805 EGF-containing fibulin-like extracellular matrix protein Defense response S P10909 Clusterin precursor Signal transduction c S P04004 Vitronectin precursor Cell communication c S,C Q15582 Transforming growth factor-beta induced protein IG-H Cell proliferation d S P61626 Lysozyme C precursor Enzyme activity C P00751 Complement factor B precursor Metabolism c, a S P13987 CD59 glycoprotein precursor Defense response c C P35555 Fibrillin-1 precursor Development P08294 Extracellular superoxide dismutase [Cu-Zn] precurso Metabolism Q9HC84 Mucin-5B precursor Cell communication C P07998 Ribonuclease pancreatic precursor Enzyme activity P02788 Lactotransferrin precursor Defense response a S,C Q9UBC9 Small proline-rich protein FNA C P01344 Insulin-like growth factor II precursor Signal transduction Q14118 Dystroglycan precursor Signal transduction P00748 Coagulation factor XII precursor Enzyme activity S P07602 Proactivator polypeptide precursor [Contains: Saposi Metabolism P01019 Angiotensinogen precursor Metabolism c S P01833 Polymeric-immunoglobulin receptor precursor Cell communication c C P02766 Transthyretin precursor Cell communication c, a S P02768 Serum albumin precursor Cell communication b,d S,C
3 P05156 Complement factor I precursor Defense response S Q15113 Procollagen C-proteinase enhancer protein precurso Development S P11464 Pregnancy-specific beta-1-glycoprotein 1 precursor FNA c P29279 Connective tissue growth factor precursor Metabolism Q9UGM5 Fetuin-B precursor Metabolism P02671 Fibrinogen alpha/alpha-e chain precursor Cell proliferation S,C P00746 Complement factor D precursor Defense response S P02748 Complement component C9 precursor Defense response c S P07476 Involucrin Development C P05090 Apolipoprotein D precursor Metabolism c S P01243 Chorionic somatomammotropin hormone precursor Signal transduction a P08123 Collagen alpha 2(I) chain precursor Cell communication d P05362 Intercellular adhesion molecule-1 precursor Cell communication P24593 Insulin-like growth factor binding protein 5 precursor Cell communication P02679 Fibrinogen gamma chain precursor Cell proliferation c S,C Q07654 Trefoil factor 3 precursor Defense response P35321 Cornifin A Development C O95633 Follistatin-related protein 3 precursor FNA P31949 Calgizzarin Metabolism P61916 Epididymal secretory protein E1 precursor Metabolism O43278 Kunitz-type protease inhibitor 1 precursor Enzyme activity P04278 Sex hormone-binding globulin precursor Cell communication S P16070 CD44 antigen precursor Cell communication Q13421 Mesothelin precursor Cell communication c P01028 Complement C4 precursor Defense response c S,C P08174 Complement decay-accelerating factor precursor Defense response P31025 Von Ebner's gland protein precursor Defense response c, a Q10588 ADP-ribosyl cyclase 2 precursor Defense response S P03973 Antileukoproteinase 1 precursor Enzyme activity C P04080 Cystatin B Enzyme activity a C P02652 Apolipoprotein A-II precursor Metabolism S P10599 Thioredoxin Metabolism C Q96IY4 Carboxypeptidase B2 precursor Metabolism S P11684 Uteroglobin precursor Signal transduction
4 P55290 Cadherin-13 precursor Cell organization P22105 Tenascin-X precursor Cell communication S P80188 Neutrophil gelatinase-associated lipocalin precursor Cell communication S,C P01024 Complement C3 precursor Defense response c S,C P01860 Ig gamma-3 chain C region Defense response S P48745 NOV protein homolog precursor Development P03952 Plasma kallikrein precursor Enzyme activity S P17900 Ganglioside GM2 activator precursor Enzyme activity P04156 Major prion protein precursor Metabolism P07988 Pulmonary surfactant-associated protein B precursor Metabolism c P01215 Glycoprotein hormones alpha chain precursor Signal transduction Q14767 Latent transforming growth factor-beta-binding protei Signal transduction P00734 Prothrombin precursor Enzyme activity c S P02787 Serotransferrin precursor Defense response a,c,d S,C P09228 Cystatin SA precursor Enzyme activity Q03591 Complement factor H-related protein 1 precursor Cell communication S P12830 Epithelial-cadherin Cell communication P14543 Nidogen Cell communication P16949 Stathmin Cell communication P49747 Cartilage oligomeric matrix protein Cell communication S P protein epsilon Cell communication d P protein zeta/delta Cell communication d C P68871 Hemoglobin subunit beta Cell communication a S Q13908 Alpha-2 type V collagen Cell communication Q14036 Alpha-2 type I collagen Cell communication Q14112 Nidogen Cell communication Q5XKQ4 Alpha-2-glycoprotein 1, zinc Cell communication S Q6GRB6 Fetuin-B Cell communication S Q6GTW4 Cadherin 13, preproprotein Cell communication Insulin-like growth factor binding protein, acid labile Q8TAY0 subunit Cell communication S Q92496 Complement factor H-related protein Cell communication P35609 Alpha-actinin Cell organization P53485 Actin, cytoplasmic Cell organization
5 P68133 Actin, alpha skeletal muscle Cell organization S P02675 Fibrinogen beta chain Cell proliferation d, a S,C P60709 Actin, cytoplasmic Cell proliferation S,C P protein gamma Cell proliferation d P01011 Alpha-1-antichymotrypsin Defense response S,C P01595 Ig kappa chain V-I region Bi Defense response P01598 Ig kappa chain V-I region EU Defense response S P01603 Ig kappa chain V-I region Ka Defense response P01605 Ig kappa chain V-I region Lay Defense response P01621 Ig kappa chain V-III region NG Defense response S P01622 Ig kappa chain V-III region Ti Defense response S P01624 Ig kappa chain V-III region POM Defense response S P01625 Ig kappa chain V-IV region Len Defense response S P01766 Ig heavy chain V-III region BRO Defense response P01767 Ig heavy chain V-III region BUT Defense response P01857 Ig gamma-1 chain C region Defense response S,C P01859 Ig gamma-2 chain C region Defense response S,C P01861 Ig gamma-4 chain C region Defense response S,C P01876 Ig alpha-1 chain C region Defense response S,C P01877 Ig alpha-2 chain C region Defense response S,C P04083 Annexin A Defense response d S,C P04206 Ig kappa chain V-III region GOL Defense response S P04434 Ig kappa chain V-III region VH Defense response S P05109 Protein S100-A Defense response S,C P05155 Plasma protease C1 inhibitor Defense response c S P05164 Myeloperoxidase* Defense response C P06681 Complement C Defense response S P06702 Protein S100-A Defense response S,C P08571 Monocyte differentiation antigen CD Defense response S P08697 Alpha-2-antiplasmin Defense response c S P10643 Complement component C Defense response S P15814 Immunoglobulin lambda-like polypeptide Defense response P18135 Ig kappa chain V-III region HAH Defense response S P20160 Azurocidin* Defense response
6 P40121 Macrophage capping protein Defense response d P49913 Antibacterial protein FALL-39* Defense response Long palate, lung and nasal epithelium carcinomaassociated protein 1* Defense response C Q8TDL5 Q9UGM3 Glycoprotein 340* Defense response P05452 Tetranectin Development S P06741 Myosin light chain 3, skeletal muscle isoform Development P07355 Annexin A Development d S,C P07996 Thrombospondin Development S P36955 Pigment epithelium-derived factor Development c S Q9UBI9 Headcase protein homolog Development P30740 Leukocyte elastase inhibitor* Enzyme activity C P05543 Thyroxine-binding globulin Enzyme activity c S P05546 Heparin cofactor Enzyme activity S P08185 Corticosteroid-binding globulin Enzyme activity c S P09525 Annexin A Enzyme activity d Q02325 Plasminogen-related protein B Enzyme activity S P02750 Leucine-rich alpha-2-glycoprotein FNA S P13796 Plastin-2* FNA S,C Q2XP30 Mutant beta-globin FNA Q5SYV9 Lipocalin FNA Q6EMK4 Vasorin FNA Q92520 Protein FAM3C FNA Q9UJ14 Gamma-glutamyltransferase FNA Q9Y5Z4 Heme-binding protein FNA O00187 Mannan-binding lectin serine protease Metabolism S P00918 Carbonic anhydrase Metabolism P01023 Alpha-2-macroglobulin Metabolism S P06727 Apolipoprotein A-IV Metabolism c,d S P08709 Coagulation factor VII Metabolism P15144 Aminopeptidase N Metabolism S P18669 Phosphoglycerate mutase Metabolism d C P19440 Gamma-glutamyltranspeptidase Metabolism P22352 Glutathione peroxidase Metabolism
7 P36222 Chitinase-3-like protein Metabolism P43251 Biotinidase Metabolism S P55058 Phospholipid transfer protein Metabolism S P60174 Triosephosphate isomerase Metabolism d C P S ribosomal protein S27a Metabolism P S ribosomal protein L Metabolism P62988 Ubiquitin Metabolism C Q16819 Meprin A subunit alpha Metabolism S Q53XZ5 Tyrosine 3-monooxygenase/tryptophan 5- monooxygenase Metabolism Q5T986 Inter-alpha (Globulin) inhibitor, H2 polypeptide Metabolism CDNA FLJ32377 fis, clone SKMUS , highly similar to Polyubiquitin Metabolism Q96MH4 Q96PQ8 Factor VII active site mutant immunoconjugate Metabolism Q14406 Chorionic somatomammotropin hormone-like Signal transduction Q53YY1 Angiotensinogen Signal transduction S Q7Z7P3 Coagulation factor II, Signal transduction Q86VW7 Colony stimulating factor 1 receptor, Signal transduction Q8WZA4 Collectin placenta Signal transduction Proteins that were identified in experiment are listed with their SwissProt or TrEMBL accession 1. Molecular weight (kda) 2 and pi 3 calculated using CalPI/ tool available on SwissProt website. 4 Functional annotation is performed using procedure outlined in methods section. FNA-Function not assigned. 5 AF proteins that were also found in other amniotic fluid (a I,b II,c III ) and amnion cell (d IV ) studies are marked accordingly. 6 AF proteins that are also present in Serum (S) and Cervico-vagianl Fluid (C) are also marked (see results section for details). * Proteins identified in amniotic fluid with infection. I - Park, SJ et. al. Proteomics, 2006, 6, (1), ; II - Nilsson S et. al. J. Proteome Research, 2004, 3, (4), ; III - Michel, P. E. et. al. Electrophoresis, 2006, 7, 7.; IV- Tsangaris, G. et. al. Electrophoresis, 2005, 26, (6), ; Proteins are also color coded for their role in fetal biology (see results for details): Red-Complement and Coagulation cascades, Grey-Metabolism, Green - Defense response, Yellow-Signal transduction, Orange-Development, and Cyan- Transport
TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive
TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)
More informationTable S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts
Table S1. page 1/4 Phase 1 Exploratory Study, List of proteins identified by LC-ESI-MS/MS after 1DE separation and their relative quantitation by spectral count UniProt Entry SwissProt- CRC case Pool Control
More informationSUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
More informationSupporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation
Supporting Information Synthesis of Zwitterionic Polymer Particles via Combined Distillation Precipitation Polymerization and Click Chemistry for Highly Efficient Enrichment of Glycopeptide Jianxi Liu,
More informationSupporting Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Supporting Information Covalent functionalization of graphene oxide with
More informationGMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS
GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood,
More informationCh. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma
Chapt. 45 Ch. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma Inheritance of X-linked gene for Factor VIII hemophilia A Explain the
More informationSupporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma
Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural
More informationMultiple High-Abundant Protein Removal for Proteomics. Dr. Cory Szafranski, Product Manager
Multiple High-Abundant Protein Removal for Proteomics Dr. Cory Szafranski, Product Manager Agilent Multiple Affinity Removal System - What is it? H L High-Abundant Proteins (Albumin, IgG, IgA, Transferrin,
More informationESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES
ESTUDIO GMI. ESTUDIO PROTEÓMICO-COMPARACIÓN IMPLANTES DENTALES 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood, resulting in protein
More informationChapter 19 Cardiovascular System Blood: Functions. Plasma
Chapter 19 Cardiovascular System Blood: Functions 19-1 Plasma Liquid part of blood. Colloid: liquid containing suspended substances that don t settle out of solution 91% water. Remainder proteins, ions,
More informationChapter 19: Cardiovascular System: Blood
Chapter 19: Cardiovascular System: Blood I. Functions of Blood A. List and describe the seven major homeostatic functions of blood: 1. 2. 3. 4. 5. 6. 7. II. Plasma A. Composition 1. It is a fluid consisting
More informationFig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationSupplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases
Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin
More informationPart IV Antithrombotics, Anticoagulants and Fibrinolytics
Part IV Antithrombotics, Anticoagulants and Fibrinolytics "The meaning of good and bad, of better and worse, is simply helping or hurting" Emerson Chapter 16: Blood Coagulation and Fibrinolytic System
More informationBlood. Plasma. The liquid part of blood is called plasma. 1. Pale yellow fluid; forms more than half the blood volume.
11 Blood FOCUS: Blood consists of plasma and formed elements. The plasma is 91% water with dissolved or suspended molecules, including albumin, globulins, and fibrinogen. The formed elements include erythrocytes,
More informationProteomic studies in Collagen Induced Arthritis (CIA) rats
V{tÑàxÜ@H Proteomic studies in Collagen Induced Arthritis (CIA) rats 5.1. Introduction Over the last few decades, both naturally occurring and genetically engineered animal models of human diseases have
More informationChapter 11. Lecture and Animation Outline
Chapter 11 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have
More informationChapter 19. Openstax: Chapter 18. Blood
Chapter 19 Blood Openstax: Chapter 18 Chapter 19 Learning Outcomes After completing Chapter 19, you will be able to: 1. Describe the components and major functions of blood and list the physical characteristics
More informationC-reactive protein. An ED perspective Greg Stevens May 2010
C-reactive protein An ED perspective Greg Stevens May 2010 Basic Biology Is a short Pentraxin Penta 5, ragos berries 224 residue protein 25106 Da Gene 1q21-q23 q23 History Tillett WS, Francis T Jr. Serological
More informationChapter 19 Blood Lecture Outline
Chapter 19 Blood Lecture Outline Cardiovascular system Circulatory system Blood 1. distribution 2. regulation 3. protection Characteristics: ph 7.4 38 C 4-6 L Composition: Plasma Formed elements Erythrocytes
More informationBranch of medicine that deals with blood, its formation and disorders is called. Three main functions of cardiovascular system are,, and.
Chapter 19 The Blood Human body must maintain a balance called. Body fluid inside the cells is called fluid; that outside is called or fluid. Two major fluid networks that help in connecting cells are
More informationThe Cardiovascular System: Blood
C h a p t e r 11 The Cardiovascular System: Blood PowerPoint Lecture Slides prepared by Jason LaPres Lone Star College - North Harris Introduction to the Cardiovascular System A circulating transport system
More informationFirePlex Multiplex Immunoassay product list
FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes
More informationConnective tissue CONNECTIVE TISSUE Part I
Connective tissue CONNECTIVE TISSUE Part I Part 1 Connective Tissue Found everywhere in the body (app. 50% of body weight) Includes the most abundant and widely distributed tissues General features of
More informationHemostasis. Learning objectives Dr. Mária Dux. Components: blood vessel wall thrombocytes (platelets) plasma proteins
Hemostasis Learning objectives 14-16 Dr. Mária Dux Components: blood vessel wall thrombocytes (platelets) plasma proteins Hemostatic balance! procoagulating activity anticoagulating activity 1 Thrombocytes
More informationBlood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit
Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit General Characteristics: Extracellular matrix ph Volume Functions of the blood: 1. Transport 2. Regulation 3. Protection
More informationConnective Tissue (CT)
Connective Tissue (CT) YONG-MEI CHEN ( 陈咏梅 ) Dept. of Anatomy, Histology & Embryology Peking Union Medical College Tel:69156461 E-mail address: pumc_he@126.com Content Introduction of CT 1. Origin 2. Compositions
More informationAVAILABLE BIOMARKER ASSAYS
AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated
More informationImmune suppression in Atlantic salmon: smoltification, sea water transfer and breeding
Immune suppression in Atlantic salmon: smoltification, sea water transfer and breeding Aleksei Krasnov, Nofima FHFs fiskehelsesamling 1.-2. september 2015 Smoltifiction and breeding suppress immunity in
More informationBIOL 2458 CHAPTER 19 Part 1 SI 1. List the types of extracellular fluids. 2. Intracellular fluid makes up of the body fluids. Where is it found?
BIOL 2458 CHAPTER 19 Part 1 SI 1 1. Extracellular fluid makes up of the body fluids. List the types of extracellular fluids. 2. Intracellular fluid makes up of the body fluids. Where is it found? 3. In
More informationAgenda. Components of blood. Blood is Fluid Connective Tissue. Blood: General functions
Agenda Chapter 19: Blood Major functions Major Components Structure of RBCs and WBCs ABO Blood Types, and Rh Factor Lab 34.1 and Blood Typing Blood: General functions Transport of dissolved gases, nutrients,
More informationTissue repair. (3&4 of 4)
Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid
More informationCH 11 Blood OUTLINE: Functions of Blood Composition of Blood Blood Cell Disorders Blood Types Blood Clotting Functions of Blood Transportation
1 CH 11 Blood OUTLINE: Functions of Blood Composition of Blood Blood Cell Disorders Blood Types Functions of Blood Transportation Protection Regulation ph Temperature Composition of Blood Plasma: liquid
More informationCO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationG. Types of White Blood Cells
1. White blood cells are also called leukocytes. G. Types of White Blood Cells 2. White blood cells function to protect against diseases. 3. Two hormones that stimulate white blood cell production are
More informationFunctional proteomic analysis of seminal plasma proteins in men with various semen parameters
Sharma et al. Reproductive Biology and Endocrinology 2013, 11:38 RESEARCH Open Access Functional proteomic analysis of seminal plasma proteins in men with various semen parameters Rakesh Sharma 1, Ashok
More informationBIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended.
BIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended. 1. Match the following glands of the endocrine system with the appropriate label 1.
More informationWBCs production(leucopoiesis):
WBCs production(leucopoiesis): Note: this sheet contain only extra notes.j - leucopoiesis is the most complicated process in body because many reasons which are : 1- the production of many cells(monocyte,
More informationBiological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
More informationTHE BIOLOGY OF PLATELET-GEL THERAPY
THE BIOLOGY OF PLATELET-GEL THERAPY The synopsis of normal healing includes a well known sequence of coordinated phases. The unique process leading to healing is ontologically partitioned in three sequential
More informationground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were
Supplementary Figure 1. Characterization of EVs from intestine. (a, b) Intestinal tissues were ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were isolated by
More informationPPI. The Clinical Potential of the Human Plasma Proteome. The Plasma Proteome Institute
The Clinical Potential of the Human Plasma Proteome Leigh Anderson Ph.D. Founder & CEO, Plasma Proteome Institute Board Member, Dade Behring The Plasma Proteome Institute Plasma is the largest, and deepest,
More informationFour melanocyte-stimulating hormones have the following amino acid sequences:
Assignment 14: Melanocyte-stimulating hormone belongs to a group called the melanocortins. This group includes ACTH, alpha-msh, beta-msh and gamma-msh; these peptides are all cleavage products of a large
More informationBlood. Biol 105 Lecture 14 Chapter 11
Blood Biol 105 Lecture 14 Chapter 11 Outline I. Overview of blood II. Functions of blood III. Composition of blood IV. Composition of plasma V. Composition of formed elements VI. Platelets VII. White blood
More informationLECTURE: 21. Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES:
LECTURE: 21 Title IMMUNOGLOBULINS FUNCTIONS & THEIR RECEPTORS LEARNING OBJECTIVES: The student should be able to: Determine predominant immunoglobulin isotypes in serum. Determine the predominant immunoglobulin
More informationBLOOD. Dr. Vedat Evren
BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body
More informationSupplementary Data. References
Supplementary Data Materials and Methods Sample collection from acute kidney injury patients Urine samples were obtained from patients who had cardiac surgery at one academic medical center and two local
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationPRP Basic Science. Platelets. Definition of PRP 10/4/2011. Questions that this talk aims to answer
PRP Basic Science Peter J. Moley, MD Hospital for Special Surgery October 5, 2011 Questions that this talk aims to answer 1. What is PRP? 2. What blood components are NOT in PRP? 3. What are the active
More informationI) Choose the best answer: 1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine.
1- All of the following amino acids are neutral except: a) glycine. b) threonine. c) lysine. d) proline. e) leucine. 2- The egg white protein, ovalbumin, is denatured in a hard-boiled egg. Which of the
More information4/5/17. Blood. Blood. Outline. Blood: An Overview. Functions of Blood
Outline Blood Biol 105 Chapter 11 I. Overview of blood II. Functions of blood III. Composition of blood IV. Composition of plasma V. Composition of formed elements VI. Platelets VII. White blood cells
More informationOvarian Cancer-Biomarkers
Ovarian Cancer-Biomarkers Bobby Graham Deputy Director of the Stoller Biomarker Discovery Centre Discovery Validation Stoller Biomarker Discovery Centre Arginine R Glutamic acid E Leucine L Serine S Threonine
More informationBlood. BIOLOGY OF HUMANS Concepts, Applications, and Issues. Judith Goodenough Betty McGuire
BIOLOGY OF HUMANS Concepts, Applications, and Issues Fifth Edition Judith Goodenough Betty McGuire 11 Blood Lecture Presentation Anne Gasc Hawaii Pacific University and University of Hawaii Honolulu Community
More informationBlood. Blood Composition Plasma Red blood cells -RBCs White Blood Cells- WBCs (leucocytes) Blood Platelets PLT (thrombocytes)
Blood Blood Composition Plasma Red blood cells -RBCs White Blood Cells- WBCs (leucocytes) Blood Platelets PLT (thrombocytes) Functions of the blood 1. Respiration - transport of oxygen from the lungs to
More informationTNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More informationWhat are the functions of blood?
What are the functions of blood? Transportation: oxygen, nutrients, wastes, carbon dioxide, nitrogen from amino acids and hormones, lipoproteins HDL and LDL Hemoglobin carries oxygen and CO2, (CO poisoning)
More information25 years of research excelence
Crystal Chem full product catalog 25 years of research excelence We're poud to be one of the top providers of research assays for the last 25 years product catalog See our full line of high quality assays
More informationBlood. The only fluid tissue in the human body Classified as a connective tissue. Living cells = formed elements Non-living matrix = plasma
Blood Blood The only fluid tissue in the human body Classified as a connective tissue Living cells = formed elements Non-living matrix = plasma Blood Physical Characteristics of Blood Color range Oxygen-rich
More informationFunctions of Blood. Transport. Transport. Defense. Regulation. Unit 6 Cardiovascular System: Blood
Unit 6 Cardiovascular System: Blood Functions of Blood With each beat of the heart, approximately 75 ml of blood is pumped On average, the heart beats 70 times per minute Every minute, the heart pumps
More informationChapter 13. Plasma Proteins and Enzymes. Lecturer: Dr Abeer Shnoudeh. Clinical Chemistry William Marshall
Chapter 13 Plasma Proteins and Enzymes Lecturer: Dr Abeer Shnoudeh Clinical Chemistry William Marshall Introduction Measurement of Plasma Proteins Total Plasma Protein concentration of total protein in
More informationAAV Apolipoprotein D APOD Lipid transport AAA Complement C3 C3 Inflammatory response/complement
Supplementry Tble 1. Smple 1 A25T + CSF. AAA52992.1 Immunoglobulin mu chin Inflmmtory response/complement 2 126 1.13 AAV38664.1 Apolipoprotein D APOD Lipid trnsport 2 150 0.82 AAA85332.1 Complement C3
More informationAntibody-Cytokine- Autoimmune
Antibody-Cytokine- Autoimmune Surasak Wongratanacheewin, Ph.D Dean, Graduate School, KKU Microbiology, Faculty of Medicine, KKU sura_wng@kku.ac.th การอบรมหล กส ตรประกาศน ยบ ตรการข นทะเบ ยนช วว ตถ ว นท
More informationAn#body structure & func#on
An#body structure & func#on Objec&ves You should be able to: ü Define an&body ü Describe an&body structure ü Compare between different types or classes of an&body and their func&on An#bodies = Immunoglobulin
More informationBlood. Water compartments
Blood Water compartments 2/8 about 60% of our body is water (young-old, male-female) water is located in compartments, movement is regulated intracellular : extracellular 2:1, i.e. 40:20% interstitial
More informationBlood coagulation and fibrinolysis. Blood clotting (HAP unit 5 th )
Blood coagulation and fibrinolysis Blood clotting (HAP unit 5 th ) Vessel injury Antithrombogenic (Favors fluid blood) Thrombogenic (Favors clotting) 3 Major systems involved Vessel wall Endothelium ECM
More informationBlood Cells Med Terms Quiz
Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:
More informationSupplementary Table 1: Motor-clutch gene mrna expression Myosin Motors
Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors Symbol Description Expression Rank MYL6 myosin, light chain 6, alkali, smooth muscle and non-muscle 11903 79 MYH9 myosin, heavy chain
More informationChapter 19: The Cardiovascular System: The Blood. Copyright 2009, John Wiley & Sons, Inc.
Chapter 19: The Cardiovascular System: The Blood Blood Liquid connective tissue 3 general functions 1. Transportation Gases, nutrients, hormones, waste products 2. Regulation ph, body temperature, osmotic
More informationBlood clotting. Subsequent covalent cross-linking of fibrin by a transglutaminase (factor XIII) further stabilizes the thrombus.
Blood clotting It is the conversion, catalyzed by thrombin, of the soluble plasma protein fibrinogen (factor I) into polymeric fibrin, which is deposited as a fibrous network in the primary thrombus. Thrombin
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationPublished on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.
More informationPrimary Exam Physiology lecture 5. Haemostasis
Primary Exam Physiology lecture 5 Haemostasis Haemostasis Body s response for the prevention and cessation of bleeding. Broadly consists of: Primary Haemostasis - vascular spasm and platlet plug formation
More informationChapter 1. General introduction
Chapter 1 General introduction 8 Haemostasis All organs and tissues of higher organisms are provided with nutrients and oxygen through the bloodstream. The bloodstream is an extensive vascular system that
More informationAssessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018
Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect
More informationInnate vs Adaptive Response
General Immunology Innate vs Adaptive Response Innate- non-specific (4 types of barriers) anatomic- ato mechanical ca (skin), ph, mucous, normal flora Physiologic- temperature, ph, chemicals (lysozyme,
More informationThis slide belongs to iron lecture and it is to clarify the iron cycle in the body and the effect of hypoxia on erythropoitein secretion
This slide belongs to iron lecture and it is to clarify the iron cycle in the body and the effect of hypoxia on erythropoitein secretion Topics of today lectures: Hemostasis Meaning of hemostasis Mechanisms
More informationMimi Roy, PhD Senior Director & Site Head Caprion Proteomics US LLC. ISBER, Orlando May 23, 2014
Controlled Analysis of Preanalytical Variables in CSF and Blood Sample Collection, Processing and Storage: Implications for Best Practices in Clinical Research Mimi Roy, PhD Senior Director & Site Head
More informationA. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters
A. Blood is considered connective tissue. RBC A. Blood volume and composition 1. Volume varies - average adult has 5 liters 2. 45% cells by volume called hematocrit (HCT) a. red blood cells (RBC) mostly
More informationChapter 19(1) An Introduction to the Circulatory System and Blood
Chapter 19(1) An Introduction to the Circulatory System and Blood Circulatory System VS Cardiovascular System circulatory system = heart, blood vessels and blood cardiovascular system = heart and blood
More informationGeneral Features. Originates mostly from mesoderm. Composed of cells, fibres and extracellular matrix. Highly vascular. Variable regenerative power.
Connective Tissue General Features Originates mostly from mesoderm. Composed of cells, fibres and extracellular matrix. Highly vascular. Variable regenerative power. Functions of Connective Tissue Support:
More informationBiology 218 Human Anatomy. Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood
Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood Introduction The cardiovascular system functions as a system to transport numerous substances throughout the body
More information10. Which of the following immune cell is unable to phagocytose (a) neutrophils (b) eosinophils (c) macrophages (d) T-cells (e) monocytes
Chapter 2. Acute and chronic inflammation(6): 1. In acute inflammation, which events occur in the correct chronological order? (Remembered from 2000, 2004 exam.) p50 (a) transient vasoconstriction, stasis
More informationHealing & Repair. Tissue Regeneration
Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)
More informationHemostasis and. Blood Coagulation
Hemostasis and Blood Coagulation Events in Hemostasis The term hemostasis means prevention of blood loss. Whenever a vessel is severed or ruptured, hemostasis is achieved by several mechanisms: (1) vascular
More informationPHASES OF HAEMOSTASIS
HAEMOSTASIS Maintains the integrity of a closed, highpressure circulatory system after vascular damage Vessel Wall Injury events in the vessel wall and in the blood which seal breach Delicate balance exists
More informationConnective Tissue Part-2. Dr. Heba Kalbouneh Assistant Professor of Anatomy and Histology
Connective Tissue Part-2 Dr. Heba Kalbouneh Assistant Professor of Anatomy and Histology 1 Features Composed of cells, fibers and extracellular matrix. Highly vascular Variable regenerative power Originates
More informationINFLAMMATION & REPAIR
INFLAMMATION & REPAIR Lecture 7 Chemical Mediators of Inflammation Winter 2013 Chelsea Martin Special thanks to Drs. Hanna and Forzan Course Outline i. Inflammation: Introduction and generalities (lecture
More informationSeparation of Main Proteins in Plasma and Serum
BCH 471 Experiment (2) Separation of Main Proteins in Plasma and Serum PLASMA PROTEINS Mw The main plasma proteins are: þ Albumin (36-50 g/l), Mw 66.241kDa. þ Globulins (18-32 g/l), Mw of globulins Cover
More informationAnalyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
More informationSupporting information. for. Facile synthesis of enzyme-inorganic hybrid nanoflowers and
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information for Facile synthesis of enzyme-inorganic hybrid nanoflowers and their
More informationLike other Biological Macromolecules such as polysaccharides and nucleic acids, Proteins are essential parts of all living organisms and participate
Like other Biological Macromolecules such as polysaccharides and nucleic acids, Proteins are essential parts of all living organisms and participate in every process within cells. The RDA of protein intake
More informationThe source of protein structures is the Protein Data Bank. The unit of classification of structure in SCOP is the protein domain.
UNIT 14 PROTEINS DEFINITION A large molecule composed of one or more chains of amino acids in a specific order; the order is determined by the base sequence of nucleotides in the gene that codes for the
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationCardiovascular System Blood
Cardiovascular System Blood William T. Budd Virginia Commonwealth University Center for the Study of Biological Complexity Medical Careers College Objectives What is blood? Review metabolism Functions
More informationDevelopment of B and T lymphocytes
Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell
More informationCURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products.
CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products Table of Contents Major Current And Emerging Cancer Diagnostic Tests 1. Introduction
More informationJournal Name RSC ARTICLE
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2014 Journal Name RSC Significance of surface charge and shell material of Superparamagnetic
More information