a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)

Size: px
Start display at page:

Download "a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)"

Transcription

1 Week 4 - PROBLEM SET ( 200 points ) INSTRUCTIONS: Report all numerical answers to 1 decimal place. Do not round values used for calculations. Must show calculations and units for full credit. (1) A standard curve for hemoglobin (HgB) yielded the equation y = 0.049x (with an r 2 value of.998 over the range of 0-50 g/dl HgB. Using the equation from this standard curve line equation, a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) Patient Absorbance HgB calculation HgB conc. Hct (540 nm) (g/dl) (%) 1 (Female) (Female) (Male) (Male) (Pregnant) b) Is patient #1 anemic ( yes / no ) based on: low Hct / low HgB / both normal Is patient #2 anemic ( yes / no ) Is patient #3 anemic ( yes / no ) Is patient #4 anemic ( yes / no ) Is patient #5 anemic ( yes / no ) based on: low Hct / low HgB / both normal based on: low Hct / low HgB / both normal based on: low Hct / low HgB / both normal based on: low Hct / low HgB / both normal (2) Which of the statements is/are true concerning determination of Hct and HgB? (2 pts) a) the colorimetric assay for HgB uses alkaline potassium ferricyanide to oxidize hemoglobin to methemoglobin b) Hct is determined by dividing the total blood volume (or height) in the hematocrit tube by the packed red blood cell volume (height) c) A blood sample with a large proportion of lysed (broken) cells will still give an accurate Hct d) a and b only e) none of the above (3) Which of the following conditions can present with low MCV and low MCHC values? (2 pts) a) Thalassemia b) Iron deficiency c) porphyrin defects d) all of the above e) a and b only

2 (4-6) Using the values provided below, calculate the MCV, MCH and MCHC values for each patient below. Calculate MCHC using Hgb and Hct for Patients A, B and C and using MCV and MCH for patients D and E. Show your work and include units for full credit. (15 pts) Patient Hct (%) HgB (g/dl) RBCs A x B C D E x x x x Patient A: Patient B: Patient C: Patient D: Patient E:

3 (7) Based on all data for each patient provided above (questions 4-6) fill in the table below (34 pts) Patient A (female) Cell Morphology Anemia? (based on) Severity List 2 possible cause(s) Patient B (male) Patient C (male) Patient D (female) Patient E (male) (8) A male patient has an MCV = fl; RBC# of 4.82 x10 12 and an MCH = 33.6 pg. (6 pts) Based on these values, complete the questions below (show calculations and units) What is his Hct value? What is his HgB value? Describe his RBC morphology Is he anemic? Based on what indicator(s) (9) A female patient has normal MCV and normal MCHC values. However, her RBC concentration is reduced and her Hct value indicates a severe anemia (4 pts) In terms of RBCs, what is the fundamental problem that could account for this? What type(s) of anemia (or conditions) present this way?

4 (10) Ann, a 21 year old female patient, presents with fatigue, edema of the feet and ankles, and has the following CBC values: Hct = 34.8% RBCs= 4.23 x10 12 HgB = 12.3 g/dl What are Ann s MCV and MCHC values? (Show calculations and units) (8 pts) MCV = MCHC = Is she anemic? Based on what indicator(s) Describe (classify) her RBC morphology List/describe some possible cause(s) for her condition (11) Jack, a 43 year old male patient, is recovering from surgical removal of an aggressive, but benign, intestinal tumor 6 days ago. He has recently complained of light-headedness and extreme fatigue. His current CBC values are: Hct = 37.7% RBCs = 3.81x10 12 HgB = 12.4 g/dl What are Jack s MCV and MCHC values? (Show calculations and units) (9 pts) MCV = MCHC = Is he anemic? Based on what indicator(s) Describe his RBC morphology Possible cause(s) (12) A patient has the following CBC results: MCV = fl RBCs = 4.73x10 12 MCH = 24.52pg Based on these values, which of the following is correct? (2 pts) a) Hct = 17.16% HgB = g/dl b) Hct = 21.14% HgB = g/dl c) Hct = 38.40% HgB = g/dl d) Hct = 21.14% HgB = g/dl e) Hct = 31.17% HgB = g/dl

5 (13) A patient has high MCV and high MCHC values. (5 pts) List their possible or likely RBC morphology This could be indicative of what type(s) of anemia Based on only the data provided, is the patient anemic? (14) A non-pregnant 23 year old female patient had blood work done over a successive period of several months which yielded the following data (today = day 90): (13 pts) Day 01 HgB = 13.2 g/dl Hct = 39.2% RBCs= 4.31 x10 12 Day 15 HgB = 13.1 g/dl Hct = 38.4% RBCs= 4.13 x10 12 Day 30 HgB = 12.5 g/dl Hct = 36.3% RBCs= 3.68 x10 12 Day 45 HgB = 12.1 g/dl Hct = 35.3% RBCs= 3.22 x10 12 Day 60 HgB = 12.0 g/dl Hct = 34.4% RBCs= 2.91 x10 12 Day 75 HgB = 12.0 g/dl Hct = 34.3% RBCs= 2.61 x10 12 Today HgB = 11.8 g/dl Hct = 34.1% RBCs= 2.60 x10 12 Given the data above, is she anemic? Based on what/which indice(s)? Over-time (Day1 to today), what has been the change in her MCV? in her MCH? in her MCHC? Note: report change in indicator s units and directionality of change (e.g. increased 2.0 fl or decreased 10 pg) What is her current RBC morphology? What type(s) of anemia is this indicative of? (15) Two non-pregnant female patients have the following values: Jane - Hct = 34.7%; Mary HgB = 13.7 g/dl. Based on these values, which of the following is/are correct? a) if both have identical RBC # (4.27x10 12 ), then only Mary is anemic b) if both have identical RBC # (as above), then only Jane has macrocytic cells c) if both have identical RBC # (as above), then Mary will exhibit microcytic cells if she has a Hct value <33.9% d) a and b only e) none of the above (2 pts)

6 (16) Two males (Max and Bob), have identical numbers of RBCs (4.88x ) and identical MCHC values (32.4g/dl). Based on these data, which of the following is/are correct? (2 pts) a) if Max has a Hct = 39.7% and Bob has a Hct = 41.5, then Bob has the lowest HgB value b) if Max and Bob have the Hct values above, then only Max would have microcytic cells c) if Max and Bob have the Hct values above, then only Max is anemic d) a and b only e) none of the above (17) Having developed a new assay for HgB and established the new assays validity in lab settings, you will now be testing the assay under field conditions and will be confirming and following up on 6 nonpregnant females who gave Anemic HgB values in a study conducted 6 weeks ago using a different ( old ) assay. Given below, are data for the 6 Anemic subjects (replicate results), and triplicate results for an established HgB Standard [ 14.0 g/dl ]. Based on these data, answer the questions that follow. (21 pts) Subjects: AA DD GG RR KK WW STD New Assay 11.7/ / / / / / /14.8/15.5 Old Assay 10.2/ / / / / / /13.8/14.5 Calculate the Mean HgB for each AA DD GG RR KK WW STD New Old Which assay is more precise based on the values for the standards (show work)? Which assay is more accurate? Which (if any) diagnosis have changed as a result of the new vs old assay? Which assay ( old or new ) would you use for the next, large-scale study and why would you use it?

7 (18) A non-pregnant 26 year old female returned 13 weeks ago from a 10 month period as a Peace Corps worker in remote South America. Shortly after her return, she was diagnosed with anemia and began treatment. Since then, she has been monitored to assess the progress of her recovery. Evaluate her situation given the blood work data presented below [fill-in the missing data first]. (34 pts) Hct(%) HgB(g/dL) RBC # MCV(fL) Std DevMCV MCH(pg) MCHC(g/dL) RDW(%) Day x Day x (treatment started) Day x Day x Day x Day x Day x (Today) At the start of her treatment (day 14): Describe her cell morphology Was her RDW normal? Was she anemic? Based on what indicator(s) Today (day 84): Describe her cell morphology Is her RDW normal? Is she anemic? Based on what indicator(s) Is the treatment working? Are ALL the RBC indices within normal limits? Which (if any) indices are NOT? For any values that are NOT within normal limits, explain/discuss possible reasons why they are outside the normal range(s)

8 (19) Upon admission to the hospital, blood analysis on a 32 year old male patient provided the following data: Hct (%) = 28.3 HgB (g/dl) = 9.1 RBCs (#) = 3.49 x x10 12 RDW (%) = 12.2 What are his MCV and MCHC values? (Show calculations and units) (24 points) MCV = MCHC = Is he anemic? Based on what indicator(s) Severity? Describe his RBC morphology Further test results (HIGH Blood Urea Nitrogen and HIGH Creatinine) revealed significant (>60%) loss of renal function. Based on these results and those above, briefly discuss if/how this affects your interpretation of the patient s situation. Diet assessment revealed apparent sufficiency of all nutrients, and a synthetic form of Erythropoietin ( Procrit ) was administered. Now, 2 weeks after Procrit treatment, the following blood values were obtained: Hct (%) = 29.8 HgB (g/dl) = 9.6 RBCs (#) = 3.71 x x10 12 RDW (%) = 12.4 What are his MCV and MCHC values now? (Show calculations and units) MCV = MCHC = Is he anemic? Based on what indicator(s) Severity? Describe his RBC morphology Should he continue receiving Procrit treatment why or why not?

9 (20) 2 weeks after moving into the dormitories at the Colorado School of Mines (in the Rocky Mountains about 20 miles east of Denver), all students had blood taken and analysis performed as part of a study. Regarding the student blood samples, which of the following statements is/are true? a) centrifuging the blood at too high a speed could artificially lead to a low Hct value b) assuming similar ages, gender, diet and lifestyle, freshman coming from coastal communities of California would be expected to have HgB values comparable to California students who have lived in Denver area for the past 9-12 months c) a student with significant hypernatremia would likely have decreased HgB and a decreased Hct compared to their values in a normal natremic (normal sodium) state d) all of the above e) a and b only

BONE MARROW PERIPHERAL BLOOD Erythrocyte

BONE MARROW PERIPHERAL BLOOD Erythrocyte None Disclaimer Objectives Define anemia Classify anemia according to pathogenesis & clinical significance Understand Red cell indices Relate the red cell indices with type of anemia Interpret CBC to approach

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

i. Where is the participant seen?

i. Where is the participant seen? PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant

More information

Anemia 1: Fourth year Medical Students/ October/21/ 2015/ Abdallah Abbadi.MD.FRCP Professor

Anemia 1: Fourth year Medical Students/ October/21/ 2015/ Abdallah Abbadi.MD.FRCP Professor Anemia 1: Fourth year Medical Students/ October/21/ 2015/ Abdallah Abbadi.MD.FRCP Professor Email: abdalla.awidi@gmail.com Main Hematological diseases A- Benign Hematology 1- Anemias 2- Bleeding disorders

More information

20/01/1439. Prof. M. Rushdi. Prof. Mahmoud Rushdi Faculty of Veterinary Medicine Assiut University Egypt.

20/01/1439. Prof. M. Rushdi. Prof. Mahmoud Rushdi Faculty of Veterinary Medicine Assiut University Egypt. By Prof. Mahmoud Rushdi Faculty of Veterinary Medicine Assiut University Egypt 1 CBC in Dog 2 1 Evaluation of the red blood cells (RBCs) Erythrocytes picture Determination of RBCs count (/mm 3 or T/l)

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Step 2. Common Blood Tests, and the Coulter Counter Readout

Step 2. Common Blood Tests, and the Coulter Counter Readout Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their

More information

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make

More information

Red cell disorder. Dr. Ahmed Hasan

Red cell disorder. Dr. Ahmed Hasan Red cell disorder Dr. Ahmed Hasan Things to be learned in this lecture Definition and clinical feature of anemia. Classification of anemia. Know some details of microcytic anemia Question of the lecture:

More information

NOTE: This table will be discontinued after this lot.

NOTE: This table will be discontinued after this lot. AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Continuing Education Questions

Continuing Education Questions FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one

More information

The Complete Blood Count

The Complete Blood Count The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count

More information

Discloser. Objectives LETTING GO OF THE RULES OF 3. I am receiving an honorarium from Sysmex for this presentation

Discloser. Objectives LETTING GO OF THE RULES OF 3. I am receiving an honorarium from Sysmex for this presentation LETTING GO OF THE RULES OF 3 and how not to let the MCHC rule your life Jeri Walters, SH(ASCP) Technical Supervisor Esoteric Testing, WI Core Lab, ACL Laboratories Discloser I am receiving an honorarium

More information

Changes to CBC Reference Ranges

Changes to CBC Reference Ranges September 28, 2016 July, 2017 Changes to CBC Reference Ranges At Dynacare, our vision is to be Canada s health and wellness solutions leader. As part of our commitment and continuous efforts to enhance

More information

Laboratory for diagnosis of THALASSEMIA

Laboratory for diagnosis of THALASSEMIA SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia

More information

CASE-BASED SMALL GROUP DISCUSSION

CASE-BASED SMALL GROUP DISCUSSION MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very

More information

Evaluation of Anemia. Md. Shafiqul Bari Associate professor (Medicine) SOMC

Evaluation of Anemia. Md. Shafiqul Bari Associate professor (Medicine) SOMC Evaluation of Anemia Md. Shafiqul Bari Associate professor (Medicine) SOMC Definition Anemia is operationally defined as a reduction in one or more of the major RBC measurements Hemoglobin concentration

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Factors affecting oxygen dissociation curve

Factors affecting oxygen dissociation curve P a g e 1 Factors affecting oxygen dissociation curve As you know, hemoglobin contains 4 heme molecules that bind 4 oxygen molecules (8 atoms). These 4 heme molecules, however, do not bind oxygen all at

More information

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia 50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and

More information

THE KENYA POLYTECHNIC UNIVERSITY COLLEGE

THE KENYA POLYTECHNIC UNIVERSITY COLLEGE THE KENYA POLYTECHNIC UNIVERSITY COLLEGE SCHOOL OF HEALTH SCIENCES AND TECHNOLOGY DEPARTMENT OF BIOMEDICAL LABORATORY SCIENCES AND TECHNOLOGY DIPLOMA IN MEDICAL LABORATORY SCIENCE END OF YEAR 1 EXAMINATION

More information

CASE-BASED SMALL GROUP DISCUSSION

CASE-BASED SMALL GROUP DISCUSSION MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am

More information

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE

More information

BCH 471. Experiment (5) Hemoglobin Estimation, Erythrocyte Sedimentation Rate (ESR) and Hematocrit (HCT)

BCH 471. Experiment (5) Hemoglobin Estimation, Erythrocyte Sedimentation Rate (ESR) and Hematocrit (HCT) BCH 471 Experiment (5) Hemoglobin Estimation, Erythrocyte Sedimentation Rate (ESR) and Hematocrit (HCT) Objectives Quantitative determination of hemoglobin in a blood sample. Determination of erythrocyte

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION

More information

Anemia 1: Fourth year Medical Students/ Feb/22/ Abdallah Awidi Abbadi.MD.FRCP.FRCPath Professor

Anemia 1: Fourth year Medical Students/ Feb/22/ Abdallah Awidi Abbadi.MD.FRCP.FRCPath Professor Anemia 1: Fourth year Medical Students/ Feb/22/ 2018 Abdallah Awidi Abbadi.MD.FRCP.FRCPath Professor Email: abdalla.awidi@gmail.com Kidney EPO O2 Sensor Blood vessel Definition: Anemia is operationally

More information

Chapter 2. ERYTHROPOIESIS and ANEMIA

Chapter 2. ERYTHROPOIESIS and ANEMIA Chapter 2 ERYTHROPOIESIS and ANEMIA Red Cell Production The Production of red cells, known as erythropoiesis, is a developmental system fundamentally under genetic control but modulated and regulated by

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

Hemoglobin. Each alpha subunit has 141 amino acids, and each beta subunit has 146 amino acids.

Hemoglobin. Each alpha subunit has 141 amino acids, and each beta subunit has 146 amino acids. In the previous lecture we talked about erythropoiesis and its regulation by many vitamins like vitamin B12 and folic acid, proteins, iron and trace elements copper and cobalt. Also we talked about pernicious

More information

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY

HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY HEMATOCRIT Hematocrit is a measure of the percentage of the total blood volume that is made up by the red blood cells The hematocrit can be determined directly

More information

Diagnostic Approach to Patients with Anemia

Diagnostic Approach to Patients with Anemia J KMA Special Issue Diagnostic Approach to Patients with Anemia Seonyang Park, MD Department of Internal Medicine, Seoul National University College of Medicine E mail : seonpark@snu.ac.kr J Korean Med

More information

Evaluation of Hematological Parameters and Iron Status among Renal Failure Patients Attending Ribat National Hospital Khartoum, Sudan

Evaluation of Hematological Parameters and Iron Status among Renal Failure Patients Attending Ribat National Hospital Khartoum, Sudan EUROPEAN ACADEMIC RESEARCH Vol. III, Issue 11/ February 216 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Evaluation of Hematological Parameters and Iron Status among

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

SMALL GROUP DISCUSSION

SMALL GROUP DISCUSSION MHD II, Session 1 Student Copy Page 1 SMALL GROUP DISCUSSION MHD II Session 1 Gastroinestinal Monday, January 9, 2017 STUDENT COPY MHD II, Session 1 Student Copy Page 2 CASE 1 CHIEF CONCERN: "I'm passing

More information

Approach to a pale child

Approach to a pale child Approach to a pale child Dr. Dafalla Ahmed Babiker Jazan university objectives Definition of anemia Classification and causes Important points in history and physical examination Investigations. Definition

More information

Introduction To Medical Technology. Hemoglobin Concentration Determination

Introduction To Medical Technology. Hemoglobin Concentration Determination Introduction To Medical Technology Hemoglobin Concentration Determination Hemoglobin (Hb) Hemoglobin (Hb) is the standard abbreviation for hemoglobin, the oxygen-carrying pigment and predominant protein

More information

Approach to the child with anemia. Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital

Approach to the child with anemia. Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital Approach to the child with anemia Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital Definition of anemia Hb< 2 SD or P2.5 below the mean for a healthy of the same gender

More information

BCH 471 Experiment (7) HEMOGIOBIN AND ANEMIA, ERYTHROCYTE SEDIMENTATION RATE (ESR) AND HEMATOCRIT (HCT)

BCH 471 Experiment (7) HEMOGIOBIN AND ANEMIA, ERYTHROCYTE SEDIMENTATION RATE (ESR) AND HEMATOCRIT (HCT) BCH 471 Experiment (7) HEMOGIOBIN AND ANEMIA, ERYTHROCYTE SEDIMENTATION RATE (ESR) AND HEMATOCRIT (HCT) OBJECTIVES 1) Quantitative determination of hemoglobin in a blood sample. 2) Determination of erythrocyte

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

Anemia in the elderly. Nattiya Teawtrakul MD., PhD

Anemia in the elderly. Nattiya Teawtrakul MD., PhD Anemia in the elderly Nattiya Teawtrakul MD., PhD Contents Definition of anemia in the elderly The impact of anemia in the elderly Etiology of anemia in the elderly Management of anemia in the elderly

More information

SMALL GROUP DISCUSSION

SMALL GROUP DISCUSSION MHD II, Seesion II Student Copy - Page 1 SMALL GROUP DISCUSSION MHD II Session II JANUARY 15, 2014 Recent Review highlighting disease process in Case 2: Fasano A, Catassi, C. NEJM 2012; 367: 2419-26 STUDENT

More information

Microcytic Hypochromic Anemia An Approach to Diagnosis

Microcytic Hypochromic Anemia An Approach to Diagnosis Microcytic Hypochromic Anemia An Approach to Diagnosis Decreased hemoglobin synthesis gives rise to microcytic hypochromic anemias. Hypochromic anemias are characterized by normal cellular proliferation

More information

Hematopoiesis, The hematopoietic machinery requires a constant supply iron, vitamin B 12, and folic acid.

Hematopoiesis, The hematopoietic machinery requires a constant supply iron, vitamin B 12, and folic acid. Hematopoiesis, 200 billion new blood cells per day The hematopoietic machinery requires a constant supply iron, vitamin B 12, and folic acid. hematopoietic growth factors, proteins that regulate the proliferation

More information

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory

More information

The LaboratoryMatters

The LaboratoryMatters Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic

More information

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION

EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click

More information

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00

More information

(anemia) ก hemoglobin concentration, hematocrit deviation 1 1 ก hemoglobin, hematocrit mean corpuscular volume (MCV) 2

(anemia) ก hemoglobin concentration, hematocrit deviation 1 1 ก hemoglobin, hematocrit mean corpuscular volume (MCV) 2 ก ก. ก ก.. ก (anemia) ก hemoglobin concentration, hematocrit ก ก ก 2 Standard deviation 1 1 ก hemoglobin, hematocrit mean corpuscular volume (MCV) 2 Hemoglobin hematocrit MCV (g/dl) (%) (fl) ( ) 0.5-1.9

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

Patient: Becky Smith DOB: 01/26/XXXX Age: 5 y/o Attending: Dr. D. Miles Allergies: NKA MR#: 203. Patient Chart #203 Becky Smith

Patient: Becky Smith DOB: 01/26/XXXX Age: 5 y/o Attending: Dr. D. Miles Allergies: NKA MR#: 203. Patient Chart #203 Becky Smith Patient Chart #203 Becky Smith 1 Property of CSCLV CSCLV Rev: 06/04/2018 Chief Complaint: Abdominal pain. Informant: Parents. HISTORY & PHYSICAL HPI: Ill looking patient, healthy until 2 days ago when

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

Clinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock

Clinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock Learning Objectives At the completion of this program, the participants will be able to: 1. Identify the components of the CBC and Differential and their clinical implications. 2. Identify normal pediatric

More information

INTERELATIONSHIP BETWEEN IDA AND VITAMIN D DEFICIENCY IS NOW ESTABLISHED

INTERELATIONSHIP BETWEEN IDA AND VITAMIN D DEFICIENCY IS NOW ESTABLISHED INTERELATIONSHIP BETWEEN IDA AND VITAMIN D DEFICIENCY IS NOW ESTABLISHED Rationale for Combining Iron & Vit-D Vit D deficiency and Iron deficiency Anaemia the two most menacing disorders - are inter-related

More information

MHD II Session 3 STUDENT COPY

MHD II Session 3 STUDENT COPY MHD II, Session 3, Student Copy - Page 1 MHD II Session 3 January 15, 2016 STUDENT COPY MHD II, Session 3, Student Copy - Page 2 CASE HISTORY 1 Cc: Terrible diarrhea for 1 ½ days A 66 year-old woman presents

More information

3. Blood Cell Histograms:

3. Blood Cell Histograms: LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative

More information

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:

More information

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for

More information

This amount has to be newly synthesized each day because:

This amount has to be newly synthesized each day because: Hemoglubin synthesis The circulation blood of normal adult contain about 750 mg of hemoglobin and of this about 7 8 gm are degraded daily. This amount has to be newly synthesized each day because: 1) The

More information

Icd code for cbc with differential/ platelet

Icd code for cbc with differential/ platelet Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential

More information

VOLUME & NORMALIZATION ASSAY KITS

VOLUME & NORMALIZATION ASSAY KITS Interactive Assay Solutions VOLUME & NORMALIZATION ASSAY KITS Table of Contents Assay Kits Page # Creatinine, Urinary Detection Kits 3 Hemoglobin Colorimetric Detection Kits 4 Protein Dual Range (BCA)

More information

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA

More information

Anemia In the Insurance Applicant What do the numbers mean?

Anemia In the Insurance Applicant What do the numbers mean? Anemia In the Insurance Applicant What do the numbers mean? Lisa Duckett, M.D. Vice President and Medical Director September 12, 2017 Goals of the presentation Develop a consistent way to analyze Complete

More information

Hematology Unit Lab 1 Review Material

Hematology Unit Lab 1 Review Material Hematology Unit Lab 1 Review Material - 2018 Objectives Laboratory instructors: 1. Assist students during lab session Students: 1. Review the introductory material 2. Study the case histories provided

More information

Symptoms and Signs in Hematology (2)/ 2013

Symptoms and Signs in Hematology (2)/ 2013 Symptoms and Signs in Hematology (2)/ 2013 Abdallah Abbadi.MD.FRCP Professor of Medicine,Hematology & Oncology University of Jordan & JUH Email: abdalla.awidi@gmail.com Case one: A 24 yr old female complains

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:

More information

Approach to the abnormal CBC

Approach to the abnormal CBC Approach to the abnormal CBC Robert T. Means, Jr., M.D. Hematology and Blood & Marrow Transplant Division University of Kentucky and VA Medical Center Lexington KY General Considerations Always repeat

More information

IRON DEFICIENCY / ANAEMIA ANTHONY BEETON

IRON DEFICIENCY / ANAEMIA ANTHONY BEETON IRON DEFICIENCY / ANAEMIA ANTHONY BEETON HYPOXIA 1-2 mg IRON Labile iron Body iron ± 3 4 g Liver and the reticuloendothelial system and spleen (approximately 200 300 mg in adult women and 1 g in adult

More information

Heme Questions and Derivatives for the USMLE Step One Exam. Winter Storm Skylar Edition

Heme Questions and Derivatives for the USMLE Step One Exam. Winter Storm Skylar Edition Heme Questions and Derivatives for the USMLE Step One Exam Winter Storm Skylar Edition Howard J. Sachs, MD Howard@12DaysinMarch.com www.12daysinmarch.com Patient presents for routine preoperative evaluation

More information

Results Report. Welcome to Your ABT Report!

Results Report. Welcome to Your ABT Report! Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be

More information

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;

More information

Advanced Hematology Five-Part Differential. Simple Operation

Advanced Hematology Five-Part Differential. Simple Operation HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior

More information

Comparison between Manual and Automated Methods for Determination of Canine and Feline Hematocrit and Hemoglobin Concentration

Comparison between Manual and Automated Methods for Determination of Canine and Feline Hematocrit and Hemoglobin Concentration Kasetsart J. (Nat. Sci.) 4 : 655-659 (8) Comparison between and d Methods for Determination of Canine and Feline Hematocrit and Hemoglobin Concentration Kreangsak Prihirunkit *, Chalermpol Lekcharoensuk

More information

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur

DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010

More information

Types of Anaemias and their Management. S. Moncrieffe, Pharm.D., MPH, Dip.Ed., RPh. PSJ CE Mandeville Hotel April 27, 2014

Types of Anaemias and their Management. S. Moncrieffe, Pharm.D., MPH, Dip.Ed., RPh. PSJ CE Mandeville Hotel April 27, 2014 Types of Anaemias and their Management S. Moncrieffe, Pharm.D., MPH, Dip.Ed., RPh. PSJ CE Mandeville Hotel April 27, 2014 Objectives At the end of the presentations participants should be able to: 1. Define

More information

MHD I SESSION X. Renal Disease

MHD I SESSION X. Renal Disease MHD I, Session X, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION X Renal Disease Monday, November 11, 2013 MHD I, Session X, Student Copy Page 2 Case #1 Cc: I have had weeks of diarrhea

More information

Supporting Information for: Diagnosis of Iron Deficiency Anemia Using Density-based Fractionation of. Red Blood Cells

Supporting Information for: Diagnosis of Iron Deficiency Anemia Using Density-based Fractionation of. Red Blood Cells Supporting Information for: Diagnosis of Iron Deficiency Anemia Using Density-based Fractionation of Red Blood Cells Jonathan W. Hennek 1, Ashok Kumar 1, Alex Wiltschko, 2,3 Matthew Patton 1, Si Yi Ryan

More information

Interpreting Blood Tests Part 1. Dr Andrew Smith

Interpreting Blood Tests Part 1. Dr Andrew Smith Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core

More information

Shyana Sadiq DFM 484: MNT Case Study 33: Esophageal Cancer Treated with Surgery and Radiation 10/14/2013

Shyana Sadiq DFM 484: MNT Case Study 33: Esophageal Cancer Treated with Surgery and Radiation 10/14/2013 Shyana Sadiq DFM 484: MNT Case Study 33: Esophageal Cancer Treated with Surgery and Radiation 10/14/2013 I. Understanding the Disease and Pathophysiology 1. Mr. Seyer has been diagnosed with adenocarcinoma

More information

HM5. Hematology Analyzer BETTER. ACTUALLY.

HM5. Hematology Analyzer BETTER. ACTUALLY. HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter

More information

CPRS Lab Formatter. User Guide

CPRS Lab Formatter. User Guide CPRS Lab Formatter User Guide 1 March 2016 Contents 1 Introduction 3 2 Features 4 2.1 Accessing the Formatter.................................................. 4 2.2 Formatting Labs..........................................................

More information

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor

Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Documentation Dissection

Documentation Dissection History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3

More information

Parkview Health Laboratories Health Fair Information

Parkview Health Laboratories Health Fair Information FAX SHEET.doc Thank you for choosing Parkview Health Laboratories (PHL) for your laboratory needs. We value the opportunity in providing laboratory services for your specific group or organization. PHL

More information

201 Low Hematocrit/Low Hemoglobin

201 Low Hematocrit/Low Hemoglobin 201 Low Hematocrit/Low Hemoglobin Definition/Cut off Value Hemoglobin or hematocrit concentration below the 95 percent confidence interval (i.e., below the.025 percentile) for healthy, well nourished individuals

More information

Aranesp. Aranesp (darbepoetin alfa) Description

Aranesp. Aranesp (darbepoetin alfa) Description Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.85.01 Subject: Aranesp Page: 1 of 6 Last Review Date: September 15, 2017 Aranesp Description Aranesp

More information

Complete Blood Count (CBC)

Complete Blood Count (CBC) Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information

Classification of Anaemia

Classification of Anaemia Classification of Anaemia Dr Roger Pool Department of Haematology NHLS & University of Pretoria MEASUREMENT OF HAEMATOCRIT The haematocrit ratio (Hct) is the proportion of blood made up of cells - mainly

More information

Hematology: Challenging Cases with Your Participation COPYRIGHT

Hematology: Challenging Cases with Your Participation COPYRIGHT Hematology: Challenging Cases with Your Participation Reed E. Drews, MD Beth Israel Deaconess Medical Center Harvard Medical School Boston, MA Question 1 Question 1 64-year-old man is evaluated during

More information