a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)
|
|
- Horace Robertson
- 5 years ago
- Views:
Transcription
1 Week 4 - PROBLEM SET ( 200 points ) INSTRUCTIONS: Report all numerical answers to 1 decimal place. Do not round values used for calculations. Must show calculations and units for full credit. (1) A standard curve for hemoglobin (HgB) yielded the equation y = 0.049x (with an r 2 value of.998 over the range of 0-50 g/dl HgB. Using the equation from this standard curve line equation, a) Determine the HgB values for the patient samples to fill in the table below. (15 points total) Patient Absorbance HgB calculation HgB conc. Hct (540 nm) (g/dl) (%) 1 (Female) (Female) (Male) (Male) (Pregnant) b) Is patient #1 anemic ( yes / no ) based on: low Hct / low HgB / both normal Is patient #2 anemic ( yes / no ) Is patient #3 anemic ( yes / no ) Is patient #4 anemic ( yes / no ) Is patient #5 anemic ( yes / no ) based on: low Hct / low HgB / both normal based on: low Hct / low HgB / both normal based on: low Hct / low HgB / both normal based on: low Hct / low HgB / both normal (2) Which of the statements is/are true concerning determination of Hct and HgB? (2 pts) a) the colorimetric assay for HgB uses alkaline potassium ferricyanide to oxidize hemoglobin to methemoglobin b) Hct is determined by dividing the total blood volume (or height) in the hematocrit tube by the packed red blood cell volume (height) c) A blood sample with a large proportion of lysed (broken) cells will still give an accurate Hct d) a and b only e) none of the above (3) Which of the following conditions can present with low MCV and low MCHC values? (2 pts) a) Thalassemia b) Iron deficiency c) porphyrin defects d) all of the above e) a and b only
2 (4-6) Using the values provided below, calculate the MCV, MCH and MCHC values for each patient below. Calculate MCHC using Hgb and Hct for Patients A, B and C and using MCV and MCH for patients D and E. Show your work and include units for full credit. (15 pts) Patient Hct (%) HgB (g/dl) RBCs A x B C D E x x x x Patient A: Patient B: Patient C: Patient D: Patient E:
3 (7) Based on all data for each patient provided above (questions 4-6) fill in the table below (34 pts) Patient A (female) Cell Morphology Anemia? (based on) Severity List 2 possible cause(s) Patient B (male) Patient C (male) Patient D (female) Patient E (male) (8) A male patient has an MCV = fl; RBC# of 4.82 x10 12 and an MCH = 33.6 pg. (6 pts) Based on these values, complete the questions below (show calculations and units) What is his Hct value? What is his HgB value? Describe his RBC morphology Is he anemic? Based on what indicator(s) (9) A female patient has normal MCV and normal MCHC values. However, her RBC concentration is reduced and her Hct value indicates a severe anemia (4 pts) In terms of RBCs, what is the fundamental problem that could account for this? What type(s) of anemia (or conditions) present this way?
4 (10) Ann, a 21 year old female patient, presents with fatigue, edema of the feet and ankles, and has the following CBC values: Hct = 34.8% RBCs= 4.23 x10 12 HgB = 12.3 g/dl What are Ann s MCV and MCHC values? (Show calculations and units) (8 pts) MCV = MCHC = Is she anemic? Based on what indicator(s) Describe (classify) her RBC morphology List/describe some possible cause(s) for her condition (11) Jack, a 43 year old male patient, is recovering from surgical removal of an aggressive, but benign, intestinal tumor 6 days ago. He has recently complained of light-headedness and extreme fatigue. His current CBC values are: Hct = 37.7% RBCs = 3.81x10 12 HgB = 12.4 g/dl What are Jack s MCV and MCHC values? (Show calculations and units) (9 pts) MCV = MCHC = Is he anemic? Based on what indicator(s) Describe his RBC morphology Possible cause(s) (12) A patient has the following CBC results: MCV = fl RBCs = 4.73x10 12 MCH = 24.52pg Based on these values, which of the following is correct? (2 pts) a) Hct = 17.16% HgB = g/dl b) Hct = 21.14% HgB = g/dl c) Hct = 38.40% HgB = g/dl d) Hct = 21.14% HgB = g/dl e) Hct = 31.17% HgB = g/dl
5 (13) A patient has high MCV and high MCHC values. (5 pts) List their possible or likely RBC morphology This could be indicative of what type(s) of anemia Based on only the data provided, is the patient anemic? (14) A non-pregnant 23 year old female patient had blood work done over a successive period of several months which yielded the following data (today = day 90): (13 pts) Day 01 HgB = 13.2 g/dl Hct = 39.2% RBCs= 4.31 x10 12 Day 15 HgB = 13.1 g/dl Hct = 38.4% RBCs= 4.13 x10 12 Day 30 HgB = 12.5 g/dl Hct = 36.3% RBCs= 3.68 x10 12 Day 45 HgB = 12.1 g/dl Hct = 35.3% RBCs= 3.22 x10 12 Day 60 HgB = 12.0 g/dl Hct = 34.4% RBCs= 2.91 x10 12 Day 75 HgB = 12.0 g/dl Hct = 34.3% RBCs= 2.61 x10 12 Today HgB = 11.8 g/dl Hct = 34.1% RBCs= 2.60 x10 12 Given the data above, is she anemic? Based on what/which indice(s)? Over-time (Day1 to today), what has been the change in her MCV? in her MCH? in her MCHC? Note: report change in indicator s units and directionality of change (e.g. increased 2.0 fl or decreased 10 pg) What is her current RBC morphology? What type(s) of anemia is this indicative of? (15) Two non-pregnant female patients have the following values: Jane - Hct = 34.7%; Mary HgB = 13.7 g/dl. Based on these values, which of the following is/are correct? a) if both have identical RBC # (4.27x10 12 ), then only Mary is anemic b) if both have identical RBC # (as above), then only Jane has macrocytic cells c) if both have identical RBC # (as above), then Mary will exhibit microcytic cells if she has a Hct value <33.9% d) a and b only e) none of the above (2 pts)
6 (16) Two males (Max and Bob), have identical numbers of RBCs (4.88x ) and identical MCHC values (32.4g/dl). Based on these data, which of the following is/are correct? (2 pts) a) if Max has a Hct = 39.7% and Bob has a Hct = 41.5, then Bob has the lowest HgB value b) if Max and Bob have the Hct values above, then only Max would have microcytic cells c) if Max and Bob have the Hct values above, then only Max is anemic d) a and b only e) none of the above (17) Having developed a new assay for HgB and established the new assays validity in lab settings, you will now be testing the assay under field conditions and will be confirming and following up on 6 nonpregnant females who gave Anemic HgB values in a study conducted 6 weeks ago using a different ( old ) assay. Given below, are data for the 6 Anemic subjects (replicate results), and triplicate results for an established HgB Standard [ 14.0 g/dl ]. Based on these data, answer the questions that follow. (21 pts) Subjects: AA DD GG RR KK WW STD New Assay 11.7/ / / / / / /14.8/15.5 Old Assay 10.2/ / / / / / /13.8/14.5 Calculate the Mean HgB for each AA DD GG RR KK WW STD New Old Which assay is more precise based on the values for the standards (show work)? Which assay is more accurate? Which (if any) diagnosis have changed as a result of the new vs old assay? Which assay ( old or new ) would you use for the next, large-scale study and why would you use it?
7 (18) A non-pregnant 26 year old female returned 13 weeks ago from a 10 month period as a Peace Corps worker in remote South America. Shortly after her return, she was diagnosed with anemia and began treatment. Since then, she has been monitored to assess the progress of her recovery. Evaluate her situation given the blood work data presented below [fill-in the missing data first]. (34 pts) Hct(%) HgB(g/dL) RBC # MCV(fL) Std DevMCV MCH(pg) MCHC(g/dL) RDW(%) Day x Day x (treatment started) Day x Day x Day x Day x Day x (Today) At the start of her treatment (day 14): Describe her cell morphology Was her RDW normal? Was she anemic? Based on what indicator(s) Today (day 84): Describe her cell morphology Is her RDW normal? Is she anemic? Based on what indicator(s) Is the treatment working? Are ALL the RBC indices within normal limits? Which (if any) indices are NOT? For any values that are NOT within normal limits, explain/discuss possible reasons why they are outside the normal range(s)
8 (19) Upon admission to the hospital, blood analysis on a 32 year old male patient provided the following data: Hct (%) = 28.3 HgB (g/dl) = 9.1 RBCs (#) = 3.49 x x10 12 RDW (%) = 12.2 What are his MCV and MCHC values? (Show calculations and units) (24 points) MCV = MCHC = Is he anemic? Based on what indicator(s) Severity? Describe his RBC morphology Further test results (HIGH Blood Urea Nitrogen and HIGH Creatinine) revealed significant (>60%) loss of renal function. Based on these results and those above, briefly discuss if/how this affects your interpretation of the patient s situation. Diet assessment revealed apparent sufficiency of all nutrients, and a synthetic form of Erythropoietin ( Procrit ) was administered. Now, 2 weeks after Procrit treatment, the following blood values were obtained: Hct (%) = 29.8 HgB (g/dl) = 9.6 RBCs (#) = 3.71 x x10 12 RDW (%) = 12.4 What are his MCV and MCHC values now? (Show calculations and units) MCV = MCHC = Is he anemic? Based on what indicator(s) Severity? Describe his RBC morphology Should he continue receiving Procrit treatment why or why not?
9 (20) 2 weeks after moving into the dormitories at the Colorado School of Mines (in the Rocky Mountains about 20 miles east of Denver), all students had blood taken and analysis performed as part of a study. Regarding the student blood samples, which of the following statements is/are true? a) centrifuging the blood at too high a speed could artificially lead to a low Hct value b) assuming similar ages, gender, diet and lifestyle, freshman coming from coastal communities of California would be expected to have HgB values comparable to California students who have lived in Denver area for the past 9-12 months c) a student with significant hypernatremia would likely have decreased HgB and a decreased Hct compared to their values in a normal natremic (normal sodium) state d) all of the above e) a and b only
BONE MARROW PERIPHERAL BLOOD Erythrocyte
None Disclaimer Objectives Define anemia Classify anemia according to pathogenesis & clinical significance Understand Red cell indices Relate the red cell indices with type of anemia Interpret CBC to approach
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationHAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationAnemia 1: Fourth year Medical Students/ October/21/ 2015/ Abdallah Abbadi.MD.FRCP Professor
Anemia 1: Fourth year Medical Students/ October/21/ 2015/ Abdallah Abbadi.MD.FRCP Professor Email: abdalla.awidi@gmail.com Main Hematological diseases A- Benign Hematology 1- Anemias 2- Bleeding disorders
More information20/01/1439. Prof. M. Rushdi. Prof. Mahmoud Rushdi Faculty of Veterinary Medicine Assiut University Egypt.
By Prof. Mahmoud Rushdi Faculty of Veterinary Medicine Assiut University Egypt 1 CBC in Dog 2 1 Evaluation of the red blood cells (RBCs) Erythrocytes picture Determination of RBCs count (/mm 3 or T/l)
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationStep 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
More informationInterpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
More informationRed cell disorder. Dr. Ahmed Hasan
Red cell disorder Dr. Ahmed Hasan Things to be learned in this lecture Definition and clinical feature of anemia. Classification of anemia. Know some details of microcytic anemia Question of the lecture:
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationContinuing Education Questions
FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one
More informationThe Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
More informationDiscloser. Objectives LETTING GO OF THE RULES OF 3. I am receiving an honorarium from Sysmex for this presentation
LETTING GO OF THE RULES OF 3 and how not to let the MCHC rule your life Jeri Walters, SH(ASCP) Technical Supervisor Esoteric Testing, WI Core Lab, ACL Laboratories Discloser I am receiving an honorarium
More informationChanges to CBC Reference Ranges
September 28, 2016 July, 2017 Changes to CBC Reference Ranges At Dynacare, our vision is to be Canada s health and wellness solutions leader. As part of our commitment and continuous efforts to enhance
More informationLaboratory for diagnosis of THALASSEMIA
SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very
More informationEvaluation of Anemia. Md. Shafiqul Bari Associate professor (Medicine) SOMC
Evaluation of Anemia Md. Shafiqul Bari Associate professor (Medicine) SOMC Definition Anemia is operationally defined as a reduction in one or more of the major RBC measurements Hemoglobin concentration
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationFactors affecting oxygen dissociation curve
P a g e 1 Factors affecting oxygen dissociation curve As you know, hemoglobin contains 4 heme molecules that bind 4 oxygen molecules (8 atoms). These 4 heme molecules, however, do not bind oxygen all at
More informationM. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia
50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and
More informationTHE KENYA POLYTECHNIC UNIVERSITY COLLEGE
THE KENYA POLYTECHNIC UNIVERSITY COLLEGE SCHOOL OF HEALTH SCIENCES AND TECHNOLOGY DEPARTMENT OF BIOMEDICAL LABORATORY SCIENCES AND TECHNOLOGY DIPLOMA IN MEDICAL LABORATORY SCIENCE END OF YEAR 1 EXAMINATION
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am
More informationEDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS
EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More informationBCH 471. Experiment (5) Hemoglobin Estimation, Erythrocyte Sedimentation Rate (ESR) and Hematocrit (HCT)
BCH 471 Experiment (5) Hemoglobin Estimation, Erythrocyte Sedimentation Rate (ESR) and Hematocrit (HCT) Objectives Quantitative determination of hemoglobin in a blood sample. Determination of erythrocyte
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationAnemia 1: Fourth year Medical Students/ Feb/22/ Abdallah Awidi Abbadi.MD.FRCP.FRCPath Professor
Anemia 1: Fourth year Medical Students/ Feb/22/ 2018 Abdallah Awidi Abbadi.MD.FRCP.FRCPath Professor Email: abdalla.awidi@gmail.com Kidney EPO O2 Sensor Blood vessel Definition: Anemia is operationally
More informationChapter 2. ERYTHROPOIESIS and ANEMIA
Chapter 2 ERYTHROPOIESIS and ANEMIA Red Cell Production The Production of red cells, known as erythropoiesis, is a developmental system fundamentally under genetic control but modulated and regulated by
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationHemoglobin. Each alpha subunit has 141 amino acids, and each beta subunit has 146 amino acids.
In the previous lecture we talked about erythropoiesis and its regulation by many vitamins like vitamin B12 and folic acid, proteins, iron and trace elements copper and cobalt. Also we talked about pernicious
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationHEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY
HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY HEMATOCRIT Hematocrit is a measure of the percentage of the total blood volume that is made up by the red blood cells The hematocrit can be determined directly
More informationDiagnostic Approach to Patients with Anemia
J KMA Special Issue Diagnostic Approach to Patients with Anemia Seonyang Park, MD Department of Internal Medicine, Seoul National University College of Medicine E mail : seonpark@snu.ac.kr J Korean Med
More informationEvaluation of Hematological Parameters and Iron Status among Renal Failure Patients Attending Ribat National Hospital Khartoum, Sudan
EUROPEAN ACADEMIC RESEARCH Vol. III, Issue 11/ February 216 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Evaluation of Hematological Parameters and Iron Status among
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationReduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationSMALL GROUP DISCUSSION
MHD II, Session 1 Student Copy Page 1 SMALL GROUP DISCUSSION MHD II Session 1 Gastroinestinal Monday, January 9, 2017 STUDENT COPY MHD II, Session 1 Student Copy Page 2 CASE 1 CHIEF CONCERN: "I'm passing
More informationApproach to a pale child
Approach to a pale child Dr. Dafalla Ahmed Babiker Jazan university objectives Definition of anemia Classification and causes Important points in history and physical examination Investigations. Definition
More informationIntroduction To Medical Technology. Hemoglobin Concentration Determination
Introduction To Medical Technology Hemoglobin Concentration Determination Hemoglobin (Hb) Hemoglobin (Hb) is the standard abbreviation for hemoglobin, the oxygen-carrying pigment and predominant protein
More informationApproach to the child with anemia. Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital
Approach to the child with anemia Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital Definition of anemia Hb< 2 SD or P2.5 below the mean for a healthy of the same gender
More informationBCH 471 Experiment (7) HEMOGIOBIN AND ANEMIA, ERYTHROCYTE SEDIMENTATION RATE (ESR) AND HEMATOCRIT (HCT)
BCH 471 Experiment (7) HEMOGIOBIN AND ANEMIA, ERYTHROCYTE SEDIMENTATION RATE (ESR) AND HEMATOCRIT (HCT) OBJECTIVES 1) Quantitative determination of hemoglobin in a blood sample. 2) Determination of erythrocyte
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationAnemia in the elderly. Nattiya Teawtrakul MD., PhD
Anemia in the elderly Nattiya Teawtrakul MD., PhD Contents Definition of anemia in the elderly The impact of anemia in the elderly Etiology of anemia in the elderly Management of anemia in the elderly
More informationSMALL GROUP DISCUSSION
MHD II, Seesion II Student Copy - Page 1 SMALL GROUP DISCUSSION MHD II Session II JANUARY 15, 2014 Recent Review highlighting disease process in Case 2: Fasano A, Catassi, C. NEJM 2012; 367: 2419-26 STUDENT
More informationMicrocytic Hypochromic Anemia An Approach to Diagnosis
Microcytic Hypochromic Anemia An Approach to Diagnosis Decreased hemoglobin synthesis gives rise to microcytic hypochromic anemias. Hypochromic anemias are characterized by normal cellular proliferation
More informationHematopoiesis, The hematopoietic machinery requires a constant supply iron, vitamin B 12, and folic acid.
Hematopoiesis, 200 billion new blood cells per day The hematopoietic machinery requires a constant supply iron, vitamin B 12, and folic acid. hematopoietic growth factors, proteins that regulate the proliferation
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More informationThe LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
More informationEDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION
EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click
More informationAmerican University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00
More information(anemia) ก hemoglobin concentration, hematocrit deviation 1 1 ก hemoglobin, hematocrit mean corpuscular volume (MCV) 2
ก ก. ก ก.. ก (anemia) ก hemoglobin concentration, hematocrit ก ก ก 2 Standard deviation 1 1 ก hemoglobin, hematocrit mean corpuscular volume (MCV) 2 Hemoglobin hematocrit MCV (g/dl) (%) (fl) ( ) 0.5-1.9
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationPatient: Becky Smith DOB: 01/26/XXXX Age: 5 y/o Attending: Dr. D. Miles Allergies: NKA MR#: 203. Patient Chart #203 Becky Smith
Patient Chart #203 Becky Smith 1 Property of CSCLV CSCLV Rev: 06/04/2018 Chief Complaint: Abdominal pain. Informant: Parents. HISTORY & PHYSICAL HPI: Ill looking patient, healthy until 2 days ago when
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationClinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock
Learning Objectives At the completion of this program, the participants will be able to: 1. Identify the components of the CBC and Differential and their clinical implications. 2. Identify normal pediatric
More informationINTERELATIONSHIP BETWEEN IDA AND VITAMIN D DEFICIENCY IS NOW ESTABLISHED
INTERELATIONSHIP BETWEEN IDA AND VITAMIN D DEFICIENCY IS NOW ESTABLISHED Rationale for Combining Iron & Vit-D Vit D deficiency and Iron deficiency Anaemia the two most menacing disorders - are inter-related
More informationMHD II Session 3 STUDENT COPY
MHD II, Session 3, Student Copy - Page 1 MHD II Session 3 January 15, 2016 STUDENT COPY MHD II, Session 3, Student Copy - Page 2 CASE HISTORY 1 Cc: Terrible diarrhea for 1 ½ days A 66 year-old woman presents
More information3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
More informationAmerican University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:
More informationBeyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for
More informationThis amount has to be newly synthesized each day because:
Hemoglubin synthesis The circulation blood of normal adult contain about 750 mg of hemoglobin and of this about 7 8 gm are degraded daily. This amount has to be newly synthesized each day because: 1) The
More informationIcd code for cbc with differential/ platelet
Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential
More informationVOLUME & NORMALIZATION ASSAY KITS
Interactive Assay Solutions VOLUME & NORMALIZATION ASSAY KITS Table of Contents Assay Kits Page # Creatinine, Urinary Detection Kits 3 Hemoglobin Colorimetric Detection Kits 4 Protein Dual Range (BCA)
More informationClinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
More informationAnemia In the Insurance Applicant What do the numbers mean?
Anemia In the Insurance Applicant What do the numbers mean? Lisa Duckett, M.D. Vice President and Medical Director September 12, 2017 Goals of the presentation Develop a consistent way to analyze Complete
More informationHematology Unit Lab 1 Review Material
Hematology Unit Lab 1 Review Material - 2018 Objectives Laboratory instructors: 1. Assist students during lab session Students: 1. Review the introductory material 2. Study the case histories provided
More informationSymptoms and Signs in Hematology (2)/ 2013
Symptoms and Signs in Hematology (2)/ 2013 Abdallah Abbadi.MD.FRCP Professor of Medicine,Hematology & Oncology University of Jordan & JUH Email: abdalla.awidi@gmail.com Case one: A 24 yr old female complains
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More information5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN
DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:
More informationApproach to the abnormal CBC
Approach to the abnormal CBC Robert T. Means, Jr., M.D. Hematology and Blood & Marrow Transplant Division University of Kentucky and VA Medical Center Lexington KY General Considerations Always repeat
More informationIRON DEFICIENCY / ANAEMIA ANTHONY BEETON
IRON DEFICIENCY / ANAEMIA ANTHONY BEETON HYPOXIA 1-2 mg IRON Labile iron Body iron ± 3 4 g Liver and the reticuloendothelial system and spleen (approximately 200 300 mg in adult women and 1 g in adult
More informationHeme Questions and Derivatives for the USMLE Step One Exam. Winter Storm Skylar Edition
Heme Questions and Derivatives for the USMLE Step One Exam Winter Storm Skylar Edition Howard J. Sachs, MD Howard@12DaysinMarch.com www.12daysinmarch.com Patient presents for routine preoperative evaluation
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationChanges in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
More informationAdvanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
More informationComparison between Manual and Automated Methods for Determination of Canine and Feline Hematocrit and Hemoglobin Concentration
Kasetsart J. (Nat. Sci.) 4 : 655-659 (8) Comparison between and d Methods for Determination of Canine and Feline Hematocrit and Hemoglobin Concentration Kreangsak Prihirunkit *, Chalermpol Lekcharoensuk
More informationDR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur
DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010
More informationTypes of Anaemias and their Management. S. Moncrieffe, Pharm.D., MPH, Dip.Ed., RPh. PSJ CE Mandeville Hotel April 27, 2014
Types of Anaemias and their Management S. Moncrieffe, Pharm.D., MPH, Dip.Ed., RPh. PSJ CE Mandeville Hotel April 27, 2014 Objectives At the end of the presentations participants should be able to: 1. Define
More informationMHD I SESSION X. Renal Disease
MHD I, Session X, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION X Renal Disease Monday, November 11, 2013 MHD I, Session X, Student Copy Page 2 Case #1 Cc: I have had weeks of diarrhea
More informationSupporting Information for: Diagnosis of Iron Deficiency Anemia Using Density-based Fractionation of. Red Blood Cells
Supporting Information for: Diagnosis of Iron Deficiency Anemia Using Density-based Fractionation of Red Blood Cells Jonathan W. Hennek 1, Ashok Kumar 1, Alex Wiltschko, 2,3 Matthew Patton 1, Si Yi Ryan
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More informationShyana Sadiq DFM 484: MNT Case Study 33: Esophageal Cancer Treated with Surgery and Radiation 10/14/2013
Shyana Sadiq DFM 484: MNT Case Study 33: Esophageal Cancer Treated with Surgery and Radiation 10/14/2013 I. Understanding the Disease and Pathophysiology 1. Mr. Seyer has been diagnosed with adenocarcinoma
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More informationCPRS Lab Formatter. User Guide
CPRS Lab Formatter User Guide 1 March 2016 Contents 1 Introduction 3 2 Features 4 2.1 Accessing the Formatter.................................................. 4 2.2 Formatting Labs..........................................................
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationDocumentation Dissection
History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3
More informationParkview Health Laboratories Health Fair Information
FAX SHEET.doc Thank you for choosing Parkview Health Laboratories (PHL) for your laboratory needs. We value the opportunity in providing laboratory services for your specific group or organization. PHL
More information201 Low Hematocrit/Low Hemoglobin
201 Low Hematocrit/Low Hemoglobin Definition/Cut off Value Hemoglobin or hematocrit concentration below the 95 percent confidence interval (i.e., below the.025 percentile) for healthy, well nourished individuals
More informationAranesp. Aranesp (darbepoetin alfa) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.85.01 Subject: Aranesp Page: 1 of 6 Last Review Date: September 15, 2017 Aranesp Description Aranesp
More informationComplete Blood Count (CBC)
Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationClassification of Anaemia
Classification of Anaemia Dr Roger Pool Department of Haematology NHLS & University of Pretoria MEASUREMENT OF HAEMATOCRIT The haematocrit ratio (Hct) is the proportion of blood made up of cells - mainly
More informationHematology: Challenging Cases with Your Participation COPYRIGHT
Hematology: Challenging Cases with Your Participation Reed E. Drews, MD Beth Israel Deaconess Medical Center Harvard Medical School Boston, MA Question 1 Question 1 64-year-old man is evaluated during
More information