Chromium reducing and plant growth promoting novel strain Pseudomonas aeruginosa OSG41 enhance chickpea growth in chromium amended soils

Transcription

1 From the SelectedWorks of Mohammad Oves Winter February, 2013 Chromium reducing and plant growth promoting novel strain Pseudomonas aeruginosa OSG41 enhance chickpea growth in chromium amended soils Mohammad Oves, King Abdul Aziz University Available at:

2 This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier s archiving and manuscript policies are encouraged to visit:

3 European Journal of Soil Biology 56 (2013) 72e83 Contents lists available at SciVerse ScienceDirect European Journal of Soil Biology journal homepage: Original article Chromium reducing and plant growth promoting novel strain Pseudomonas aeruginosa OSG41 enhance chickpea growth in chromium amended soils Mohammad Oves *, Mohammad Saghir Khan, Almas Zaidi Department of Agricultural Microbiology, Faculty of Agricultural Sciences, Aligarh Muslim University, Aligarh , Uttar Pradesh, India article info abstract Article history: Received 14 October 2012 Received in revised form 9 January 2013 Accepted 15 February 2013 Available online 16 March 2013 Handling editor: Kristina Lindström Keywords: Pseudomonas aeruginosa Chromium bioreduction EPS Proline PGP activities Pseudomonas aeruginosa strain OSG41, isolated from the heavy metal contaminated water irrigated to rhizospheric soil of mustard crop, tolerated chromium up to the concentration of 1800 mg ml 1 and reduced it by 100% at ph 6e8 after 120 h incubation at 30e40 C. P. aeruginosa produced plant growthpromoting substances, both in the presence and absence of chromium; it produced 32 mg ml 1 indole acetic acid ml 1, in Luria Bertani broth with 100 mg tryptophan ml 1, solubilized tri-calcium phosphate (417 mg ml 1 ) and secreted 20.8 mg ml 1 exopolysaccharides (EPS) which decreased with increasing concentration of chromium added to growth medium. While investigating the impact of hexavalent chromium on chickpea, chromium application to soil had a phytotoxic effect. The application of P. aeruginosa strain OSG41 even with three times concentration of chromium increased the dry matter accumulation, symbiotic attributes (like nodule formation), grain yield and protein of chickpea compared to non-inoculated plants. The bio-inoculant decreased the uptake of chromium by 36, 38 and 40% in roots, shoots and grains, respectively. The present finding suggests that the bioinoculant effectively reduced the toxicity of hexavalent chromium to chickpea plants and concurrently enhanced the biological and chemical characteristics of chickpea, when grown in chromium treated soils. Ó 2013 Elsevier Masson SAS. All rights reserved. 1. Introduction Chromium is one of the major environmental pollutants which enter the agro-ecosystem from different sources like, metal finishing, leather tanning, chromate preparation, and cooling tower of nuclear reactor. Of the various forms of chromium, hexavalent chromium (Cr 6þ ) is mutagenic and carcinogenic [1]. After accumulation, the elevated concentration of chromium in soil severely affects the composition and metabolic activities of microbes [2e4] leading to losses in soil fertility [5] and also adversely affects the physiological process of plants [6]. In this context, the toxicity of chromium to various plant growth promoting rhizobacteria (PGPR) for example Bacillus spp. [7,8]; Pseudomonas aeruginosa [9], asymbiotic bacteria such as Azotobacter and symbiotic organism, Rhizobium [6,10] are reported. Mechanistically, when microbes are exposed to chromium polluted environment, hexavalent chromium enters the microbial cells * Corresponding author. Tel./fax: þ , þ (mobile). addresses: owais.micro@gmail.com, owais01m@gmail.com (M. Oves), khanms17@rediffmail.com (M.S. Khan), alma29@rediffmail.com (A. Zaidi). through the membrane transport channels and following accumulation inside, Cr(vi) is reported to oxidatively damage biomolecules like, DNA and other cellular components [11]. Moreover, the other intermediate species of chromium produced from hexavalent chromium like Cr þ5 and Cr þ4, have also been found to exhibit mutagenic and carcinogenic effects on many biological systems including microbial populations [12,13]. Besides these effects, the high concentration of different forms of chromium has also been observed to have negative impact on microbial enzymes [14] such as nitrate reductase in anaerobic soil microcosms [15]. Soil enzymes in general act as a biological catalyst to facilitate different reactions and physiological processes involved in the decomposition of various soil constituents including certain organic pollutants and ultimately affect the soil fertility [16]. While acting on enzymes, chromium interacts with the enzyme substrate complexes, binds with the enzyme active sites and consequently denatures enzyme functions [17]. Additionally, at high concentration, chromium inhibits the oxygen uptake and induces petite mutation in microbes [18]. Conclusively, these studies suggest that chromium disrupts the electron transport system of cell and hence, affect the metabolic process of microorganisms. As a result of altered soil fertility, the deposited chromium in soil can indirectly /$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved.

4 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 73 (by reducing soil fertility) restrict the growth of plants. Thus, apart from their effect on various metabolic activities of microbes, chromium has also been reported to inhibit different important physiological processes of plants. The uptake and transport of chromium to various organs of plants, may cause direct adverse impact such as it may- (i) alter mineral nutrition (ii) impair photosynthesis in legumes for example greengram [Vigna radiata (L.) wilczek] [19] and consequently decrease chlorophyll content [3,20] (iii) inactivate enzymes by interacting with sulfhydryl groups of proteins [21] and (iv) decrease plant growth and seed yield [22,23]. These and other associated data thus clearly suggests that the toxicity of chromium to variable agro-ecological environments including soil requires an inexpensive and effective strategy to clean up the contaminated sites. In this context, certain physicochemical approaches like, electrochemical treatment, ion exchange, precipitation, evaporation, reverse osmosis and sedimentation have been used for detoxifying chromium polluted environment [24,25]. However, due to difficulty in (i) operation at larger scale (ii) negative impact on the environment and (iii) prohibitive cost of operation, these physicochemical methods [26] have not been widely practiced for chromium removal. Considering these factors, focus has been shifted on to find some low-cost option for removing/reducing chromium toxicity from the contaminated regions. In this regard, the use of bacterial cultures especially the plant growth promoting rhizobacteria has provided an attractive and economical alternative for biological reduction of Cr 6þ from contaminated environments [27,28]. Mechanistically, PGPR reduce the metal toxicity by different mechanisms such as biosorption, mobilizing metals through the excretion of organic acids or bioleaching, immobilization or bio-mineralization, intracellular accumulation, and enzyme-catalyzed transformation [24,28]. Apart from metal removal/detoxification, metal-tolerant microbes provide hugely important nutrients to plants [29], protect plants from nuisance of phytopathogens by synthesizing antimicrobial compounds, cyanogenic compounds and siderophores and accelerate the availability of phytohormones such as indole acetic acid (IAA) etc. when applied to seed and soil [30]. As a result of these multifaceted activities, PGPR enhance the overall growth, and yield of plants even when grown in soils already contaminated with heavy metals or soils deliberately designed for testing the toxicity of metals or bioremediation potential of microbes. Compared to the vast and varied inherent functional properties of PGPR, there is little information available on the role of metal tolerant PGPR on the growth and development of legumes especially chickpea when grown intentionally in metal contaminated soils or in soils already polluted with heavy metals like chromium. Considering these applied and extremely important agronomic gaps, the present study was designed to search for a suitable hexavalent chromium reducing PGPR and to determine its proline stress reducing ability and plant growth-promoting activity both in the presence and absence of chromium. The growth promoting potentials of the selected metal tolerant bacterial culture was assessed further in a pot trial experiment using chickpea (Cicer arietinum L.) as a test crop. 2. Materials and methods 2.1. Heavy metal concentration in soil The alluvial sandy clay loam soil samples for total heavy metals were collected from the cultivated fields near industrial area of Ghaziabad (S1), located at N E N E, Uttar Pradesh, India and also from the cultivated but unpolluted sandy clay loam soil from the fields of Faculty of Agricultural Sciences (S2), Aligarh Muslim University, Aligarh, located at N E N E, Uttar Pradesh, India. There was consistent use of industrial sewage water, discharged from Hindan River, at site S1. The heavy metals in soil samples were determined following the method of McGrath and Cunliffe [31] using flame atomic absorption spectrophotometer (Model GBC 932B Plus atomic absorption spectrophotometer). All chemicals used for heavy metal analysis were of Analytical grade and solutions were prepared in double distilled water Bacterial strains and evaluation of metal tolerance In this study, a total of 20 bacterial cultures were isolated from the rhizosphere of mustard (Brassica campestris) grown at the edge of Hindan River near Ghaziabad. The polluted waste water of Hindan River near Ghaziabad was used to irrigate the mustard field as and when required. For enumerating bacterial cultures, King s B agar medium was used, and the selected cultures were maintained on this medium until use. Preliminary test to identify bacterial isolates included colony morphology, and cultural and biochemical characteristics using standard methods [15]. The bacterial strains were tested further to determine resistance/sensitivity against hexavalent chromium (Cr 6þ ) by the chromium amended nutrient agar plate dilution method. After sterility check, nutrient agar plates were treated separately with increasing concentrations (0e2000 mgml 1 ) of Cr 6þ (used as K 2 Cr 2 O 7 ), and were spot inoculated with loopful culture of overnight grown bacterial strain. Plates were incubated at 28 2 C for 48 h. The highest concentration of Cr 6þ supporting bacterial growth was defined as the maximum tolerance level (MTL). Of the total 20 bacterial strains, strain OSG41 showing highest tolerance to hexavalent chromium was selected for further studies Strain identification and phylogenetic tree construction Heavy metal resistant bacteria isolate was characterized both biochemically and molecularly. The biochemical tests conducted for presumptive identification of strain OSG41 included, citrate utilization, indole production, methyl red, nitrate reduction, Voges Proskauer, catalase and oxidase test, gelatine liquefaction, carbohydrates such as dextrose, mannitol and sucrose, utilization and starch hydrolysis following standard methods [32]. Sequencing of the 16S rrna of strain OSG41 was done commercially by a DNA sequencing service (Macrogen, Seoul, South Korea) using universal primers, 518 F (5 0 CCAGCAGCCGCGGTAATACG3 0 ) and 800R (5 0 TACCAGGGTATCTAATCC3 0 ). Nucleotide sequence data was deposited in the GenBank sequence database. The online programme BLASTn was used to find related sequences with known taxonomic information in the databank at the NCBI website ( nlm.nih.gov/blast) to accurately identify strain OSG41. Further, the 16S rrna gene sequence of the selected strains was characterized using universal primer 518 F and 800 R. The sequence (1466 bp) so obtained were analyzed using BLASTn programme at NCBI server ( to identify and compare the isolate with the nearest neighbour sequence available in the NCBI database [33]. All the sequence were aligned using Clustal W 1.6 programme at ( BLASTn alignment tools used bootstrapped neighbour-joining relationship were estimated with MEGA4 software [33] Chromium reduction The effect of ph values on Cr 6þ reduction was assessed using nutrient broth (NB) treated with varying concentrations (0, 50, 100, 200 and 400 mg ml 1 )ofcr 6þ and the autoclaved medium was adjusted to ph 4, 5, 6, 7, 8, 9 and 10 with 1 M HCL or 1 M NaOH. A

5 74 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e ml of exponentially grown culture of P. aeruginosa OSG41, was inoculated into NB medium containing different concentrations of hexavalent chromium and incubated at varying temperatures such as 20, 25, 30 and 40 C for different time intervals (upto 120 h) in order to assess the impact of temperatures on chromium reduction by strain OSG41. For Cr 6þ reduction, one ml culture from each flask was centrifuged (6000 rpm) for 10 min at 10 C, and Cr 6þ in the supernatant was determined by the 1,5-diphenyl carbazide method [34,35] Bioassay of plant growth promoting (PGP) activities under chromium stress Phosphate solubilization and siderophore production Various PGP activities such as, P-solubilization, indole acetic acid (IAA), siderophores, and hydrogen cyanide (HCN) of the bacterial strains were assayed both in the presence and absence of the selected chromium salt under in vitro conditions. The phosphate solubilization activity was quantitatively assayed using liquid culture medium containing tri-calcium phosphate (TCP) amended with 0, 50, 100, 200 and 400 mg Crml 1.The amount of water-soluble P was estimated by a chlorostannous reduced molybdophosphoric acid blue method [36,37]. The productions of siderophores by the P. aeruginosa OSG41 strain was detected using the Chrome Azurol S (CAS) method [38] using the four concentrations (50, 100, 200 and 400 mg ml 1 )ofchromium, added to CAS agar plates. For quantitative estimation of siderophore, the P. aeruginosa OSG41 strain was grown in Modi medium (K 2 HPO %; MgSO %; NaCl 0.01%; mannitol 1%; glutamine 0.1%; NH 4 NO 3 0.1%) treated with 0 50, 100, 200 and 400 mg Cr ml 1 for 5 days and Catechol-type phenolates was measured [39]. For the assay, one volume of the Hathway s reagent was added to one volume of sample, and absorbance was determined at 560 nm for salicylates with sodium salicylate as a standard and at 700 nm for dihydroxy phenols with 2,3-DHBA as a standard Bioassay of indole acetic acid and cyanogenic compounds Indole-3-acetic acid synthesized by P. aeruginosa OSG41 strain was quantitatively evaluated by the method of Gordon and Weber [40], later modified by Bric et al. [41]. For this activity, the P. aeruginosa OSG41 strain was grown in Luria Bertani (LB) broth (g l 1 : tryptone 10; yeast extract 5; NaCl 10 and ph 7.5). A 100 ml of LB having a fixed concentration (100 mg ml 1 ) of tryptophan as an inducer (Glickmann and Dessaux, 1955) [42] and supplemented with 0, 50, 100, 200 and 400 mg ml 1 of hexavalent chromium was inoculated with 100 ml culture (10 8 cells ml 1 )ofp. aeruginosa OSG41 strain and incubated for 7 days at 28 2 C with shaking at 120 rpm. After seven days, a 5 ml culture from each treatment was centrifuged (8000 r/min) for 15 min and an aliquot of 2 ml supernatant was mixed with 100 ml of orthophosphoric acid and 4 ml of Salkowsky reagent (2% 0.5 M FeCl 3 in 35% per-chloric acid) and incubated at 28 2 C in darkness for 1 h. The absorbance of developed pink colour was read at 530 nm. The IAA concentration in the supernatant was determined using a calibration curve of pure IAA as a standard. Hydrogen cyanide production by P. aeruginosa OSG41 strain was detected by the method of Bakker and Schipper [43]. For HCN production, P. aeruginosa OSG41 strain was grown on an HCN induction medium (g l 1 : tryptic soy broth 30; glycine 4.4 and agar 15) supplemented with 0, 50, 100, 200 and 400 mg ml 1 of hexavalent chromium at 28 2 C for 4 days. Further, a loopful culture of strain OSG41 was placed in the centre of the Petri plates, amended with selected concentration of hexavalent chromium. A disk of Whatman filter paper No. 1 dipped in 0.5% picric acid and 2% Na 2 CO 3 was placed at the lid of the Petri plates. Plates were sealed with parafilm. After 4 days incubation at 28 2 C, an orange brown colour of the paper indicating HCN production was observed Ammonia and exo-polysaccharide synthesis For ammonia (NH 3 ) detection, P. aeruginosa OSG41 strain was grown in peptone water with 0, 50, 100, 200 and 400 mg ml 1 of hexavalent chromium and incubated at 28 2 C for 4 days. One millilitre of Nessler reagent was added to each tube and the development of yellow colour indicating ammonia production was recorded following the method of Dye [44]. The exopolysaccharide (EPS) produced by the P. aeruginosa OSG41 was determined as suggested by Mody et al. [45]. For this, the bacterial strain was grown in 100 ml capacity flasks containing basal medium supplemented with 5% sucrose and treated with 0, 50, 100, 200 and 400 of hexavalent chromium. Inoculated flasks were incubated for 5 days at 28 2 C on a rotary shaker. Culture broth was spun (8000 r/min) for 30 min and EPS was extracted by adding three volumes of chilled acetone (CH 3 COCH 3 ) to one volume of supernatant. The precipitated EPS was repeatedly washed three times alternately with distilled water and acetone, transferred to a filter paper and weighed after overnight drying at room temperature Plant growth and metal uptake Seeds of chickpea var. Avrodhi were surface sterilized with 70% ethanol, 3 min followed by 3% sodium hypochlorite, 3 min, rinsed six times with sterile water and shade dried. The sterilized seeds were bacterized with P. aeruginosa OSG41, grown in nutrient broth, by dipping the seeds in liquid culture medium for 2 h using 10% gum Arabic as adhesive to deliver approximately 10 8 cells seed 1. The non-coated sterilized seeds soaked in sterile water served as control. The non-inoculated and inoculated chickpea seeds (8 seeds per pot) were sown in clay pots (25 cm high, 22 cm internal diameter) using 3 kg unsterilized soils from agricultural field of Aligarh Muslim University Aligarh (sandy clay loam, organic carbon 0.4%, Kjeldahl N 0.75 g kg 1, Olsen P 16 mg kg 1, ph 7.2 and WHC 0.45 ml g 1, Cr 6.5 mgg 1,Cu18mgg 1, Ni 14.7 mgg 1,Zn25mgg 1, Pb 9.5 mg g 1 and Cd 0.4 mg g 1 ) with control (without chromium) and four treatments each with 50, 100, 200, and 400 mg g 1 hexavalent chromium in soil used in this study. Six pots used for each treatment were arranged in a complete randomized block design. Three weeks after emergence, plants in each pot were thinned to three plants. The pots were watered with tap water and were maintained in an open field condition. The experiments were conducted for two consecutive years to ascertain the reproducibility of data Measurement of biological characteristics, symbiotic efficiency, seed yield and metal uptake All plants in three pots for each treatment were removed at 80 days and remaining three pots at 130 days after seeding (DAS), and were observed for growth and symbiotic attributes. Plants uprooted at 80 and 130 DAS were oven-dried at 80 Canddry matter was measured. Total chlorophyll content in fresh foliage of inoculated chickpea plants grown in chromium stressed and metal free (control) soil was measured at 80 DAS by the method of Arnon [46]. The leghaemoglobin (Lb) content in fresh nodules recovered from the root system of chickpea plants maintained under metal stressed and metal free soils (control) was assessed at 80 DAS [47]. Seed yield and grain protein was estimated [48] at 130 DAS (harvest). Chromium content in roots and shoots of chickpea plants was measured both at 80 and 130 DAS where as in grains, it was determined at harvest by the method of Ouzounidou et al. [49].

6 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e Bioassay of proline The proline content in roots and shoots of chickpea plants was determined at 80 DAS while in seed it was assayed at 130 DAS. A 500 mg fresh weight of chickpea plant materials prepared separately was homogenized with 10 ml of 3% aqueous sulfosalicylic acid. The resulting homogenate was filtered through Whatman No. 2 filter paper. The filtrates were made upto 20 ml with 3% sulfosalicylic acid and used for the estimation of proline following the method of Bates et al. [50] Statistical analysis The experiment was conducted for two consecutive years under the identical environmental conditions and each treatment was repeated three times. Since the data of the measured parameters obtained were homogeneous, they were pooled and subjected to analysis of variance. The difference among treatment means was compared by high range statistical domain (HSD) using two-way ANOVA at 5% probability level. 3. Results 3.1. Total heavy metal concentration in soils Heavy metals in polluted soils of Ghaziabad near Hindon River and non polluted soils of Faculty of Agricultural Sciences, AMU, Aligarh was determined by atomic absorption spectrophotometer and presented in Table 1. Heavy metal concentrations in polluted soils of Ghaziabad (S1) were (mg g 1 ): cadmium 16.4, chromium 108.5, copper 745, lead 230.5, Nickel and Zinc While Heavy metal concentration in conventional cultivated soils of Faculty of Agricultural Science (S2) were (mg g 1 ): cadmium 0.4, chromium 6.5, copper 18, lead 9.5, nickel 14.7 and zinc Characterization and molecular identification of the strain OSG41 The bacterial strain OSG41 recovered from mustard rhizosphere was found as Gram negative and showed positive reaction for citrate utilization, nitrate reduction, and oxidase test, and could hydrolyze starch and gelatin. Strain OSG41, however, showed a variable carbohydrate utilization property. Based on these and negative results obtained for some other biochemical parameters (data not shown), the bacterial strain OSG41 was presumptively identified to genus level as Pseudomonas. To further identify the strain to species level, 16S rrna gene sequence analysis was performed. The nucleotide sequence of 16S rrna of OSG41 was found to be approximately 1466 bp in size. The sequence of the 16S rrna of this strain was submitted to GenBank (accession number HM222648). A similar search was performed by using the BLASTn programme that indicated that strain OSG41 shared a close relationship with the rrna gene sequence of P. aeruginosa EU (16S: 99% similarity with the reference strain EU037096). Such high similarity values confirmed it as P. aeruginosa. A phylogenetic tree Table 1 Heavy metal content in polluted and conventional soils. Collection site Heavy metal (mg g 1 ) Cadmium Chromium Copper Lead Nickel Zinc S S Here, S1 represents the cultivated field of Ghaziabad, irrigated by polluted water of Hindon River and S2 indicates the conventional cultivated soils irrigated by fresh water of Faculty of Agricultural Science, Aligarh Muslim University, Aligarh. constructed by MEGA4 software, based on 16S rrna partial gene sequence is presented in Fig Chromium tolerance In this study, bacterial strain P. aeruginosa OSG41 isolated from the rhizosphere of mustard, grown at the outskirts of Ghaziabad, India was tested against a range of heavy metals that included Cr þ6, Cd 2þ,Cu 2þ,Ni 2þ and Zn 2þ in order to establish it as a metal tolerant bacterial strain. Bacterial strain in general showed a variable response to each metal but even the lower concentrations of all tested metals were inhibitory to all bacterial strains except strain P. aeruginosa OSG41, which tolerated a considerable amount of heavy metals such as Cr þ6,cd 2þ,Cu 2þ,Ni 2þ and Zn 2, when grown on nutrient agar plates amended with the graded concentrations (0e2000 mgml 1 ) of each metal. The tolerance level of P. aeruginosa OSG41 strain against heavy metals ranged over 1200 mgml 1 for Ni, Cu, and Zn and 1800 mg ml 1 for Cr. Among the selected heavy metals, P. aeruginosa OSG41 strain displayed the maximum tolerance against Cr 6þ. The MTL values of the strain OSG41 against each metal were, however, remarkably high. Other bacterial strains (N ¼ 19) however, showed a remarkably low level (1000 mgml 1 ) of tolerance to Ni (OSG1, OSG2 OSG5, OSG10, OSG17), Cu (OSG3, OSG22, OSG35, OSG40), Pb (OSG4, OSG6, OSG7, OSG15, OSG33, OSG44, OSG50) and Zn while for Cr it was 1500 mg ml 1 (OSG 13, OSG 16, OSG19) Chromium reduction influenced by environmental variables Effect of ph on Cr 6þ reduction The effect of different ph values on P. aeruginosa OSG41 mediated reduction of Cr 6þ was variable (Fig. 2a). Generally, strain OSG41 was found to significantly reduce chromium at ph values ranging from 6 to 8 when culture was grown at 35 2 C in the presence of 100 mg Crml 1 added to NB medium. The maximum reduction (100%) of Cr 6þ was however, observed at ph from 6 to 8 after 120 h incubation by P. aeruginosa OSG41, which was followed by ph 5 (88%) and ph 10 (79%). While comparing the effect of different ph values on chromium reduction by strain OSG41, incubated for variable time periods, a maximum of 3.4 times greater reduction was observed at ph 8 relative to ph 4 after 10 h bacterial growth. Chromium reduction increased significantly with increasing ph and incubation period; 40% reduction at ph 6 (80 mg ml 1 ) and 55% reduction at ph 8 (110 mg ml 1 ) after 40 h of bacterial growth which increased substantially by 81% at ph 6 (162 mgml 1 ) and 83% at ph 8 (166 mgml 1 ) after 80 h incubation of P. aeruginosa OSG41 in the presence of 200 mg Crml 1 added to NB medium Effect of temperature on Cr 6þ reduction Temperature is yet another important factor, which directly affects the growth of bacterial populations and their associated activities including the bio-reduction of hexavalent chromium. Generally, the chromium reduction by the test bacterial strain increased consistently upto 35 C which however, decreased considerably at 40 C. For example, P. aeruginosa OSG41 significantly increased the hexavalent chromium reduction by approximately 20% each at 30 C and 35 C compared to those observed at 25 C which however decreased by about 25% at 40 C relative to those determined at 30 C and 35 C after 120 h at 50 mg Crml 1 (Fig. 2b) Effect of chromate concentration on Cr 6þ reduction Chromium reduction monitored at different initial concentration ranging from 50 to 400 mg ml 1 was greatly influenced by

7 76 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 Fig. 1. Phylogenetic tree constructed from the 16S rrna gene sequence (1466 bp) of Pseudomonas aeruginosa OSG41 (GenBank accession no. HM222648) and related organisms by using Clustal W and MEGA 4 software. P. aeruginosa OSG41 (Fig. 2c). Chromium reduction by the strain P. aeruginosa OSG41 was comparatively maximum at lowest concentration of 50 mg ml 1 ; complete reduction was observed after 60 h at 100 mg Crml 1 where as 200 mg ml 1 of hexavalent chromium was completely reduced after 120 h of bacterial growth Plant growth promoting activities Hexavalent chromium tolerant bacterial strain OSG41 used in this study revealed considerable production of PGP substances when grown both with and without hexavalent chromium (Table 2). The effect of four concentrations (50, 100, 200 and 400 mg ml 1 ) of hexavalent chromium on plant growth promoting traits like IAA, P solubilization, exo-polysaccharide (EPS) production, siderophores production (salicylic acid, 2,3-dihydroxybenzoic acid), HCN and ammonia production by P. aeruginosa OSG41 was variable (Table 2). Generally, the measured traits of strain OSG41 like, EPS production increased with 100 mg Cr ml 1 and then decreased constantly with increasing metal concentrations. Likewise, phosphate solubilization, IAA and siderophores activities progressively decreased with increasing dose of metal, HCN and ammonia production were however, not affected by increasing metal concentration. At 400 mg Crml 1 the PGP activities such as IAA and phosphate solubilizing activity and production of EPS, SA and 2,3-dihydroxybenzoic acid by strain P. aeruginosa OSG41 was decreased by 67, 81, 12, 58 and 53% compared to those observed under metal free medium Plant growth and symbiotic traits In this study, we analyzed the chromium toxicity to chickpea plants and determined the effect of bioinoculant on crop performance in metal treated soil. Chickpea seeds inoculated with plant growth promoting rhizobacterium, P. aeruginosa OSG41 grown in sandy loam soils amended with different concentration of Cr þ6 applied separately, had better growth compared to uninoculated plants (Table 3). P. aeruginosa OSG41 strain used as a bioinoculant with 108 mg g 1 of Cr þ6, increased the dry biomass of roots, and shoots, nodule numbers, nodule biomass and whole plant biomass by 68, 52, 27, 23, and 58% at 80 DAS and 53, 41, 50, 49 and 52 at 130 DAS, respectively compared to the uninoculated control plants. Grain yields recorded for the inoculated plants were increased by 40%, compared to uninoculated control plants. While comparing the effect of bioinoculant (strain OSG41) applied at 216 mg g 1 of Cr þ6 concentrations to those of only chromium amended soil, a

8 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 77 Fig. 2. Effect of ph (a), temperature (b) and initial metal ion concentration (c) on Cr þ6 reduction by strain Pseudomonas aeroginosa OSG41 at different time of incubation in nutrient medium in presence of Cr þ6. maximum increase of 63, 67, 50 and 48%, in root dry mass, shoot dry mass, number of nodules per plant and nodule dry mass at 80 DAS, and root dry mass, shoot dry mass, total dry mass, nodule mass and nodule numbers increased by 71, 60, 62, 36 and 33%, respectively at 130 DAS compared to chromium untreated and uninoculated control plants. The two way ANOVA revealed that the effects of inoculation and chromium was significant (P 0.05) for the measured parameters. The interactive effect of inoculation and chromium was significant for all measured parameter (Table 3) at 80 DAS and 130 DAS except total dry weight (chromium inoculated ¼ ; df ¼ 3) at 80 DAS Chlorophyll and leghaemoglobin content In the absence of bacterial inoculant (P. aeruginosa OSG41), chlorophyll and leghaemoglobin content of chickpea plants measured at 80 DAS decreased consistently with increasing

9 78 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 Table 2 Plant growth promoting (PGP) activities of strain P. aeroginosa OSG41 in the absence and presence of different dose of Cr þ6. IAA a (mg ml 1 ) Phosphate solubilization (mg ml 1 ) EPS b (mg ml 1 ) Siderophores HCN g NH 3 Phenolates (mg ml 1 ) CAS e Agar (mm) FeCl 3 test f SA c 2,3-DHBA d þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ LSD Value indicates the means S.D. of three independent replicates. a Indole acetic acid. b Exo-polysaccharide. c Salicylic acid. d 2, 3-Dihydroxybenzoic acid. e Chrome Azurol S agar. f Ferric chloride test. g Hydrogen cyanide. concentration of Cr þ6 (Table 4). Chromium at 216 mg g 1 decreased the total chlorophyll and leghaemoglobin contents by 50 and 33% respectively, relative to those observed for uninoculated chickpea plants. In contrast, the bioinoculant increased the chlorophyll content by 30% and leghaemoglobin content by 27% at 108 mgcrg 1 soil compared to un-inoculated plants. While comparing the effect of 216 mg Cr g 1 on inoculated and un-inoculated plants, a maximum increase of 32, 38, 35, 15, 31, 35 and 38% in total chlorophyll content, leghaemoglobin, N content in roots and shoots, P content in roots and shoots, and seed protein, respectively was observed over chromium untreated and uninoculated control plants. Two factor ANOVA revealed that the individual effect of inoculation and their interaction (inoculation Cr þ6 ) were significant (P 0.05) for the measured parameters Seed yield and grain protein Seed yield and grain protein assayed at harvest (130 DAS) progressively decreased with increasing concentration of chromium (Table 4). Seed yield and grain protein of inoculated chickpeas increased by 19 and 21%, respectively, relative to uninoculated control plants. In comparison, the chromium reducing strain P. aeruginosa OSG41 increased the seed yield and grain protein by 39 and 30% respectively, at 108 mg Cr g 1 soil, compared to uninoculated chickpea plants grown in soil treated with similar concentration of chromium. While chromium reducing P. aeruginosa (OSG41) enhanced the seed yield and grain protein by 15 and 9% respectively, at 108 mg Crg 1 soil, compared to inoculated but metal free control chickpea plants. Two way ANOVA revealed that the individual effect of inoculation and Cr þ6 and their interaction (inoculation Cr þ6 ) were significant for the measured parameters Chromium uptake Chromium accumulation in roots and shoots of chickpea plants observed at 80 and 130 DAS, increased with increasing concentration of Cr þ6, added to soil. Maximum chromium uptake of 46.9 mgcrg 1 and 26.8 mg Crg 1 was determined at 80 DAS in roots and shoots of uninoculated plants while 25.5 mg Crg 1 and 17.5 mg Crg 1 accumulated in the roots and shoots of inoculated chickpea plants, respectively. Application of bioinoculant (P. aeruginosa OSG41) however, reduced the level of chromium in roots and shoots by 46.6 and 35%, respectively, measured at 80 DAS (Fig. 3) compared to those observed for chickpea plants grown solely in chromium treated soils. At 130 DAS, chromium accumulated in roots and shoots of uninoculated plants were: 72.5 mg g 1 and 33.6 mg g 1 (Fig. 3) while it was 45 mgg 1 (roots) and 20.5 mgg 1 (shoots) of P. aeruginosa inoculated chickpea plants. Interestingly, the inoculant bacterial strain (OSG41) decreased the concentration of chromium in roots and shoots by 37 Table 3 Effect of different dose of hexavalent chromium on growth and nodulation of chickpea grown in soil inoculated with strain OSG41 and without bioinoculant. Treatment Dose rate (mg/g soil) Dry biomass (g/plant) Nodulation Total dry biomass Root Shoot No./plant Nodule biomass (mg/plant) (g/plant) 80 DAS 130 DAS 80 DAS 130 DAS 80 DAS 130 DAS 80 DAS 130 DAS 80 DAS 130 DAS Un-inoculated Control 0.74d 0.88e 2.81d 3.71e 28c 19d 112d 80d 3.66e 4.67d 1 (54) 0.55c 0.78c 2.49c 3.04d 26c 14c 104d 55c 3.14d 3.87d 2 (108) 0.30b 0.52b 1.20b 1.88b 19b 10b 80c 41b 1.58b 2.44b 3 (216) 0.16a 0.29a 0.68a 0.80a 10a 06a 39a 24a 0.87a 1.11a Inoculated Control 1.20f f 4.71h 34d 26e 135e 102f 4.85h 6.18e 1 (54) 1.10e e 4.37f 32d 24e 129e 97e 4.42g 5.74f 2 (108) 0.94d 1.10f 2.74d 3.87f 26c 20d 104d 80d 3.78f 5.05e 3 (216) 0.55c 0.78c 1.70b 2.46c 15a 12b 61b 46b 2.29c 2.28c LSD F value Un-inoculated (df ¼ 1) * * * * 58.43* * * * * * Inoculated (df ¼ 3) * * * * * 62.43* * 97.23* * * Un-inoculate inoculated (df ¼ 3) * 1.67 * * * 0.07* 2.08* * 4.81* * Each value is a mean of three replicates where each replicate constituted tree plants/pot. Mean values with star are significant at P Mean values with different letters are significantly different from each other s according to post hoc Tukey s HSD (P 0.05).

10 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 79 Table 4 Effect of different dose of hexavalent chromium on chlorophyll, leghaemoglobin, N and P content and seed protein in chickpea plants grown in soil inoculated with and without stain P. aeroginosa OSG41. Treatment Dose rate (mg/g soil) Chlorophyll content (mg mg 1 ) Leghaemoglobin content a b Total [mm/(gf.m.)] N content mg mg 1 ) P content (mg mg 1 ) Root Shoot Root Shoot Seed yield g/plant Seed protein (mg/g) Uninoculated Control 0.81g 0.75f 1.56f 0.22a 18c 24b 0.18d 0.21b 2.86e 256d 1 (54) 0.67d 0.59d 1.26d 0.21a 17b 23b 0.15c 0.20b 2.36d 221c 2 (108) 0.56b 0.43b 0.98b 0.16a 15b 20a 0.13b 0.16a 1.69c 204b 3 (216) 0.41a 0.37a 0.78a 0.08a 11a 17a 0.11a 0.13a 0.79a 155a Inoculated Control 0.84h g 0.29a 24d 28c 0.25e 0.27c 3.52g 272f 1 (54) 0.80f 0.72e 1.52f 0.27a 24d 27c 0.19d 0.26c 3.11f 245f 2 (108) 0.71e 0.68e 1.40e 0.22a 20c 22b 0.18d 0.23b 2.80e 220e 3 (216) 0.63c 0.51c 1.15c 0.13a 17b 20a 0.16c 0.20b 1.33b 208d LSD F value Un-inoculated (df ¼ 1) * * * * 17.91* * 56.79* * * Inoculated (df ¼ 3) * * * * 13.76* 65.79* 17.62* * * Un-inoculate inoculated (df ¼ 3) * 27.58* 68.23* * * * 12.78* Each value is a mean of three replicates where each replicate constituted tree plants/pot. Mean values are significant at P Means followed by similar alphabets are not significantly different from each other according to post hoc Turkey s HSD. and 63%, respectively at 130 DAS when chickpea was grown with 216 mgg 1 soil compared to those observed for uninoculated plants. A maximum decrease of 36% in chromium uptake was recorded for chickpea seeds compared to uninoculated chickpeas. While comparing the accumulation of chromium in different plant organs, seeds in general, accumulated more chromium compared to other tested parts of chickpea plants Proline accumulation Proline accumulation in the plant roots and shoots measured at 80 DAS and grains at 130 DAS increased with increasing concentration of Cr þ6, added to soil. A maximum uptake of 46 and 42 mg g 1 fresh weight was recorded in roots and shoots after 80 DAS when plants were grown without bioinoculant while in the presence of bioinoculant, it was 37.5 and mg g 1 fresh weight proline in roots and shoots, respectively, at 216 mg kg 1 chromium amended soil. The application of bioinoculant substantially declined the proline concentration in roots and shoots of chickpea plants by 35 and 18% respectively, at 80 DAS compared to the plants grown in chromium treated soils (Fig. 4). Maximum proline (63.3 mg g 1 fresh weight) accumulation was recorded in grains collected from uninoculated plants while it was 48.2 mg g 1 fresh weight in grains of inoculated chickpea plants Hexavalent chromium reduction The ability to reduce the toxicity of hexavalent chromium has been found in many bacterial species including PGPR such as Pseudomonas fluorescence [56], Enterobacter cloacae [57], Bacillus sp. [2,54] and Staphylococcus capitis [58] under both aerobic and anaerobic conditions. The chromium reduction is however, influenced both by varying ph and temperature [59,60]. Considering the importance of these environmental variables in chromium reduction, we used a bacterial strain P. aeruginosa OSG41 to assess its chromium reducing ability under changing factors. Interestingly, this strain was able to reduce Cr þ6 at a wide range of ph (4e10) and temperature (20e40 C), as also reported by others [2,58]. Furthermore, the growth of P. aeruginosa OSG41 and its reduction ability was assessed at varied Cr þ6 concentration; the overall rate of Cr þ6 reduction decreased with increasing concentration of Cr þ6. However, the rate of Cr þ6 reduction was not inhibited by high levels of chromium during early phase of reduction process. Similar trend was observed by Rahman et al. [61] for Pseudomonas sp. C-171 against different concentration of Cr þ6. However, among bacteria, Arthrobacter sp. has been found more efficient chromium reducing organism than Bacillus sp. [62] while the Arthrobacter oxydans was affected even at a very low (35 mgml 1 ) concentration of Cr þ6 [63]. 4. Discussion 4.1. Identification and characterization The effluents discharged from different industries are reported to contain variable heavy metals including chromium to an extent of toxicity level [51]. When used intentionally in agronomic practices, such effluents are known to cause shifts in microbial communities leading even to the emergence of pollutant (e.g., metal) resistance among bacterial population [52]. Considering the wide spread resistant/reducing traits among bacteria, metal reducing for example chromium reducing plant growth promoting rhizobacteria such as Bacillus sp. [20,53] and Pseudomonas sp. [54,55] have been isolated and characterized from metal contaminated environment. In this study, we isolated metal tolerant bacteria from soil receiving metal containing effluent. Metal tolerant bacterial strain (OSG41) was later on identified as P. aeruginosa (Acc no. HM222648) using biochemical tests and 16S rrna gene sequence characterization and phylogenetic analysis Effect of chromium tolerant strain (OSG41) on chickpea grown in chromium treated soils Application of bacterial inoculant as biofertilizer has been reported to result in better growth and increased yield of different crops [64,65]. Considering both the growth promoting efficiency and metal tolerant ability of the P. aeruginosa OSG41, we designed an experiment to assess the performance of inoculated chickpea in chromium amended soils. The results are discussed in the following section Plant growth and nodulation Generally, the chickpea growth expressed both in terms of dry matter and symbiotic attributes, was higher for inoculated chickpea than for uninoculated ones even when grown in the presence of the varying level of Cr þ6. Like any conventional PGPR, chromium tolerant P. aeruginosa OSG41 used as inoculant in this study caused a substantial increase in the overall performance of chickpea

11 80 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 Fig. 3. Chromium uptake by chickpea plants 80 days after sowing- roots (A) and shoots (B) and at 130 Days in roots (C), shoots (D) and grains (E), in the presence and absence of bio-inoculant P. aeruginosa OSG41. Proline content (mg/g fw) Proline content (mg/g fw) Proline content (mg/g fw) Metal Metal+Bioinoculant Chromium in soil (µgg -1 ) Fig. 4. Proline accumulation in roots (A), shoot (B) at 80 DAS and grains (C) at 130 DAS chickpea in the absence and presence of bio inoculants (P. aeroginosa OSG41) with different dose of chromium amended in soil. The values indicate the mean SD of three replicates. probably due to the synthesis of plant growth regulating substances [3], which are reported to promote root growth directly by stimulating plant cell elongation or cell division [66]. Furthermore, the HCN, and siderophores producing ability of this stain might also have enhanced the root growth and uptake of soil minerals by the host plant as also observed by others [2,3,64]. Taking into consideration the importance of EPS in biological nitrogen fixation (BNF), adaptation of PGPR including rhizobia to environmental stressors and in the process of soil aggregation [67], the strain OSG41 was further tested for its ability to synthesize EPS under in vitro condition. Interestingly, this strain produced a substantial amount of heteropolysaccharides which could directly and/or indirectly affect the growth of plants growing in differentially stressed environment. For example, EPS synthesized by PGPR indirectly stimulate the plant growth by- (i) accelerating microbial activity in the rhizosphere and (ii) enhancing the soil organic content and provide soil aggregate stability with plant roots, and thereby to soil. While directly, EPS has been found to play some key roles in the A B C

12 M. Oves et al. / European Journal of Soil Biology 56 (2013) 72e83 81 physiological processes of plants. For example, EPS has been reported to play important functions in the invasion process, infection thread formation, bacteroid and nodule development during BNF [67]. Other benefits of EPS to bacteria could be protection from pathogens, desiccation, phagocytosis and phage attack [68]. Also, by secreting excess amounts of EPS, PGPR could protect itself from the toxicity of pollutants for example heavy metals by masking the effects of such pollutants [69] and hence, the surviving bacteria inside the polymeric network of EPS could show a considerable metal reducing/accumulating ability. And therefore, by trapping the metals inside the EPS, the PGPR capable of synthesizing EPS are likely to restrict the mobility of metals towards various plants growing in the contaminated soils and, hence, the toxicity of such metals to plants could be avoided. The growth characteristics, the nodules formed on the root system of inoculated chickpea plants raised in soil amended with chromium, was significantly higher compared to those observed for uninoculated plants. Also, the leghaemoglobin content in fresh nodules collected from inoculated chickpea was greater. The improved symbiotic relationship measured as nodule numbers and leghaemoglobin in bacterized legumes host grown in chromium amended soil is a clear suggestive of the rhizobial establishment and survival within chromium polluted soil which despite chromium continued to express its full growth promoting abilities even in the presence of chromium. Similar, increase in the growth of inoculated legumes grown in the presence of metals has been reported by Pajuelo et al. [5] and Wani and Khan [20] Chlorophyll, seed yield and grain protein In the absence of bacterial culture, there was a progressive decrease in the chlorophyll content in fresh foliage measured at 80 DAS and seed yield and grain protein after harvest. In comparison, P. aeruginosa OSG41 increased the measured parameter when chickpea was grown with different concentration of chromium added intentionally to sandy clay loam soils. In a similar study, Tripathi et al. [70] has reported a comparable increase in the chlorophyll content of greengram plants inoculated with siderophore producing and lead and cadmium resistant Pseudomonas putida KNP9 under metal stressed condition. Seed yield and protein of chickpea was increased in presence of bioinoculant strain P. aeruginosa OSG41 under influence of chromium in soil. However, severe adverse effects were recorded when chickpea was grown with sole application of chromium. In a study similar to the present investigation, Chaudhri et al. [71] observed an increase in seed yield of pea (Pisum sativum) when grown in the presence of bioinoculant under the influence of heavy metals for example zinc and copper. While increase in the seed protein content of mustard plant inoculated with Kluyvera ascorbata SUD165 and grown in Zn, Ni and Pb contaminated soil, was observed by Burd et al. [72] Chromium accumulation The uptake of chromium in different organs such as roots and shoots and grains of chickpea plants, grown in variously metal treated soils increased gradually with increase in the concentration of chromium added to soil. Interestingly, plant growth promoting and chromium reducing bacterial strain used as a bioinoculant, however caused a substantial decrease in the concentration of chromium in roots, shoots and seed compared to uninoculated crop. The reduction in chromium concentration in chickpea organs thus exhibited the ability of this strain to protect legume crop against the inhibitory effect of high concentration of hexavalent chromium. Faisal and Hasnain [73] in a similar study have also observed a lesser accumulation of chromium in Ochrobacteriam intermedium inoculated Helianthus annus while Wani et al. [3] reported a reduced uptake of chromium by Mesorhizobium inoculated chickpea plants and concomitantly a significant increase in the overall performance. Similar effects were found on the Bacillus sp. inoculated chickpea plants when grown in chromium stressed soils [20] Proline accumulation The enhanced synthesis of free cellular proteins during various abiotic and abiotic stresses has been found to provide a multifunctional protective role in most plant species [74,75]. For example, Schat et al. [76] reported heavy metal-induced accumulation of free proline in a metal-tolerant and a nontolerant ecotype of Silene vulgaris. After synthesis and accumulation within plants, proline is reported to play adaptive roles for example in plant stress tolerance [77]. Moreover, it also acts as a compatible osmolyte and hence, help to store C and N. Besides these, proline can be a ROS scavenger [78], function as molecular chaperone stabilizing the structure of proteins and help to maintain cytosolic ph and to balance cell redox status. In our study, we also observed a significant accumulation of proline in chickpea plant organs like, roots, shoots and seeds due to high concentration of hexavalent chromium present in soils. The concentration of proline in plant tissues and grains consistently increased with increasing chromium concentration suggesting that the stressor for example chromium here probably has an inducible effect on proline synthesis. A similar increase in the proline level in plants such as lemongrass (Cymbopogon flexuosus) grown in the presence of heavy metals such as lead, mercury and cadmium has been reported [79]. Proline accumulation however, decreased significantly in bacterized chickpea plants grown in soils treated even with higher concentration of chromium (Fig. 4). The decline in proline concentration in various organs/grain of inoculated chickpea plants grown in chromium amended soil could possibly be due to the detoxifying/bioreducing effect of strain OSG41 on hexavalent chromium accumulated inside the plant tissues. However, to the best of our information, there are no reports on how and why proline concentration diminishes even in inoculated plants including chromium tolerant P. aeruginosa OSG41 inoculated chickpeas, when grown in soils treated intentionally with heavy metals (including chromium) or soils already polluted with heavy metals. However, whatever may be reason, the decrease in proline level in OSG41 inoculated chickpea plants as observed in this study is likely to act as an indicator for determining the effect of bioinoculant and consequently to assess the impact of chromium stress on chickpea plants, grown in chromium polluted environment. This study further opens up new vistas to better understand the mechanistic basis of proline decline in inoculated plants grown in polluted environment. 5. Conclusion In the present study, we demonstrate the phytotoxic effect of hexavalent chromium on the performance of chickpea plants, grown in hexavalent chromium treated sandy loam soils. Hexavalent chromium tolerant P. aeruginosa OSG41 when used as seed inoculant, however protected the plants from the toxicity of hexavalent chromium leading thereby to a considerable increase in the dry biomass, nutrient assimilation, seed yield and seed protein. The increased growth of chickpea plants even in the presence of chromium might have been due to several factors like (i) synthesis and release of plant growth promoting substances such as phytohormone, siderophores and EPS by P. aeruginosa OSG41 (ii) chromium reducing ability of the test bacterial strain and (iii) ability of bacterial strain to overcome the proline accumulation in metal stressed