Effect of dietary linseed supplements on ω-3 PUFA content and on IGF-1 expression in broiler tissues
|
|
- Whitney Fleming
- 5 years ago
- Views:
Transcription
1 Vol. 18 (2009): Effect of dietry linseed supplements on ω-3 PUFA content nd on IGF-1 expression in broiler tissues Zinid Sprõkin 1 *, Avo Krus 1, Sirje Kuusik 4, Hrld Tikk 2, Peeter Järv 3, Riin Soidl 3, Aleksnder Lember 2, Helgi Kldmäe 4, Virge Krus 1 nd Mti Rosto 3 1 Chemistry, Institute of Veterinry Medicine nd Animl Science, Estonin University of Life Sciences, Kreutzwldi 1A, Trtu, Estoni 2 Deprtment of Smll Frm Animl nd Poultry Husbndry, Institute of Veterinry Medicine nd Animl Sciences, Estonin University of Life Sciences, Trtu, Estoni 3 Deprtment of Food Sciences, Institute of Veterinry Medicine nd Animl Sciences, Estonin University of Life Sciences, Trtu, Estoni 4 Deprtment of Nutrition, Institute of Veterinry Medicine nd Animl Sciences, Estonin University of Life Sciences, Trtu, Estoni *e-mil: zinid.sprokin@emu.ee The im of this study ws to evlute the effect of ω-3 PUFA-rich linseed-supplemented diet on the ω-6/ω-3 PUFA content nd IGF-I mrna expression in broiler tissues. Broilers (50 of 21 d old nd 90 of 42 d old) were divided into groups ccording to dietry dditives: 1.5% linseed oil (LO), 3.0% LO, 15% linseed cke (LC) nd 30% LC nd to the durtion of modified feeding (1 21, 1 42 nd dys). PUFA content in brest muscles ws ssyed by gs chromtogrphy nd IGF-I mrna content in liver, muscle nd leukocytes ws mesured by one step RT-PCR. The experimentl diets improved the ω-6/ω-3 PUFA rtio through threefold increse in the ω-3 PUFA content in the brest muscle. The chnges in PUFA content were ccompnied by chnges in IGF-1 gene expression levels in tissues. Therefore, both prcrine nd utocrine mnner of IGF-1 ction re likely to be involved. 15% LC t strting period or 1.5% LO in finl diet cn be dvised s optiml for enriching broiler met with ω-3 ftty cids. Key-words: broiler, nutrition, linseed, PUFA, IGF-1 expression Agriculturl nd Food Science Mnuscript received December
2 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression Introduction In the lst severl yers, crdiovsculr diseses hve become more frequent in Estoni nd the rest of world. At the sme time, the consumption of polyunsturted ω-3 ftty cid (ω-3 ftty cids or ω-3 PUFA) hs been shown to reduce the risk of rteriosclerosis. Unfortuntely, s the humn orgnism is unble to produce PUFAs; it is necessry to pick them up from food. The richest source of ω-3 ftty cids is the ft of cold-wter fish s well s flx, hemp, rpe nd linseed (Lopez-Ferrer et l. 2001). However most of the people do not like to use these products directly for food. Moreover oil cpsules rich in ω-3 ftty cids, produced by mny compnies re reltively expensive. The lterntive is to consume niml nd bird products whose orgns re enriched with ω-3 PUFA. The effect of trnsmitted ftty cids from dietry vegetble sources on poultry tissues is known (Lopez-Ferrer et l. 2001, Hämml 2004, Mzzuco et l. 2005, nd Lember et l. 2006). In our previous study, ω-3 ftty cid levels in brest muscle of quils were responding well to chnges in dietry mel composition (Krus et l. 2007). It therefore cn be presumed tht the enrichment of broiler met with ω-3 ftty cid cn be chieved by feeding the birds with linseed (Linum usittissinum) mel. However, the optiml content nd durtion of the supplementtion tht scertin proper development nd growth of broilers re not known t present. We hve sought to nswer these questions by mesuring the mrna level of IGF-1 (insulin like growth fctor-1). It hs been suggested tht higher ω-3 PUFA diets could ffect IGF-1 expression becuse IGF-1 mrna level in liver nd muscle ws depended on the nutrition sttus (Heck et l. 2003, Guernec et l. 2004). Therefore, IGF-1 mrna content in those tissues could give vluble informtion for estblishing optiml linseed diets for enriching broiler muscles tissues with ω-3 ftty cids. In ddition, we lso studied the mechnism of IGF-1 ction: endocrine, prcrine or utocrine, s this too cn be importnt for incresing the ω-3 ftty cid content nd in improving ω-6/ω-3 PUFA rtio in tissues using linseed mel (McMurtry et l. 1997, Beccvin et l. 2001, Heck et l. 2003, Gichetto et l. 2004). Mteril nd Methods Experiments were crried out ccording to Estonin Animl Protection Act ( /RT I 2004). The tril ws conducted t A/S Tllegg in Test groups were locted on privte frms. In totl 140 Ross 208 broilers were studied. As recommended (Tikk nd Lember 2004), broilers were divided into 14 groups (5 mles nd 5 femles in ech) ccording to following dietry dditives: 1.5 nd 3.0% linseed oil, 15 nd 30% linseed cke groups, feeding periods (1 21, 1 42 nd dys) with dditive nutrition plus two control groups (broilers t the ge of 21 d nd 42 d old). The dietry dditives were given with grnulted mixed concentrted feed s the bsl feed contining 21.2% crude protein nd 13.2MJ/kg metbolizble energy. The content of crude ft nd ω-3 PUFA in diet re presented in Tble 1. Tble 1. Content of crude ft nd ω-3 PUFA in diet. Crude ft content ω-3 PUFA in crude ft 36 ω-3 PUFA content in 1 g of feed ω-3 PUFA content in dily (30 g) diet Feeds % % mg mg Linseed cke Linseed oil Mixed feed
3 Vol. 18 (2009): Tissue smples were tken immeditely fter slughter (blood smples were tken from living birds before slughtering), instntly frozen in dry ice nd stored (bout two hours) t 20 C until use. Brest muscles were seprted from the crcss, weighed nd smples were tken for ftty cid nlysis. Ftty cids were determined by gs chromtogrphy in the form of methyl esters on 30 m Crbowx column (for more detils see Krus 2007). The totl content of sturted ftty cids, monounsturted ftty cids, ω-3 polyunsturted ftty cids (PUFA) nd ω-6 PUFAs were clculted (Hämml 2004, Tikk nd Lember 2004, Lember et l. 2006, Krus et l. 2007). Blood ws collected from V. jugulris into disposble non-heprinised test tubes for IGF-1 nlysis nd into EDTA-diN tubes for mrna studies. Leukocyte mrna ws isolted using mrna isoltion kit for bone/blood mrrow (Roche Applied Science). Muscle nd liver smples were disrupted nd homogenized tissue using mortr nd pestle. mrna ws isolted from mg of homogenized using mrna isoltion kit (Roche Applied Science). Anlysis of mrna ws performed with hot strt one-step RT-PCR using LightCycler RNA Mster SYBR Green I kit (Roche Applied Science) nd LightCycler 1.2 Instrument. The PCR protocol ws optimised on the bsis of previous work (Pfffl et l. 2002, Heck et l. 2003, Gichetto et l. 2004, Smolkin nd Krus 2004) nd the Roche LightCycler RNA mster SYBR Green I method mnul. The complimentry DNA sequences were the sme s reported by Pfffl (2001, 2002) nd were pretested in birds (Krus et l. 2007). The primers were synthesised by TIB MOLBIOL ( Primer informtion nd the TIB reference numbers re listed in Tble 2. GAPDH housekeeping gene ws used for IGF-1 mrna quntifiction (Smolkin nd Krus 2004). Crossing points for IGF-1 expression nlysis were estimted using the Fit Points option (LightCycler softwre version 3.5). Sttisticl Anlyses Vrition of polyunsturted ftty cid content in prllel mesurements of feeds hs been negligibly smll (Hämml 2004). Therefore, the pooled smples were used for nlyses nd the vlues in Tble 3 re presented s verges without stndrd devition. Sttisticl nlysis ws performed using SYSTAT 10.0 softwre (SPSS) nd R pckge (version ). The dt of IGF-1 mrna re represented s men ± SD. The homogeneity of vrince for IGF-1 mrna dt ws tested by the one-wy ANOVA. When vrinces were comprble, the differences in IGF-1 gene expression regrding the chnges in consuming durtion or in dditive yield were estimted by T-test with unequl vrinces. One-wy ANOVA dispersion nlysis followed by Tukey posthoc test ws performed to determine the effects of linseed mel on reltionship between IGF-1 mrna levels nd ω-6/ω-3 PUFA rtio. Furthermore Person s correltion coefficients between verges of IGF-1 mrna nd ω-6/ω-3 PUFA rtio were clculted. Differences of p<0.05 were regrded s significnt. Tble 2. The sequences, position nd G/C content of the RT PCR primers Primer Sequence (5 3`) GC (%) GAPDH f CATTGACCTTCACTACATGGT 42.9 GAPDH r ACCCTTCAAGTGAGCCCCAG 60.0 IGF-1 f TCGCATCTCTTCTATCTGGCCCTGT 52.0 IGF-1 r GCAGTACATCTCCAGCCTCCTCAGA 56.0 f = forwrd; r = reverse 37
4 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression Results Effect of dietry linseed dditives on PUFA content in broiler brest muscle The broiler brest muscle ftty cid content dt re presented in Tble 3. We estblished tht in comprison with control group, the linseed diet led to higher content of ω-3 PUFA nd lower ω-6/ω-3 PUFA rtio in broiler brest muscle. In comprison with control group, the experimentl diets on verge incresed ω-3 PUFA content by 3.3-fold nd decresed the rtio of ω-6/ω-3 PUFA pproximtely 3.5-fold. ω -6/ω-3 PUFA rtio reveled flling trend during the first 3 weeks of feeding tril (1 21 dy), but this could be extended by completing the diet. The highest vlues of ω-3 PUFA content nd the lowest rtios of ω-6/ω-3 PUFA in brest muscles were observed with diet contining 30% linseed cke during the lst two weeks of study. In the cse of longer feeding periods (1 42 dy) the trend ws similr linseed cke dditives improved ω-6/ω-3 PUFA rtio in brest muscle even further. Effect of linseed rich diet on IGF-1 expression level in different broilers tissues In order to investigte the effects of linseed mel in broiler, we mesured broiler leukocytes, liver nd brest muscle IGF-1 mrna level t different points in nutrition time (Tble 4). Despite reltively high vrition, the IGF-1 expression level differs quntittively between tissues. The reltive content of IGF-1 mrna in leukocytes tends to decrese in broilers fed with 30% linseed cke in first three weeks (p<0.05) (different upper-cse letters in Tble 4). After strting the diet (1 21 d), slight increse in muscle IGF-1 mrna level ws observed. However, the IGF-1 expression level differed significntly from tht of the control group (p<0.05) in the 15% linseed cke tretment group only. IGF-1 expression in liver during the first 21- dy diet period ws not ffected by linseed mel. However, there ws evidence suggesting decrese in the heptic IGF-1 expression within higher linseed cke group (p<0.05). Compred with the control group, the differences in IGF-1 expression in white blood cells fter longer nutrition period Tble 3. Ftty cid composition (% of totl) in broiler brest muscle t different experimentl diets. Ftty cids Control group 1.5% linseed oil 3.0% linseed oil 15% linseed cke 30% linseed cke SAT MUFA ω PUFA ω PUFA ω-6/ω-3 PUFA Men vlues (n=10) re percent of totl ftty cids: SAT, sum of 14:0, 15:0, 16:0, 17:0, 18:0 nd 20:0. MUFA, sum of 16:1, 17:1, 18:1 nd 20:1. ω-3 PUFA, sum of 18:3n3, 20:5n3, 22:5n3 nd 22:6n3. ω-6 PUFA sum of 18:2n6 nd 20:4n6. 38
5 Vol. 18 (2009): Tble 4. IGF-1 mrna reltive content in broiler leukocytes, liver nd brest muscle Bird group Period of nutrition IGF-1 in blood IGF-1 in liver IGF-1 in muscle Control ±0.3 A 14±25 0.7±0.5 A ±0.1 A 1.3±1.3 A 0.1±0.2 A 1.5% linseed oil group ±1.2 A 0.3± ± ±0.2 b 0.2±0.2 B 0.4±0.4 Ab ±0.6 B 2.7±2.2 B 0.7± % linseed oil group ±0.6 A 0.6± ± ±0.1 b 1.0± ±0.9 B ±0.1 Ab 1.5± ±0.1 Ab 15% linseed cke group ±2.0 A 0.6±0.4 A 7.0±9.3 B ±1.4 b 0.4± ±0.1 A ±0.2 Bb 3.0± ±0.7 A 30% linseed cke group ±0.0 B 0.3±0.2 B 1.0±1.0 b ±0.1 Bb 4.0± ±0.1 A ±0.2 Bb 5.6± ±1.3 A The IGF-1 mrna ws mesured by rel time RT-PCR nd normlized by GAPDH mrna levels. Rtios (rbitrry unit) re mens±sd, by using test of homogeneity of vrinces. The number of birds in groups rnged from n=5 10. Different upper-cse letters designte significnt differences (p<0.05) between different bird groups t the sme nutrition periods. Different lower-cse letters designte significnt differences (p<0.05) between nutrition period t the sme bird group. (1 42 dys) were observed in 30% linseed cke group (p<0.05). In muscle, the highest level of IGF-1 trnscription ws observed in 3.0% linseed oil group (p<0.05). Finlizing feeding with 3.0% linseed oil t dys decresed the IGF-1 mrna content in leukocytes compred with other supplements. Nevertheless, smll effect on IGF-1 nbolism ws found in reltion to others diets (p<0.05). In muscle, the most significnt effect ws observed in 1.5% linseed oil group (p<0.05). Double increse of IGF-1 mrna in liver during the sme period ws not sttisticlly significnt. The effect of linseed dditives on IGF-1 depends on the formultion nd dosing (different lower cse letters in Tble 4). Continuous effects on IGF-1 expression were observed with 1.5% linseed oil diets in blood nd muscle: IGF-1 mrna ws higher in dy nutrition period compred with 1 42 dy period (p<0.05). In cse of other diets, the initil 21-dy feeding hd stronger effect thn 1 42 or dy periods for IGF-1 mrna reltive content in leukocytes. The difference in the IGF-1 mrna content in leukocytes mong femle nd mle broilers t ge of 3 weeks ws detected only in the control group (p<0.05). In other groups no significnt genderbsed differences were found (p>0.1). The effect of linseed rich diet on the reltionship between IGF-1 expression nd ω-6/ ω-3 PUFA rtio We clculted the correltion coefficients between IGF-1 expression level nd ω-6/ω-3 PUFA rtio in broilers (Tble 5). 39
6 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression Tble 5. The correltion between IGF-1 mrna reltive content nd ω-6/ω-3 PUFA rtio in different feeding groups 1. Additive IGF-1 in Blood IGF-1 in Liver IGF-1 in Muscle 1.5% LO % LO (7)** 15 % LC (7)** 30 % LC 0.99* 0.99(8)** 0.55 *p<0.1; **p<0.05; (Person correltion coefficient, p vlue two tiled) 1 the mens from different feeding groups for ω-6/ω-3 PUFA rtio nd IGF-1 mrna ws compred LO = Linseed oil, LC = Linseed cke IGF-1 mrna reltive content 5 1.5% linseed oil % linseed oil b 3 2 b 1 b b b b b b % linseed cke 30% linseed cke b 1 b b b b b b blood liver muscle Fig. 1. The effect of different experimentl diets on the reltionship between bsorbed ω-6/ω-3 PUFA rtio in broiler tissues nd IGF-1 mrna reltive content observed from blood, muscle nd liver tissues. On x-xis there fe five feeding groups: control 1 21 d, control 1 42 d, supplemented 1 21 d, supplemented 1 42 d, supplemented d. The levels of IGF-1 mrna were normlized using GAPDH level. Ech br represents the men ± SEM. b Different letters denote difference (p<0.05) in mens mong diets * Ech br tht hs SEM scled out, does not represent sttisticl importnce The effects of linseed supplements were studied dditionlly by ANOVA dispersion nlysis (Fig. 1). Significnt reltionship between muscle IGF-1 mrna reltive content nd ω-6/ω-3 PUFA rtio ws demonstrted in the cse of 1.5% linseed oil 40
7 Vol. 18 (2009): nd 15% linseed cke diets (p<0.05). It ws confirmed by Person correltion coefficient vlues. IGF-1 mrna level in leukocytes ffected the ω-6/ω-3 PUFA rtio most in cse of 1.5% linseed oil diet during the first three weeks of 42-dy experiment period (p<0.05). Doubled dietry oil groups showed (comprehensive) dditive effect. There ws lso positive correltion between leukocyte IGF-1 mrna nd ω-6/ω-3 PUFA rtio in different linseed oil supplemented diets. Negtive correltion, observed between IGF- 1 gene expression in leukocytes nd ω-6/ω-3 PUFA rtio in cse of 30% linseed cke rich diet (p<0.1) ws in greement with findings from ANOVA control group vlues were ffected by diet (p<0.05). No correltion ws detected between IGF-1 expression in liver nd ω-6/ω-3 PUFA rtio. Discussion We hve demonstrted tht linseed-supplements (Linum usittissinum) cn enhnce the nutritionl qulity of broiler met through better ω-6/ω-3 PUFA rtio which results from threefold ω-3 PUFA content increse in brest muscle. The possibility of ftty cids trnsfer from linseed mel to broiler tissue is in greement with previous studies (Lopez-Ferrer et l. 2001, Hämml 2004, Lember et l. 2006, Tikk nd Lember 2004, Krus et l. 2007). Our findings, tht shorter feeding periods (in our cse dy) re preferble for diets with higher concentrtion of ω-3 PUFA, re supported by literture (Tikk nd Lember 2004, Wldroup nd Wldroup 2005, Lember et l. 2006). In ddition, we estblished tht smller mounts of linseed oil or cke dditives gve better results in the cse of 42-dy diet. In the present study the clculted ω-6/ω-3 PUFA rtio in broiler brest muscles from different experimentl diets ws round the 1:1, which my be ttributed to the optiml metbolism of fts nd proportionl production of different prostglndin s (Wtkins et l. 1997). In order to understnd better the possibility of ftty cids being bsorbed from linseed mel to broiler tissues, nd to explin whether linseed product is preferble for broiler brest muscle enrichment with ω-3 PUFA, we lso studied IGF-1 expression. An ttempt hd lso been previously mde to replce linseed oil with cheper feeds of locl origin e.g. linseed cke (Lember et l. 2006), s oil is expensive nd feeding with it would increse the cost of broiler met. Linseed mel cn ffect the morphology of poultry body nd crcss chrcteriztion (Lopez- Ferrer et l. 2001, Lember et l. 2006) nd IGF-1 (McMurtry et l. 1997, Beccvin et l. 2001, Gichetto et l. 2004, Guernec et l. 2004). Although the effect of high ω-3 PUFA diets on the IGF-1 mrna levels observed in the current study is difficult to interpret, we hve shown tht neither IGF-1 gene expression nor PUFA content re ssocited with sex. This result is similr to the findings of Yun et l. (2005) nd Lember et l. (2006) nd suggests tht PUFA utiliztion could be relted to IGF- 1. Moreover, we found tht despite reltively high vrition in IGF-1 mrna in different tissues, IGF- 1 mrna reltive content depends on the source of linseed oil s well s the feeding regimen. The frction of PUFA bsorbed from the feed into brest muscles ws similr in broilers fed with either 3% linseed oil or 30% linseed cke during the first 3-week period. Wheres IGF-1 expression in liver nd in muscle showed tendency to depend on the diet, significnt difference observed in leukocytes t 30% linseed cke diet showing lower mrna content. It should be lso mentioned tht in totl, IGF-1 mrna content in leukocytes correlted negtively with ω-6/ω-3 PUFA rtio in broilers fed with the elevted linseed cke content. Bsed on the finding tht 30% linseed cke diet during first three weeks of posthtch growth does not led to subsequent enrichment of broiler met with ω-3 PUFA nd on the results by McMurtry et l. (1997) it ppers tht better vilbility of PUFA does not result in elevted IGF-1 expression. Previous reserch hs lso pointed out tht the production nd ction of IGF-1 re selectively influenced by the dietry supply of proteins (Mc- Murtry et l. 1997, Ktsumt et l. 2002), whose deficiency ws ssocited with low circulting con- 41
8 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression centrtion of IGF-1 in blood nd reduced production in liver (cited in Ktsumt et l. 2002). In ddition, plsm IGF-1 concentrtion nd heptic IGF-1 mrna gene expression in young chickens re lowered by feed restriction nd vice verse (cited in Mzucco et l. 2005). The consequences on muscle IGFs mrna levels remin undetermined in chickens (cited in Guernec et l. 2004). In the current study, the IGF-1 mrna level in brest muscle smples of broilers ws mesured s being significntly higher fter initil three weeks consumption of 15% linseed cke, when compred with the control group. The precise role of IGF-1 in the monitoring of nutritionl chnges is still mtter of debte, but we propose tht with low linseed cke consumption in the strting diet, the endocrine mnner of IGF-1 ction ws diminished or chnged very little. Moreover, the significnt effect of 15% linseed cke diet on the reltionship between muscle IGF-1 mrna level nd ω-6/ω-3 PUFA rtio ws confirmed by positive correltion. This reflects tht prcrine nd/or utocrine mechnism of IGF-1 re of higher importnce. Our hypothesis is supported by recent dt: lrger mounts of linseed cke cn depress growth of poultry (Cicern 2004), which is usully ssocited with IGF-1 in endocrine mnner (Yun et l. 2005). Withl (cited in Guernec et l. 2004) hs lso noted tht prcrine IGF-I my be more importnt for de novo ftty synthesis nd muscle growth thn endocrine or circulting IGF-I. As discussed bove, the trend towrds IGF-1 gene expression increse in chicken brest muscle cn be seen not only in three weeks (Yun et l. 2005) but even 4 weeks nd it remined high t 6 weeks of chicken ge (Guernec et l. 2004). In the current study, the elevtion in IGF-1 mrna in broiler brest muscle ws observed t the ge of 42 dys fter 1.5% linseed oil of finl diet (22 42 dy). The influence of low linseed oil diet on reltionship between muscle IGF-1 gene expression nd ω-6/ω-3 PUFA rtio ws even more significnt. Our findings suggest tht IGF-1 ction in prcrine mnner my be situted with ω-6/ω-3 PUFA rtio improvement nd with ω-3 PUFA incresing. The report by Dunn et l. (2003) suggests tht negtive effect of flxseed on IGF-1 mrna content in the longissimus dorsi muscle of cttle my be cused by differences in IGF-1 gene expression, species differences or even differences between tissues. The postulte tht IGF-1 cn ct in prcrine nd utocrine mnner in PUFA bsorption from ω-3 PUFA rich feed is lso confirmed by insignificnt chnges in liver IGF-1 mrna of ll broiler groups. The only significnt differences in heptic IGF-1 mrna, compred with the control group, were observed in broilers fter continuous 42-dy long 1.5% linseed oil consumption. The fct tht the response of chicken to chnges in dietry ft composition is quite rpid (Wldroup nd Wldroup 2005), supports opinion tht using longer period is not necessry nd even not recommended. However, the totl correltion mong heptic IGF-1 mrna nd ω-6/ω-3 PUFA rtio ws negtive. Becuse most of the circulting IGF-1 (bout 80%) is synthesized in liver nd relesed into the bloodstrem, there is positive correltion between heptic IGF-I mrna level nd the plsm IGF-I profile during post-htching development in the chicken (Burnside nd Cogburn 1992). IGF-1 concentrtion in plsm increses with the ge of the birds (Beccvin et l. 2001, Yun et l. 2005) s well s the heptic expression of IGF-I tht peks t 28 dys of ge (Burnside nd Cogburn 1992), nd my even increse until 7 weeks of ge (Gichetto et l. 2004, Yun et l. 2005). Therefore, the slight oscilltions in heptic IGF-1 mrna level observed in the current study suggest tht circulting IGF- 1 cn be minimized or in unchngeble level by consumption of linseed mel for the ims of enriching broiler met with ω-3 PUFA. This suggestion grees with the conclusions by Gichetto et l. (2004): dditionl temporl regultory mechnisms relted to nutrition re involved in modulting the expression of heptic IGF-I mrna nd the consequent increse in plsm IGF-I levels. Additionlly, Ghoshl et l. (2000) hs found tht in rts the mrna level of IGF-1 in liver nd IGF-1 concentrtion in serum re less ffected by the diet contining 20% corn oil (CO) compred with those fed 5% CO. Similrly, in lter report (Mzucco et l. 2005) hve shown tht in white leghorns, 5% linseed oil hd no effect on heptic IGF-1 mrna or circulting IGF-1 fter 5 weeks long diet. Dunn 42
9 Vol. 18 (2009): et l. (2003) hve shown tht flx hs no ffect on circulting IGF-1 concentrtions in cttle. This is in fct somewht surprising, given Wtkins et l. (1997) observtion, tht dietry lipid tretment could positively lter the IGF-1 concentrtion in blood nd liver of the chicken t the ge of 21 dys. However, they used different ftty cid obtined from soybens, menhden nd corn. To the best of our knowledge the level of blood serum IGF-1 tends to decrese nd to suppress quil leukocyte IGF-1 gene expression upon feeding with the mix of linseed nd rpeseed mel s the finl diet (Krus et l., 2007). In contrst, there is smll but significnt increse in IGF-1 gene expression in leukocytes of broilers of the ge of 42 dys, fter three weeks feeding with linseed mel. Therefore, our results do not completely rule out the endocrine mode of IGF-1 ction. In conclusion, the results of the current study demonstrte tht vrious supplements of linseed mel enhnce the nutritionl qulity of broiler met. Under our experimentl conditions, the effect of bsorbed PUFA cids is quntittively relted to IGF-1 gene expression level in severl tissues. However, the exct mechnism through which PUFA ffects IGF-1 gene expression is still not known. We suggest tht prcrine nd/or utocrine functions of IGF-1 re involved in the bsorption of ftty cids from linseed mel. Our results show tht 15% linseed cke t strting period or the 1.5% linseed oil consumption t finl diet results in the enrichment of broiler met with ω-3 PUFA. Acknowledgements. This work ws supported by the pilot project P0091LATD04 nd by the grnt No 5734 from the Estonin Science Foundtion. References Beccvin, C., Chevlier, B., Cogburn, L.A., Simon, J. & Duclos, M. J Insulin-like growth fctors nd body growth in chickens divergently selected for high nd low growth rte. Journl of Endocrinology 168: Burnside, J. & Cogburn, L.A Developmentl expression of heptic growth hormone receptor nd insulin-like growth fctor-i mrna in the chicken. Moleculr nd Cellolr Endocrinology 89: Cicern, M Common flx - Linum usittissimum. Flowers. Cited 01 November Updted 03 Jnury Avilble on the Internet: istri/flor/flowers/linum-usittissimum.htm Dunn, J.D., Johnson, B.J., Kyser, J.P., Wyln, A.T., Sissom E.K. & Drouillrd, J.S Effects of flx supplementtion nd combined trenbolone cette nd estrdiol implnt on circulting insulin-like growth fctor-i nd muscle insulin-like growth fctor-i messenger RNA levels in beef cttle. Journl of Animl Science 81: Ghoshl, A., Xu, Z., Wood, G. & Archer, M Induction of heptic insulin-like growth fctor binding protein-1 (IGFBP-1) in rts by dietry n-6 polyunsturted ftty cids. Proceedings of the Society for Experimentl Biology nd Medicine 225: Gichetto, P., Riedel, E., Gbriel, J., Ferro, M., Di Muro S., Mcri, M. & Ferro, J Heptic mrna expression nd plsm levels of insulin-like growth fctor-i (IGF-I) in broiler chickens selected for different growth rtes. Genetics nd Moleculr Biology 27: Guernec, A., Chevlier, B. & Duclos, M.J Nutrient supply enhnces both IGF-I nd MSTN mrna levels in chicken skeletl muscle. Domestic Animl Endocrinology 26: Heck, A., Metyer, S., Ongbesn, O. M. & Willims, J mrna expression of components of the IGF system nd of GH nd insulin receptors in ovries of broiler breeder hens fed d libitum or restricted from 4 to 16 weeks of ge. Domestic Animl Endocrinology 25: Hämml J Possibilities to enrich poultry products with Ω-3 ftty cids nd influence of these cids to the humn helth. PhD thesis, EAU, Trtu, 143 p. Krus, A., Sprõkin, Z., Tikk, A., Järv, P., Soidl, R., Lember, A., Kuusik, S., Krus, V, Krus., Kldmäe, H., Rosto, M. & Rei, M Effect of Dietry Linseed on Insulin-Like Growth Fctor-1 nd Tissue Ft Composition in Quils. Archiv für Geflügelkunde/Europen Poultry Science 71: Ktsumt, M., Kwkmi, S., Kji, Y., Tkd, R. & Duncey, M. J Differentil Regultion of Porcine Heptic IGF-I mrna Expression nd Plsm IGF-I Concentrtion by Low Lysine Diet. Journl of Nutrition. 132: Lopez-Ferrer, S., Bucells, M.D., Brroet, A.C., Globrt, J. & Grshorn, M.A n-3 Enrichment of Chicken Met. 2. Use of Precursors of Long-Chin Polyunsturted Ftty Acids: Linseed Oil. Poultry Science 80: Lember, A., Tikk, H., Tikk, V., Tmm, K., Krus, A., Kuusik, S. & Rei, M The use of linseed oil in enriching the lipids of hen broiler, quil nd rbbit mel with ω-3 Ftty cids. Agrrtedus/Journl of Agriculturl Sciences XVII: Mzzuco, H., McMurtry, J.P. & Hester, P.Y Effect of moulting nd pre- nd post-molt diets high in omeg-3 ftty cids on circulting insulin-like growth fctor-1 in White Leghorns (bstrct). Poultry Science 84: 110. McMurtry, J.P., Frncis, G.L. & Upton, Z Insulin-like growth fctors in poultry. Domestic Animl Endocrinology 14:
10 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression Pfffl, M Development nd vlidtion of n externlly stndrdised quntittive insulin-like growth fctor-1 RT- PCR using LightCycler SYBR Green I Technology. In: Meuer, S., Wittwer, C. & Nkgwr, K. (eds.). Rpid cycle Rel-Time PCR. Berlin: Springer, p Pfffl, M., Mirchev Georgiev, T., Penchev Georgiev, I., Ontsouk, E., Hgeleit, M. & Blum, J Rel-time RT-PCR quntifiction of the insulin-like growth fctor (IGF)-1, IGF-1 receptor, IGF-2, IGF-2 receptor, insulin receptor, growth hormone receptor, IGF-binding proteins 1, 2 nd 3 in the bovine species. Domestic Animl Endocrinology 24: Smolkin, Z. & Krus, A IGF-1 nd some housekeeping gene cndidtes for rel-time RT-PCR expression studies in cttle. Agrrtedus/Journl of Agriculturl Sciences XV: Tikk, H. & Lember, A Incresing the content of the ω-3-ftty cids in the chicken met. Agrrtedus/Journl of Agriculturl Sciences XV: Wldroup, P.W. & Wldroup, A.L Ftty Acid Effect on Crcss: the Influence of Vrious Blends of Dietry Fts Added to Corn-Soyben Mel Bsed Diets on the Ftty Acid Composition of Broilers. Interntionl Journl of Poultry Sciences 4: Wtkins, B., Shen, C., McMurtry, J., Xu, H., Bin, S., Allen, K. & Seifert, M Dietry Lipids Modulte Bone Prostglndin E2 Production, Insulin-Like Growth Fctor-I Concentrtion nd Formtion Rte in Chicks. The Journl of Nutrition 127: Yun, J.S., Seo, D.S., Kim, W.K. & Ko, Y Expression nd reltionship of the insulin-like growth fctor system with posthtch growth in the Koren Ntive Ogol chicken. Poultry Science 84:
Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationRoughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationTHE INFLUENCE OF MILK THISTLE SEED CAKES ON BROILER CHICKENS PERFORMANCE PARAMETERS
THE INFLUENCE OF MILK THISTLE SEED CAKES ON BROILER CHICKENS PERFORMANCE PARAMETERS STASTNIK ONDREJ 1, DETVANOVA LENKA 2, KARASEK FILIP 1, STENCLOVA HANA 1, KALHOTKA LIBOR 2, PAVLATA LEOS 1, MRKVICOVA
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationGeographical influence on digit ratio (2D:4D): a case study of Andoni and Ikwerre ethnic groups in Niger delta, Nigeria.
Journl of Applied Biosciences 27: 1736-1741 ISSN 1997 5902 Geogrphicl influence on digit rtio (2D:4D): cse study of Andoni nd Ikwerre ethnic groups in Niger delt, Nigeri. Gwunirem, Isrel U 1 nd Ihemelndu,
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationSoybean Hulls as an Alternative Feed for Horses
Animl Industry Report AS 650 ASL R1931 2004 Soyben Hulls s n Alterntive Feed for Horses Josie Booth Iow Stte University Howrd Tyler Iow Stte University Peggy Miller-Auwerd Iow Stte University Jenette Moore
More informationShamsuddin M. Mamun, U. Focken, G. Francis and K. Becker University of Hohenheim, Stuttgart, Germany. September 2004
A GROWTH PERFORMANCE AND METABOLIC RATES OF GENETICALLY IMPROVED AND CONVENTIONAL STRAINS OF NILE TILAPIA, OREOCHROMIS NILOTICUS (L.) Shmsuddin M. Mmun, U. Focken, G. Frncis nd K. Becker University of
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationThe Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers
Beef Reserch Report, 2000 Animl Science Reserch Reports 2001 The Effects of High-Oil Corn or Typicl Corn with or without Supplementl Ft on Diet Digestibility in Finishing Steers Crig R. Belknp Iow Stte
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationComparison of three simple methods for the
J. clin. Pth. (1967), 2, 5 Comprison of three simple methods for the ssessment of 'free' thyroid hormone T. M. D. GIMLETTE1 From the Rdio-Isotope Lbortory, St. Thoms's Hospitl, London SYNOPSIS A dilysis
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationA. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5
Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationReport of the Conference on Low Blood
1046 Report of the Conference on Low Blood Cholesterol: Mortlity Associtions Dvid Jcobs, PhD; Henry Blckburn, MD; Millicent Higgins, MD; Dwyne Reed, MD, PhD; Hiroysu Iso, MD; Grdner McMilln, MD, PhD; Jmes
More informationXII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV
XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies
More informationDigestible Sulfur Amino Acid Requirement of Male Turkeys During the 12 to 18 Week Period
Interntionl Journl of Poultry Science (): 8-, 00 Asin Network for Scientific Informtion 00 Digestible Sulfur Amino Acid Requirement of Mle Turkeys During the to 8 Week Period D. T. Moore, K. Bker, K. Thompson,
More informationEffect of Field Pea Replacement and Yucca schidigera extract on weaning transition growth and feedlot performance
Effect of Field Pe Replcement nd Yucc schidiger extrct on wening trnsition growth nd feedlot performnce D.G. Lndblom 1 nd J. Pennington 2 1 Dickinson Reserch Extension Center, Dickinson, ND 2 Dickinson
More informationScientific research on the biological value of olive oil
Scientific reserch on the biologicl vlue olive oil Cov F.G. Ally M. (ed.). L' économie de l' olivier Pr : CIHEAM Options Méditerrnéennes : Série Etudes; n. 1988-V 1988 pges 149-152 Article vilble on le
More informationSummary. Effect evaluation of the Rehabilitation of Drug-Addicted Offenders Act (SOV)
Summry Effect evlution of the Rehbilittion of Drug-Addicted Offenders Act (SOV) The Rehbilittion of Drug-Addicted Offenders Act (SOV) ws lunched on April first 2001. This lw permitted the compulsory plcement
More informationEffect of Various Doses of Cinnamon on Lipid Profile in Diabetic Individuals
Pkistn Journl of Nutrition 2 (5): 312-319, 2003 Asin Network for Scientific Informtion 2003 Effect of Vrious Doses of Cinnmon on Lipid Profile in Dibetic Individuls Alm Khn, Mhpr Sfdr nd Mohmmd Muzffr
More informationEffects of Dietary Protein and Energy on Growth Performance and Carcass Characteristics of Betong Chickens (Gallus domesticus) During Growing Period
Interntionl Journl of Poultry Science 9 (5): 468-472, 2010 ISSN 1682-8356 Asin Network for Scientific Informtion, 2010 Effects of Dietry Protein nd Energy on Growth Performnce nd Crcss Chrcteristics of
More informationReducing the Risk. Logic Model
Reducing the Risk Logic Model ETR (Eduction, Trining nd Reserch) is nonprofit orgniztion committed to providing science-bsed innovtive solutions in helth nd eduction designed to chieve trnsformtive chnge
More informationThe Effects of Small Sized Rice Bowl on Carbohydrate Intake and Dietary Patterns in Women with Type 2 Diabetes
Originl Article doi: 10.4093/kdj.2010.34.3.166 pissn 1976-9180 eissn 2093-2650 The Effects of Smll Sized Rice Bowl on Crbohydrte Intke nd Dietry Ptterns in Women with Type 2 Dibetes Hee-Jung Ahn 1, *,
More informationEffects of Dietary Methionine-Supplementation on the General Performance and Economic Value of Rahmani Lambs
Avilble online t www.scinzer.com ISSN 0000-0000 Effects of Dietry Methionine-Supplementtion on the Generl Performnce nd Economic Vlue of Rhmni Lmbs A. S. El-Thwy 1 *, A. M. Ismeil 2, H. A. Ahmed 3 1. Deprtment
More informationThe Ever Changing World of Feed Additives in The Poultry Industry
The Ever Chnging World of Feed Additives in The Poultry Industry B. S. Lumpkins nd G.F. Mthis Southern Poultry Reserch Inc. Athens, GA, USA Outline Southern Poultry Reserch Impct of ethnol production of
More informationEffects of phospholipids and HUFA levels on ontogene7c development and performance of pikeperch (Sander lucioperca) larvae
Effects of phospholipids nd HUFA levels on ontogene7c development nd performnce of pikeperch (Snder lucioperc) lrve DTU Aqu, FUNDP, ULPGC ACM 2017 Brcelon, Jnury 2017 The outcome of the experiments should
More informationEffects of Atropine and Gastric Inhibitory Polypeptide on Hepatic Glucose Uptake and Insulin Extraction in Conscious Dogs
ffects of Atropine nd Gstric nhibitory Polypeptide on Heptic Glucose Uptke nd nsulin xtrction in Conscious Dogs Zvi Chp, Toshihiko shid, Jesse Chou, Robert Lewis, Crig Hrtley, Mrk ntmn, nd Jmes B. Field
More informationDIET HISTORY AND BIRTH WEIGHT RELATIONSHIP AMONG SAUDI PREGNANT WOMEN
Originl Article DIET HISTORY AND BIRTH WEIGHT RELATIONSHIP AMONG SAUDI PREGNANT WOMEN Ahmed A. Al-Shoshn 1 ABSTRACT Objective: The im of this study ws to see the reltionship between food intke pttern nd
More informationAnalysis of Regulatory of Interrelated Activity of Hepatocyte and Hepatitis B Viruses
Interntionl Journl of Biomedicl Mterils Reserch 8 6(): -7 http://www.sciencepublishinggroup.com/j/ijbmr doi:.648/j.ijbmr.86. ISSN: 33-756 (Print) ISSN: 33-7579 (Online) Anlysis of Regultory of Interrelted
More information2. Hubs and authorities, a more detailed evaluation of the importance of Web pages using a variant of
5 Web Serch Outline: 1. Pge rnk, for discovering the most ëimportnt" pges on the Web, s used in Google. 2. Hubs nd uthorities, more detiled evlution of the importnce of Web pges using vrint of the eigenvector
More informationCommunity. Profile Big Horn County. Public Health and Safety Division
Community Helth Profile 2015 Big Horn County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl
More informationJie Luo, 1 Feiruo Huang, 1 Chenglin Xiao, 1 Zhengfeng Fang, 1 Jian Peng, 1 and Siwen Jiang Introduction
BioMed Reserch Interntionl Volume 2013, Article ID 905918, 9 pges http://dx.doi.org/10.1155/2013/905918 Reserch Article Responses of Growth Performnce nd Proinflmmtory Cytokines Expression to Fish Oil
More informationEffect of Mannan Oligosaccharide (Bio-Mos) Addition With and Without Zinc Oxide on Performance and Immunocompetence of Weanling Pigs
Effect of Mnnn Oligoscchride (Bio-Mos) Addition With nd Without Zinc Oxide on Performnce nd Immunocompetence of Wenling Pigs E. Dvis, C. Mxwell, B. de Rods, nd D. Brown 1 Story in Brief An experiment involving
More informationAnalysis of alternatives for insulinizing patients to achieve glycemic control and avoid accompanying risks of hypoglycemia
284 Anlysis of lterntives for izing ptients to chieve glycemic control nd void ccompnying risks of hypoglycemi JIALIN GAO 1,2*, QIANYIN XIONG 1,2*, JUN MIAO 1*, YAO ZHANG 2,3, LIBING XIA 1, MEIQIN LU 1,
More informationProducts for weaners Benzoic acid or the combination of lactic acid and formic acid
Products for weners Benzoic cid or the comintion of lctic cid nd formic cid Tril report no.: 490 Novemer, 000 Hnne Mrio, Lrs Egelund Olsen, Bent Borg Jensen 1 nd Nuri Miquel 1 The Ntionl Committee for
More informationFat intake in patients newly diagnosed with type 2 diabetes: a 4-year follow-up study in general practice
Originl ppers Ft intke in ptients newly dignosed with type 2 dibetes: 4-yer follow-up study in generl prctice Floris A vn de Lr, Eloy H vn de Lisdonk, Peter L B J Lucssen, J M H Tigchelr, Sski Meyboom,
More informationThe Journal of Physiology
J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler
More informationFERTILITY EFFECTS OF SODIUM FLUORIDE IN MALE MICE
128 Fluoride Vol. 33 No. 3 128-134 2000 Reserch Report FERTILITY EFFECTS OF SODIUM FLUORIDE IN MALE MICE Ahmed Elbetieh, Hom Drmni, Ahmd S Al-Hiyst b Irbid, Jordn SUMMARY: Sexully mture mle Swiss mice
More informationResponse of Commercial Egg-Type Pullets to Diets Varying in Protein and Energy Content in Arid Hot Climate
Interntionl Journl of Poultry Science 8 (9): 90-98, 2009 ISSN 682-8356 sin Network for Scientific Informtion, 2009 Response of Commercil Egg-Type Pullets to Diets Vrying in Protein nd Energy Content in
More informationCommunity. Profile Powell County. Public Health and Safety Division
Community Helth Profile 2015 Powell County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationEffect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows
Ksetsrt J. (Nt. Sci.) 37 : 145-149 (2003) Effect of Orl Administrtion of Propylene Glycol on Serum Glucose Concentrtions in Periprturient Diry Cows Theer Rukkwmsuk, Nrongpol Petploi, Ing-orn Preechnvinit,
More informationIntroduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010
Introduction Lnce Bumgrd Associte Professor Ntive of southwest Minnesot BS: U of Minnesot MS: U of Minnesot Advisor: Brin Crooker Thesis: Effects of genetic selection for milk yield on somtotropin prmeters
More informationThe Effects of Diet Particle Size on Animal Performance
MF-2050 Feed Mnufcturing Feed Mnufcturing Cerel grins re the primry energy source in swine nd poultry diets. Therefore, not only must producers be concerned bout the composition of the grin, but lso how
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationCommunity. Profile Yellowstone County. Public Health and Safety Division
Community Helth Profile 2015 Yellowstone County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl
More informationCommunity. Profile Anaconda- Deer Lodge County. Public Health and Safety Division
Community Helth Profile 2015 Ancond- Deer Lodge County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12
More informationNutrition Guide. National Swine. Protein and Amino Acid Sources for Swine Diets. Introduction. Objectives. Amino Acid Sources
Ntionl Swine Nutrition Guide Protein nd Amino Acid Sources for Swine Diets Introduction Authors Mrci C. Shnnon, University of Missouri Gry L. Allee, University of Missouri Reviewers R. Den Boyd, The Hnor
More informationTHE KIDNEY AND THE CONCEPT OF CLEARANCE*
THE KIDNEY AND THE CONCEPT OF CLEARANCE* I. The Antomy of the Mmmlin Kidney A. Gross ntomy: 1. The outer region of the kidney = the CORTEX 2. Inner region = the MEDULLA 3. The re where ll of the urine
More informationCommunity. Profile Lewis & Clark County. Public Health and Safety Division
Community Helth Profile 2015 Lewis & Clrk County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl
More informationCommunity. Profile Missoula County. Public Health and Safety Division
Community Helth Profile 2015 Missoul County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk
More informationEstimates of Methionine and Sulfur Amino Acid Requirements for Laying Hens using Different Models
Brzilin Journl of Poultry Science Revist Brsileir de Ciênci Avícol ISSN 1516-635X Jul - Sept 2012/ v.14 / n.3 / 159-232 Estimtes of Methionine nd Sulfur Amino Acid Requirements for Lying Hens using Different
More informationDose-dependent effect of daptomycin on the artificial prolongation of prothrombin time in coagulation abnormalities: in vitro verification
Hshimoto et l. BMC Phrmcology nd Toxicology (2017) 18:74 DOI 10.1186/s40360-017-0180-3 RESEARCH ARTICLE Open Access Dose-dependent effect of dptomycin on the rtificil prolongtion of prothrombin time in
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationInvasive Pneumococcal Disease Quarterly Report July September 2018
Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.
More informationThe Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes
The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend
More informationBMI and Mortality: Results From a National Longitudinal Study of Canadian Adults
nture publishing group BMI nd Mortlity: Results From Ntionl Longitudinl Study of Cndin Adults Hether M. Orpn 1, Jen-Mrie Berthelot 2,3, Mrk S. Kpln 4, Dvid H. Feeny 5,6, Bentson McFrlnd 7 nd Nncy A. Ross
More informationPreliminary investigation of antimicrobial effects of pomegranate (Punica granatum L.) leathery exocarp extract against some serious phytopathogens
Preliminry investigtion of ntimicroil effects of pomegrnte (Punic grntum L.) lethery exocrp extrct ginst some serious phytopthogens Elshfie H.S. 1,*, Skr S.H. 2, Mng S.M. 1, Frisullo S. 3, Cmele I. 1 1
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationMultiphase feeding program for broilers can replace traditional system
210 Scienti Agricol http://dx.doi.org/10.1590/0103-9016-2014-0207 cn replce trditionl system Lucino Huschild*, Cmil Ferreir Delfim Bueno, Aline Remus, Jqueline de Pul Gobi, Renn Di Giovnni Isol, Nilv Kzue
More informationSandra Grbić Vladimir Lukić Ivan Kovačević Jelena Parojčić Zorica Đurić
Deprtment of Phrmceuticl Technology nd Cosmetology Fculty of Phrmcy University of Belgrde An investigtion into the possibilities nd limittions of in silico bsorption modeling: GstroPlus TM simultion of
More informationBeetroot juice and exercise: pharmacodynamic and dose-response relationships
J Appl Physiol 115: 325 336, 2013. First published My 2, 2013; doi:10.1152/jpplphysiol.00372.2013. Beetroot juice nd exercise: phrmcodynmic nd dose-response reltionships Lee J. Wylie, 1 Jmes Kelly, 1 Stephen
More informationReplacing Fish Meal with Soybean Meal and Brewer s Grains with Yeast in Diets for Australian Red Claw Crayfish, Cherax quadricarinatus
Replcing Fish Mel with Soyben Mel nd Brewer s Grins with Yest in Diets for Austrlin Red Clw Cryfish, Cherx qudricrintus Lur A. Muzinic*, Kenneth R. Thompson, & Crl D. Webster Introduction Soyben mel (SBM)
More informationInfluence of $-Adrenergic Agonist (Metaproterenol) and Lysine on Growth, Carcass Quality in Broiler Chickens
Interntionl Journl of Poultry Science 5 (11): 1082-1086, 2006 ISSN 1682-856 Asin Network for Scientific Informtion, 2006 Influence of $-Adrenergic Agonist (Metproterenol) nd Lysine on Growth, Crcss Qulity
More informationScholarly Research Exchange
Scholrly Reserch Exchnge Volume 9 Article ID 7959 doi:1.3814/9/7959 Reserch Article Different Dietry Levels of Protein to Lipid Rtio Affected Digestive Efficiency, Skeletl Growth, nd Muscle Protein in
More informationCommunity. Profile Carter County. Public Health and Safety Division
Community Helth Profile 2015 Crter County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk
More informationStudy of some Blood Parameters of Broilers Fed on Ration Containing Fish Oil
Journl of Biology, Agriculture nd Helthcre ISSN 2224-3208 (Pper) ISSN 2225-093X (Online) Study of some Blood Prmeters of Broilers Fed on Rtion Contining Fish Oil Ysser Jml Jmeel 1 * Ali Mhdi Shi 2 1. Deprtment
More informationSupplementary Online Content
Supplementry Online Content Rieckmnn N, Kronish IM, Shpiro PA, Whng W, Dvidson KW. Serotonin reuptke inhibitor use, depression, nd long-term outcomes fter n cute coronry : prospective cohort study. JAMA
More informationRelationship between food availability, glycerol and glycogen levels in lowtemperature challenged rainbow smelt Osmerus mordax
866 The Journl of Experimentl Biology, 866-87 Published by The Compny of Biologists 7 doi:.4/jeb.749 Reltionship between food vilbility, glycerol nd glycogen levels in lowtemperture chllenged rinbow smelt
More informationJournal of Hainan Medical University 2017; 23(2): Journal of Hainan Medical University.
Journl of Hinn Medicl University 2017; 23(2): 151-155 151 Journl of Hinn Medicl University http://www.hnykdxxb.com Reltionship between DEXA bone minerl density mesurement results nd serum cytokines s well
More informationDietary Characteristics of Hong Kong Young Children: Implications for Nutrition Education
HK J Peditr (new series) 2006;11:255-262 Dietry Chrcteristics of Hong Kong Young Children: Implictions for Nutrition Eduction LL HUI, EAS NELSON Abstrct Key words Objectives: To exmine the dietry pttern
More informationEvaluation of Using Different Levels and Sources of Oil in Growing Japanese Quail Diets
Americn-Eursin J. Agric. & Environ. Sci., 3 (4): 577-582, 2008 ISSN 1818-6769 IDOSI Publictions, 2008 Evlution of Using Different Levels nd Sources of Oil in Growing Jpnese Quil Diets A.T. El Ymny, Hewid
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationEstimating the impact of the 2009 influenza A(H1N1) pandemic on mortality in the elderly in Navarre, Spain
Rpid communictions Estimting the impct of the influenz pndemic on mortlity in the elderly in Nvrre, Spin J Cstill (jcstilc@nvrr.es) 1, J Etxeberri 1, E Ardnz 1, Y Floristán 1, R López Escudero 1, M Guevr
More informationStudies of the Mortality of Atomic Bomb Survivors, Report 14, : An Overview of Cancer and Noncancer Diseases
RADIATION RESEARCH 177, 229 243 (2012) 0033-7587/12 $15.00 Ó2012 by Rdition Reserch Society. All rights of reproduction in ny form reserved. DOI: 10.1667/RR2629.1 Studies of the Mortlity of Atomic Bomb
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationMeat Science 84 (2010) Contents lists available at ScienceDirect. Meat Science. journal homepage:
Met Science 84 (2010) 578 584 Contents lists vilble t ScienceDirect Met Science journl homepge: www.elsevier.com/locte/metsci Feeding co-extruded flxseed to pigs: Effects of durtion nd feeding level on
More information