Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
|
|
- Bartholomew Lewis
- 5 years ago
- Views:
Transcription
1 Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr Köln
2 Human Tolerance of Low Molecular Weight Polyethylene Markers page. Composition of the marker The marker is administered as a soft gel with 50 mg each of two monodisperse low molecular weight polyethylene glycols of 8 (mw = 58) and 0 (mw = 8) repeating units, 0,0 g dye brilliant blue and Capmul MCM and Polysorbate 80 as an excipient for a total quantity of 00 mg/soft gel. The soft gel capsule is composed of gelatin. The marker is swallowed under supervision.. Participants of the study The study took place between April th 0 and May 6 th 0 with participants initially. Two participants had to be expelled from the study because they had acquired a severe virus infection while the study was on going. This infection was not related to the intake of marker soft gels. Every participant was asked to give the following information. Data is summarized in Table. Date of birth Name Surname Gender Height Weight Smoker (yes / no, if yes how many cigarettes) Alcohol consumption Known allergies Blood pressure (measured on day and end of the study) Pregnancy (yes / no) Number and age of children Acute diseases present and in the past Chronic diseases present and in the past Medication Known reaction to drugs Known reaction to polyethylene glycols
3 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table : Participant Information Participant Participant Participant Participant Participant 5 Date of Birth Blood pressure 0 / 85 0/85 0 / 85 0 / 85 0/95 Gender Male Female Male Male Female Pregnancy Height 85 cm 80 cm 87 cm 98 cm 67 cm Weight 0 kg 68 kg 90 kg 08 kg 97 kg 0 cigarettes/ 5 cigarettes/ Smoker day day Alcohol consumption Rare Rare Rare Rare Allergy Children Acute diseases/ Surgery Chronic diseases ne Appendectomy, 00 Surgical removal of gall stones, 00 High blood pressure Lung emboli, 0 High blood pressure Medication Amipril, 5 mg Micardis, 80 mg Known reaction to drugs Known reaction to Polyethylene glycol Macrolide antibiotics 0 cigarettes/ day
4 Human Tolerance of Low Molecular Weight Polyethylene Markers page Participant 6 Participant 7 Participant 8 Participant 9 Participant 0 Date of Birth Blood pressure 00/70 60/00 0 / 85 0/80 0/85 Gender Female Female Female Male Female Pregnancy Height 68 cm 70 cm 68 cm 7 cm 68 cm Weight 7 kg 70 kg 80,5 kg 7 kg 7 kg 0 cigarettes / 5 cigarettes / Smoker day day Alcohol consumption Rare Rare Allergy Latex Fruit, Hay fever Penicillin, Nickel Children Acute diseases/ Surgery Chronic diseases Medication Known reaction to drugs Known reaction to Polyethylene glycol C-Section, 005 Streptococcus myocarditis, 99 Knee TEP, 0 C-Section, 007 C-Section, 987 High blood pressure Micardis, 80 mg Amiodipin, 5mg Cymbalta, Iron, Vitamin D
5 Human Tolerance of Low Molecular Weight Polyethylene Markers page 5. Operational and Organizational structure Participants were given soft gel each on the following dates (7 soft gels in total):. th of April 0. th of April 0. 8 th of April 0. 5 th of April 0 5. nd of May th of May th of May 0 Participants were not asked to be sober when blood was collected. Blood samples were drawn after administering the soft gels on the same day on the following dates ( blood collections in total):. th of April 0. 8 th of April 0. nd of May 0. 6 th of May 0 Blood samples were investigated for the following analytes: Heparin plasma o Sodium (=Na) o Potassium (=K) o Glucose (=GLU) o Urea (UREA) o Creatinine (=CREA) o Total protein (=TP o Bilirubin (=BIL) o LDH (LDH) o AST (AST) o ALT (AST) o γ-gt (=GGT) o Alkaline phosphatase (=AP) o HDL (HDL) o Triglycerides (=TRI) o Cholesterol (=CHOL) o C-reactive protein (=CRP) EDTA blood: o Full blood count incl. differentiation of leucocytes
6 Human Tolerance of Low Molecular Weight Polyethylene Markers page 6. Results.. Clinical signs of side reactions to marker soft gels There was no side reaction like nausea, allergic reactions, increase of blood pressure etc. observed in the course of the study... Laboratory investigations There was no significant change of laboratory parameters observed in this study that could be directed to a side reaction to the marker soft gel. Data are summarized in table table.
7 Human Tolerance of Low Molecular Weight Polyethylene Markers page 7 Table : Laboratory data of participant WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l ALT <5 U / l 5 HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl
8 Human Tolerance of Low Molecular Weight Polyethylene Markers page 8 Table : Laboratory data of participant WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV Fl MCH 7. - Pg MCHC g / dl.... Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 0 0 GLU mg / dl AST <5 U / l 0 ALT <5 U / l 6 6 HDL >0 mg / dl UREA 5 0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl 9 TRI <50 mg / dl
9 Human Tolerance of Low Molecular Weight Polyethylene Markers page 9 Table : Laboratory data of participant WBC / nl Ery / pl..0.. Hemoglobin. -.5 g / dl....8 Hematocrit - % MCV fl MCH 7. - pg...0. MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl
10 Human Tolerance of Low Molecular Weight Polyethylene Markers page 0 Table 5: Laboratory data of participant WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic %...6. Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 %...0. AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl 8 8 TRI <50 mg / dl 95 80
11 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 6: Laboratory data of participant 5 WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic %.... Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 %.... AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 0 8 GLU mg / dl AST <5 U / l 5 ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl
12 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 7: Laboratory data of participant 6 WBC / nl Ery / pl...5. Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 %..0.7 AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl
13 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 8: Laboratory data of participant 7 WBC / nl Ery / pl Hemoglobin. -.5 g / dl...0. Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. %....0 Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 6 5 GLU mg / dl AST <5 U / l 0 9 ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl
14 Human Tolerance of Low Molecular Weight Polyethylene Markers page Table 9: Laboratory data of participant 8 WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV Fl MCH 7. - Pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 6 7 GLU mg / dl AST <5 U / l 6 ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl
15 Human Tolerance of Low Molecular Weight Polyethylene Markers page 5 Table 0: Laboratory data of participant 9 WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl CRP <.0 mg / l <0. <.0 <.0 <.0 TP g / dl GGT <0 U / l GLU mg / dl AST <5 U / l 7 8 ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl.5... LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl
16 Human Tolerance of Low Molecular Weight Polyethylene Markers page 6 Table : Laboratory data of participant 0 WBC / nl Ery / pl Hemoglobin. -.5 g / dl Hematocrit - % MCV fl MCH 7. - pg MCHC g / dl Platelets 0-60 / nl Basophilic <.5 % Eosinophilic % Neutrophilic % Lympho % Mono.6-8. % Large unstained cells <.5 % AP U / l BIL mg / dl CHOL <90 mg / dl 0 CRP <.0 mg / l <.0 <.0 <.0 <.0 TP g / dl GGT <0 U / l 0 GLU mg / dl AST <5 U / l ALT <5 U / l HDL >0 mg / dl UREA 5-0 mg / dl K mg / dl CREA mg / dl LDH <50 U / l NA 5-5 mg / dl TRI <50 mg / dl
Rapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationResearch Data Available
Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationIndividual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:
SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationADPedKD: detailed description of data which will be collected in this registry
ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationSupplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationM Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES
M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationEvaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationDocumentation Dissection
History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3
More informationE#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationWhat if you could help your team realise their health goals?
What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make
More informationPediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS
Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada
More informationISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO
ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CENTRO MARIO DI NEGRI RICERCHE INSTITUTE CLINICHE FOR PHARMACOLOGICAL PER LE MALATTIE RESEARCH RARE CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationH.6.G.2 Non-MAC Studies
Page 63 H.6.G.2 Non-MAC Studies H.6.G.2.A Non-MAC Studies at the 600 mg dose A 600 mg dose of azithromycin was given in two non-mac studies (354/354A and 167). Please note: Study 354/354A enrolled a mixture
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationQuestionnaire. Traceability in EQA. Traceability
Questionnaire in EQA QUESTIONNAIRE ON TRACEABILITY QUESTIONNAIRE ON TRACEABILITY GENERAL INFORMATION Name EQA organisation Country Specify the total number of measurands in the schemes of your EQA organisation
More informationSMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationFBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
More informationThe Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
More informationOccupation Agency Code Work Location Work Supervisor Duty tel. #
PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationPresented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationColor: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
More informationMECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS
MHD I, Session 16, STUDENT Copy, Page 1 MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS CASE-BASED SMALL GROUP DISCUSSION SESSION 16 Pulmonary MHD I December 5, 2016 STUDENT COPY MHD I, Session
More informationSMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
More informationPatient Information Specimen Information Client Information. Specimen: EN255254W. Requisition:
Patient Information Specimen Information Client Information MAIL000 Requisition: 0014895 DIRECT TO PATIENT- WEST HILLS Lab Ref #: PRO76199 8401 FALLBROOK AVE WEST HILLS, CA 91304-3226 Phone: 530.347.6380
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationSerodos and Serodos plus
Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationLABORATORY SERVICES - PETS
LABORATORY SERVICES - PETS S.N TEST NAME SPECIMEN SAMPLE COLLECTION SAMPLE QUANTITY TRANSPORT AND STORAGE HEMATOLOGY 1 Complete Blood count Whole blood EDTA tube 1ml 4-8 o C 2 Platelet Count Whole blood
More informationPFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.
PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550
More informationClinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationCASE-BASED SMALL GROUP DISCUSSION MHD II
MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More information