Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor

Size: px
Start display at page:

Download "Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor"

Transcription

1 Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr Köln

2 Human Tolerance of Low Molecular Weight Polyethylene Markers page. Composition of the marker The marker is administered as a soft gel with 50 mg each of two monodisperse low molecular weight polyethylene glycols of 8 (mw = 58) and 0 (mw = 8) repeating units, 0,0 g dye brilliant blue and Capmul MCM and Polysorbate 80 as an excipient for a total quantity of 00 mg/soft gel. The soft gel capsule is composed of gelatin. The marker is swallowed under supervision.. Participants of the study The study took place between April th 0 and May 6 th 0 with participants initially. Two participants had to be expelled from the study because they had acquired a severe virus infection while the study was on going. This infection was not related to the intake of marker soft gels. Every participant was asked to give the following information. Data is summarized in Table. Date of birth Name Surname Gender Height Weight Smoker (yes / no, if yes how many cigarettes) Alcohol consumption Known allergies Blood pressure (measured on day and end of the study) Pregnancy (yes / no) Number and age of children Acute diseases present and in the past Chronic diseases present and in the past Medication Known reaction to drugs Known reaction to polyethylene glycols

3 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table : Participant Information Participant Participant Participant Participant Participant 5 Date of Birth Blood pressure 0 / 85 0/85 0 / 85 0 / 85 0/95 Gender Male Female Male Male Female Pregnancy Height 85 cm 80 cm 87 cm 98 cm 67 cm Weight 0 kg 68 kg 90 kg 08 kg 97 kg 0 cigarettes/ 5 cigarettes/ Smoker day day Alcohol consumption Rare Rare Rare Rare Allergy Children Acute diseases/ Surgery Chronic diseases ne Appendectomy, 00 Surgical removal of gall stones, 00 High blood pressure Lung emboli, 0 High blood pressure Medication Amipril, 5 mg Micardis, 80 mg Known reaction to drugs Known reaction to Polyethylene glycol Macrolide antibiotics 0 cigarettes/ day

4 Human Tolerance of Low Molecular Weight Polyethylene Markers page Participant 6 Participant 7 Participant 8 Participant 9 Participant 0 Date of Birth Blood pressure 00/70 60/00 0 / 85 0/80 0/85 Gender Female Female Female Male Female Pregnancy Height 68 cm 70 cm 68 cm 7 cm 68 cm Weight 7 kg 70 kg 80,5 kg 7 kg 7 kg 0 cigarettes / 5 cigarettes / Smoker day day Alcohol consumption Rare Rare Allergy Latex Fruit, Hay fever Penicillin, Nickel Children Acute diseases/ Surgery Chronic diseases Medication Known reaction to drugs Known reaction to Polyethylene glycol C-Section, 005 Streptococcus myocarditis, 99 Knee TEP, 0 C-Section, 007 C-Section, 987 High blood pressure Micardis, 80 mg Amiodipin, 5mg Cymbalta, Iron, Vitamin D

5 Human Tolerance of Low Molecular Weight Polyethylene Markers page 5. Operational and Organizational structure Participants were given soft gel each on the following dates (7 soft gels in total):. th of April 0. th of April 0. 8 th of April 0. 5 th of April 0 5. nd of May th of May th of May 0 Participants were not asked to be sober when blood was collected. Blood samples were drawn after administering the soft gels on the same day on the following dates ( blood collections in total):. th of April 0. 8 th of April 0. nd of May 0. 6 th of May 0 Blood samples were investigated for the following analytes: Heparin plasma o Sodium (=Na) o Potassium (=K) o Glucose (=GLU) o Urea (UREA) o Creatinine (=CREA) o Total protein (=TP o Bilirubin (=BIL) o LDH (LDH) o AST (AST) o ALT (AST) o γ-gt (=GGT) o Alkaline phosphatase (=AP) o HDL (HDL) o Triglycerides (=TRI) o Cholesterol (=CHOL) o C-reactive protein (=CRP) EDTA blood: o Full blood count incl. differentiation of leucocytes

6 Human Tolerance of Low Molecular Weight Polyethylene Markers page 6. Results.. Clinical signs of side reactions to marker soft gels There was no side reaction like nausea, allergic reactions, increase of blood pressure etc. observed in the course of the study... Laboratory investigations There was no significant change of laboratory parameters observed in this study that could be directed to a side reaction to the marker soft gel. Data are summarized in table table.

7 Human Tolerance of Low Molecular Weight Polyethylene Markers page 7 Table : Laboratory data of participant WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l ALT <5 U / l 5 HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl

8 Human Tolerance of Low Molecular Weight Polyethylene Markers page 8 Table : Laboratory data of participant WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV Fl MCH 7. - Pg MCHC g / dl.... Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 0 0 GLU mg / dl AST <5 U / l 0 ALT <5 U / l 6 6 HDL >0 mg / dl UREA 5 0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl 9 TRI <50 mg / dl

9 Human Tolerance of Low Molecular Weight Polyethylene Markers page 9 Table : Laboratory data of participant WBC / nl Ery / pl..0.. Hemoglobin. -.5 g / dl....8 Hematocrit - % MCV fl MCH 7. - pg...0. MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl

10 Human Tolerance of Low Molecular Weight Polyethylene Markers page 0 Table 5: Laboratory data of participant WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic %...6. Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 %...0. AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl 8 8 TRI <50 mg / dl 95 80

11 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 6: Laboratory data of participant 5 WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic %.... Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 %.... AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 0 8 GLU mg / dl AST <5 U / l 5 ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl

12 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 7: Laboratory data of participant 6 WBC / nl Ery / pl...5. Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 %..0.7 AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl

13 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 8: Laboratory data of participant 7 WBC / nl Ery / pl Hemoglobin. -.5 g / dl...0. Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. %....0 Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 6 5 GLU mg / dl AST <5 U / l 0 9 ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl

14 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 9: Laboratory data of participant 8 WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV Fl MCH 7. - Pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 6 7 GLU mg / dl AST <5 U / l 6 ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl

15 Human Tolerance of Low Molecular Weight Polyethylene Markers page 5 Table 0: Laboratory data of participant 9 WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <0. <.0 <.0 <.0 TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l 7 8 ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl.5... LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl

16 Human Tolerance of Low Molecular Weight Polyethylene Markers page 6 Table : Laboratory data of participant 0 WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl 0 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 0 GLU mg / dl AST <5 U / l ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product: SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150. Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

ADPedKD: detailed description of data which will be collected in this registry

ADPedKD: detailed description of data which will be collected in this registry ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -

More information

Kathryn Jones 8/11/2015

Kathryn Jones 8/11/2015 1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening

More information

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

Supplementary Note Details of the patient populations studied Strengths and weakness of the study Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined

More information

What Does My Blood Test Mean

What Does My Blood Test Mean What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential

More information

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION

More information

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This

More information

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

Results Report. Welcome to Your ABT Report!

Results Report. Welcome to Your ABT Report! Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Total Cholesterol A Type of Fat. LDL Bad Cholesterol. HDL Good Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Documentation Dissection

Documentation Dissection History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3

More information

E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women

E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women 442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro

More information

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used

More information

Blood Test Results Report

Blood Test Results Report Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or

More information

What if you could help your team realise their health goals?

What if you could help your team realise their health goals? What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make

More information

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS

Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada

More information

ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO

ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CENTRO MARIO DI NEGRI RICERCHE INSTITUTE CLINICHE FOR PHARMACOLOGICAL PER LE MALATTIE RESEARCH RARE CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

ACCREDITATION DOCUMENT

ACCREDITATION DOCUMENT Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

* * Interpretation

* * Interpretation LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)

More information

H.6.G.2 Non-MAC Studies

H.6.G.2 Non-MAC Studies Page 63 H.6.G.2 Non-MAC Studies H.6.G.2.A Non-MAC Studies at the 600 mg dose A 600 mg dose of azithromycin was given in two non-mac studies (354/354A and 167). Please note: Study 354/354A enrolled a mixture

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

CTAD as a universal anticoagulant

CTAD as a universal anticoagulant Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of

More information

Questionnaire. Traceability in EQA. Traceability

Questionnaire. Traceability in EQA. Traceability Questionnaire in EQA QUESTIONNAIRE ON TRACEABILITY QUESTIONNAIRE ON TRACEABILITY GENERAL INFORMATION Name EQA organisation Country Specify the total number of measurands in the schemes of your EQA organisation

More information

SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.

More information

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These

More information

VITROS MicroSlide Assay Summary

VITROS MicroSlide Assay Summary ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible: Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c

More information

e-figure 1. The design of the study.

e-figure 1. The design of the study. e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and

More information

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Routine Clinic Lab Studies

Routine Clinic Lab Studies Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

FBC interpretation. Dr. Gergely Varga

FBC interpretation. Dr. Gergely Varga FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24

More information

The Complete Blood Count

The Complete Blood Count The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count

More information

Occupation Agency Code Work Location Work Supervisor Duty tel. #

Occupation Agency Code Work Location Work Supervisor Duty tel. # PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal

More information

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test. 5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC

More information

MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS

MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS MHD I, Session 16, STUDENT Copy, Page 1 MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS CASE-BASED SMALL GROUP DISCUSSION SESSION 16 Pulmonary MHD I December 5, 2016 STUDENT COPY MHD I, Session

More information

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test

More information

Patient Information Specimen Information Client Information. Specimen: EN255254W. Requisition:

Patient Information Specimen Information Client Information. Specimen: EN255254W. Requisition: Patient Information Specimen Information Client Information MAIL000 Requisition: 0014895 DIRECT TO PATIENT- WEST HILLS Lab Ref #: PRO76199 8401 FALLBROOK AVE WEST HILLS, CA 91304-3226 Phone: 530.347.6380

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

Senior Executive Wellness Profile

Senior Executive Wellness Profile Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,

More information

Serodos and Serodos plus

Serodos and Serodos plus Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution

More information

i. Where is the participant seen?

i. Where is the participant seen? PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant

More information

LABORATORY SERVICES - PETS

LABORATORY SERVICES - PETS LABORATORY SERVICES - PETS S.N TEST NAME SPECIMEN SAMPLE COLLECTION SAMPLE QUANTITY TRANSPORT AND STORAGE HEMATOLOGY 1 Complete Blood count Whole blood EDTA tube 1ml 4-8 o C 2 Platelet Count Whole blood

More information

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550

More information

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA

More information

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a

More information

GRADING CRITERIA for CMS Regulated Analytes

GRADING CRITERIA for CMS Regulated Analytes CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers

More information

CASE-BASED SMALL GROUP DISCUSSION MHD II

CASE-BASED SMALL GROUP DISCUSSION MHD II MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby

More information

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information