Shu-Lu Chung, 1 Kwok-Sui Leung, 1,2 Wing-Hoi Cheung 1,2

Transcription

1 Low-Magnitude High-Frequency Vibration Enhances Gene Expression Related to Callus Formation, Mineralization and Remodeling During Osteoporotic Fracture Healing in Rats Shu-Lu Chung, 1 Kwok-Sui Leung, 1,2 Wing-Hoi Cheung 1,2 1 Department of Orthopaedics & Traumatology, The Chinese University of Hong Kong, Shatin, Hong Kong, SAR, China, 2 Translational Medicine Research & Development Center, Institute of Biomedical and Health Engineering, Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences, Shenzhen, China Received 22 July 2014; accepted 15 July 2014 Published online 17 August 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI /jor ABSTRACT: Low magnitude high frequency vibration (LMHFV) has been shown to improve anabolic and osteogenic responses in osteoporotic intact bones and during osteoporotic fracture healing; however, the molecular response of LMHFV during osteoporotic fracture healing has not been investigated. It was hypothesized that LMHFV could enhance osteoporotic fracture healing by regulating the expression of genes related to chondrogenesis (Col-2), osteogenesis (Col-1) and remodeling (receptor activator for nuclear factor- k B ligand (RANKL) and osteoproteger (OPG)). In this study, the effects of LMHFV on both osteoporotic and normal bone fracture healing were assessed by endpoint gene expressions, weekly radiographs, and histomorphometry at weeks 2, 4 and 8 post-treatment. LMHFV enhanced osteoporotic fracture healing by up-regulating the expression of chondrogenesis-, osteogenesis- and remodeling-related genes (Col-2 at week 4 (p ¼ 0.008), Col-1 at week 2 and 8 (p < 0.001and p ¼ 0.008) and RANKL/OPG at week 8 (p ¼ 0.045)). Osteoporotic bone had a higher response to LMHFV than normal bone and showed significantly better results as reflected by increased expression of Col- 2 and Col-1 at week 2 (p < for all), larger callus width at week 2 (p ¼ 0.001), callus area at week 1 and 5(p < 0.05 for all) and greater relative area of osseous tissue (p ¼ 0.002) at week 8. This study helps to understand how LMHFV regulates gene expression of callus formation, mineralization and remodeling during osteoporotic fracture healing. ß 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 32: , Keywords: vibration; gene expression; fracture healing; osteoporosis Osteoporosis is a major health problem affecting elderly population worldwide. It is characterized by microarchitectural deterioration of bone structure, low bone mineral density, increased fragility and susceptibility to fracture. 1 Although osteoporotic fracture healing undergoes the same regenerative process as normal fracture healing, management of osteoporotic fractures is difficult due to the problem of poor bone quality. The occurrence of complications, such as nonunion and mal-union, as well as the rates of morbidity and mortality are high 2 in osteoporotic fractures. Moreover, studies showed that osteoporosis impaired fracture healing by delaying mechanical property restoration, 3 impairing osteoprogenitor cell recruitment and differentiation 4 as well as angiogenesis. 5 Furthermore, the decreased responsiveness of osteoporotic bones to mechanical stimulations 6 and the altered calcium homeostasis, hormones and reduced estrogen levels with aging could reduce the bone osteogenic capacity. 7 Therefore, enhancement of osteoporotic fracture healing is of great importance to clinicians and researchers. Low-magnitude high-frequency vibration (LMHFV) was introduced as an noninvasive biophysical intervention providing whole-body vibration for osteoporosis treatment 8,9 through enhancing bone mineral density, 8,10 blood circulation, 11 muscle functions and balance control in non-fractured subjects. 12,13 Some Grant sponsor: Direct Grant from the Chinese University of Hong Kong; Grant number: Correspondence to: Wing-Hoi Cheung, (T: ; F: ; louis@ort.cuhk.edu.hk) # 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. studies showed that vibration (90 Hz, 4 g peak-to-peak acceleration) regulated gene expressions of osteogenic markers including osteocalcin and alkaline phosphatase in fractured ovariectomized rats. 14 Also, LMHFV (35 Hz, 0.3 g peak-to-peak acceleration) enhanced osteoporotic fracture healing with improved callus formation, mineralization, remodeling, mechanical restoration and angiogenesis in osteoporotic and normal fracture healing in rat models However, the underlying molecular responses of osteoporotic fractured bones to LMHFV have not yet been investigated. In this study, we hypothesized that LMHFV could enhance osteoporotic fracture healing through upregulations of the genes related to chondrogenesis, osteogenesis and remodeling. The objective of this study was to investigate the effects of LMHFV on ovariectomy-induced osteoporotic fracture healing, as compared with age-matched normal one, with reference to gene expression profiles, radiography and histomorphometry. The results could provide a better understanding of the interaction between the effects of LMHFV and the molecular responses of osteoporotic fractured bones during the healing process, which has not yet been investigated. METHODOLOGY The Animal Experimentation Ethics Committee of the Chinese University of Hong Kong has approved the care and experimental protocol of this study (Ref. no: 09/001/DRG). All surgeries were performed under katemine (20 60 mg/kg) and xylazine (2.5 mg/kg) anesthesia. Temgesic (0.1 ml/100 g) was given 15 min before surgery and for three consecutive days after surgical procedures to relieve pain and all efforts were made to minimize suffering. 1572

2 LMHFV ENHANCES OSTEOPOROTIC FRACTURE HEALING 1573 Groupings A total of 144 female Sprague Dawley (SD) rats were used and housed with 12-h light-night cycle. After one week of acclimatization, the rats were randomly assigned into four different groups: (1) sham control (Sham-C), (2) sham vibration (Sham-V), (3) ovariectomized control (OVX-C) and, (4) ovariectomized vibration (OVX-V). Establishment of Osteoporotic Rats Seventy-two six-month-old female SD rats were randomly selected for the bilateral OVX procedures. 15,19 After three months, osteoporosis was confirmed by the reduction of bone mineral density (BMD) at right femoral head and fifth lumbar vertebra using high-resolution peripheral quantitative computed tomography (XtremeCT, Scanco Medical, Brüttisellen, Switzerland). The mean values of decreases in BMD at right femoral head and trabecular thickness (Tb.Th) were found to be % (p < 0.001) and % (p < 0.001) respectively. For the sham groups, same surgical procedures without the excision of ovaries were performed. Creation of Rat Femoral Fracture Model A closed femoral fracture model was created based on previous established protocol. 15,18,20,21 Under anesthetization with katemine (20 60 mg/kg) and xylazine (2.5 mg/kg), a 1.2 mm 28 mm Kirschner wire (Sanatmetal Ltd, Hungary) was inserted into the medullary canal of the femur as an internal fixation. A 500 g steel weight was dropped with direct impact at the femur midshaft from a height of 35 cm. The transverse fracture made through this three-pointbending was confirmed by anteroposterior (AP) and lateral radiography postoperatively. All procedures were performed by the same experienced orthopaedic surgeon for consistency. LMHFV Treatment LMHFV treatment was started five days post-surgery when the rats recovered and began full weight-bearing and walking. A vibration platform with vertical vibration of 35 Hz and a peak-to-peak magnitude of 0.3 g (g ¼ gravitational acceleration) 15,18 was used. Rats were allowed to stand on the platform for 20 min/day and 5 days/week. The control groups (Sham-C and OVX-C) were given the same treatment regime with the platform switched off. At 2, 4 and 8 weeks posttreatment, six rats from each group were euthanized, and the femora were immediately harvested for gene expression assessment. Another six rats from each group were euthanized for radiographic and histomorphometric assessments. Total RNA Extraction and Gene Expression Analysis Gene expression profiles of Collagen type II (Col-2), Collagen type I, (Col-1), receptor activator for nuclear factor- k B ligand (RANKL) and osteoprotegerin (OPG) were studied. 22 Total RNA extraction, reverse transcription and real-time PCR were performed according to our established protocol. 23 Briefly, two millimeters proximal and distal to the fracture line (total 4 mm of the callus) of each frozen femur specimen was harvested and crushed into powder by mortar and pestle at 80 C liquid nitrogen. Tissues retrieved from each femur were transferred to an Eppendorf tube for further total RNA extraction using a commercially available total RNA extraction kit (RNeasy Kit, Qiagen GmbH, Hilden, Germany) following the manufacturer s instructions. The quality and quantity of the RNA extract was controlled by spectrophometric analysis at 260 nm (Nanodrop 2000, Thermo Fisher Scientific Inc., Wilmington, USA). The primer pairs used in real-time PCR are shown in Table 1. The products were confirmed by melting curve analysis, and the relative gene expression levels were normalized with that of a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). 24 Radiographic Analysis For routine monitoring of fracture healing, AP and lateral radiographs (Faxitron X-ray system model 43855C, Wheeling, IL) were taken weekly according to our established protocol. 15,18 Qualitative analysis to determine the bridging rate of each fracture was performed by two independent and blinded orthopaedic surgeons using a standard scoring system to evaluate the healing status from the x-ray films. 20 Quantitative analysis was also performed to determine the callus width (CW, the maximum width of callus minus the width of the cortical bone and medullary cavity at the diaphysis) and the callus area (CA, the size of radio-opaque area of callus) by Metamorph Image Analysis System (Universal Imaging Corporation, Downingtown, PA) according to our established protocol. 18 Histomorphometric Analysis Six femora with the entire callus from each sample were decalcified, cut into halves along the mid-sagittal plane and were embedded in paraffin blocks. For quantitative analysis, sections cut longitudinally (7 mm in thickness) were stained with Hematoxylin-Eosin (H&E). 20 Twelve sections (six from each half) of each specimen were used for evaluation. The region of interest (ROI) covering 3.8 mm proximal and distal to the fracture line (total 7.6 mm) was analyzed based on our previous protocol. 18,20 The external callus tissues within the ROI were quantified as the total callus area (CAr) while the cartilaginous tissues area (CgAr) and the osseous tissues area (OTAr) were defined manually (Metamorph Image Analysis System, University Imaging Corporation). 20 The Table 1. Primer Sequences, Generated Amplicon Size, Melting (Tm) and Annealing Temperature (Ta) of the Six Candidate Genes (including GAPDH) Gene Forward Primer Tm( C) Reverse Primer Tm( C) Product Size (bp) Col-1 TTGACCCTAACCAAGGATGC 57.3 CACCCCTTCTGCGTTGTATT Col-2 GTACACTGCCCTGAAGGATG 59.4 ATTGTGTTGTTTTGGGGTTG RANKL CCAGCATCAAAATCCCAAGT 55.3 TGAAAGCCCCAAAGTACGTC OPG GAATGGTCACTGGGCTGTTT 57.3 CTGGCAGCTTTGCACAATTA GAPDH AACTCCCATTCCTCCACCTT 57.3 GAGGGCCTCTCTCTTGCTCT Ta( C)

3 1574 CHUNG ET AL. percentage of CgAr and OTAr relative to callus area were expressed as %CgAr and %OTAr, respectively. Statistics All quantitative data were expressed as mean 1 standard deviation (SD) (SPSS version 16.0, SPSS Inc, Chicago, IL). All measurements including the quantitative radiographic analysis, histomorphometric data and real-time PCR data among groups at different time points were compared by one-way analysis of variance (ANOVA) (a ¼ 0.05), followed by Bonferroni post-hoc tests for pairwise comparison. Statistical significance was set at p < RESULTS Gene Expression Analysis Quantitative mrna gene expressions of five target genes relative to the housekeeping gene, GAPDH, at week 2, 4 and 8 post-treatment are shown in Figure 1. Expression of Col-2 (Fig. 1A) was up-regulated in vibration groups (OVX-V and Sham-V) in the early phase of fracture healing and peaked at week 4 while the control groups (OVX-C and Sham-C) peaked at week 8. At week 4, the Col-2 expression in OVX-V was significantly increased by 1.44-fold (p ¼ 0.008), as compared to OVX-C, while Sham-V was also upregulated by 1.83-fold (p < 0.001) over Sham-C. The expression level in OVX groups was up-regulated from week 2 to 8 compared to the Sham groups (Sham-C and Sham-V). Col-2 was significantly increased in OVX-C by 1.82-fold at week 2 (p < 0.001) and by fold at week 8 (p ¼ ) compared to Sham-C while OVX-V was also higher than Sham-V by 1.41-fold at week 2 (p < 0.001). Both OVX-V and Sham-V demonstrated significant up-regulation of Col-1 (Fig. 1B) throughout the healing process compared to the corresponding control groups (OVX-C and Sham-C). In OVX-V Col-1 was significantly increased by 3.00-fold at week 2 (p < 0.001) and by 1.86-fold at week 8 (p ¼ 0.008) compared to OVX-C. The level in Sham-V was also significantly increased by 2.00-fold at week 2 (p ¼ 0.008) and by 1.93-fold at week 8 (p ¼ 0.017) compared to Sham-C. Significant up-regulation of 1.83-fold at week 2 (p < 0.001) was also found, when comparing between OVX-V and Sham-V. The expression levels of the bone remodeling markers, OPG (Fig. 1C), RANKL (Fig. 1D) and the ratio of RANKL to OPG (Fig. 1E) are shown in Fig. 1. OPG was up-regulated and maximally expressed at week 4 in all groups. No significant differences found between the OVX and Sham groups except at week 8, at which time OVX-V was significantly decreased by 0.39-fold (p ¼ 0.004) compared to OVX-C. OPG expression was up-regulated in OVX groups throughout the fracture healing process compared to Sham groups. OPG was significantly increased in OVX-C by 0.76-fold at week 2 (p < 0.001) and by 1.29-fold at week 4 (p < 0.001) compared to Sham-C. OVX-V also demonstrated significantly increased expression levels over Sham-V by 0.53-fold at week 2 (p < 0.001). For the expression of RANKL (Fig. 1D), no differences were found betwen OVX and Sham groups. However, OVX groups were up-regulated from week 2 to 4 when compared to Sham groups. RANK-L expression in OVX-C significantly increased over Sham-C by 0.54-fold at week 2 (p ¼ 0.015) but no difference was found between OVX-V and Sham-V. At week 8, OVX groups were down-regulated; OVX-V was decreased by 0.47-fold at week 8 (p ¼ 0.013) compared to Sham-V. OVX and Sham groups showed no differences in RANKL/OPG expression ratio except for significantly increased expression ratio in OVX-V over OVX-C by 0.49-fold (p ¼ 0.045) at week 8 (Fig. 1E). The RANKL/ OPG ratio of Sham groups was generally up-regulated compared to OVX groups especially at the late stages of fracture healing. When comparing between OVX and Sham groups, the ratio significantly decreased in OVX-C by 0.72-fold at week 4 (p < 0.001) and by fold at week 8 (p < 0.001) compared to Sham-C. In Sham-V the ration was significantly increased by fold (p < 0.001) at week 4 compared to OVX-V. No significant difference was found between OVX-V and Sham-V at weeks 2 and 8. Radiographic Analysis In the serial radiographs (Fig. 2), obliteration of the fracture line and the bridging of the fracture gap were faster in both vibration groups compared to their corresponding control groups. At week 8, the percentages of the completed mineralized callus bridging of OVX-V, Sham-V, Sham-C and OVX-C were 91.67%, 83.33%, 66.67%, and 50.00% respectively (Table 2). Significant differences were found only between OVX- V and OVX-C from week 5 to 8 (p < 0.001) and between Sham-V and Sham-C at week 6 (p ¼ 0.006) and week 8 (p ¼ 0.035). Quantitatively, callus width (CW) (Fig. 3A) and callus area (CA) (Fig. 3B) of all groups reached their peak values at week 3. Significantly higher CW and CA of OVX-V than those of OVX-C were shown from week 1 to 3 (p < 0.05 for all) and from week 1 to 7 respectively (p < 0.01 for all). The CA of Sham-V was significantly higher than that of Sham-C at week 1 and 2 (p < 0.01 for all). OVX-V also demonstrated higher CW than that of Sham-V at week 2 (p ¼ 0.001) and significantly higher CA at week 1 (p ¼ 0.007) and week 5 (p ¼ 0.052) were as well observed. Histomorphometric Analysis At week 2, cartilaginous tissues formed in the soft callus was observed in all groups. Osseous tissue (woven bone) formed in the hard callus was also observed beneath the periosteum adjacent to the cartilaginous tissue in all groups. Area of the cartilaginous tissue in all groups decreased, while area of osseous tissue increased from week 2 to 8. From week 2 to 4, the area of cartilaginous tissue decreased while the area of osseous tissue adjacent to fracture site increased more significantly in the vibration groups

4 LMHFV ENHANCES OSTEOPOROTIC FRACTURE HEALING 1575 Figure 1. Changes in gene expression relative to GAPDH at week 2, 4 and 8. Gene expression of (A) Col-2, (B) Col-1, (C) OPG, (D) RANKL and (E) ratio of RANKL/OPG in the OVX groups (OVX-C and OVX-V) and Sham groups (Sham-C and Sham-V) were shown. Significant increases in expression between OVX-C and OVX-V was designated as a; between Sham-C and Sham-V was designated as b; between OVX-C and Sham-C was designated as c; between OVX-V and Sham-V was designated as d (p < 0.05 for all) (error bar ¼ 1 SD).

5 1576 CHUNG ET AL. Figure 2. Serial representative lateral radiographies of Sham-C, Sham-V, OVX-C and OVX-V at different time points. Faster fracture healing was found in vibration groups (Sham-V and OVX-V), as compared with corresponding controls (Sham-C and OVX-C) (arrow indicates the earlier callus bridging of the vibration groups). Table 2. The Percentages of Completed Mineralized Callus Bridging of All Groups and Time Points Group Weeks after treatment OVX-C 0% 8.33% 16.67% 50% OVX-V 25% a 66.67% a 83.33% a 91.67% a Sham-C 16.67% 16.67% 33.33% 66.67% Sham-V 16.67% 66.67% b 75% 83.33% b a p < 0.05 between OVX-V and OVX-C. b p < 0.05 between OVX-V and Sham-V. especially in OVX-V (Fig. 4). This result indicated that callus mineralization of vibration groups was faster than the control groups from week 2 to 4. Both vibration groups, especially the OVX-V, showed more extensive bridging and remodeling of woven bone at the fracture site at week 8. Throughout the fracture healing process, the % CgAr was significantly lower in the vibration groups (OVX-V and Sham-V) than the corresponding control groups (OVX-C and Sham-C) (Fig. 5A). When comparing between OVX and Sham groups, Sham-C was significantly lower than OVX-C (p ¼ 0.016) while OVX- V was significantly lower than Sham-V at week 8 (p < 0.001). The relative area of the osseous tissue (% OTAr) was higher in vibration groups throughout the fracture healing process (Fig. 5B). Vibration groups Figure 3. Radiographic analysis of temporal changes of (A) callus width (CW) and (B) callus area (CA). (A) For CW, significances were found between OVX-C and OVX-V from week 1 to 3 ( a: p < 0.01 for week 1 and 2, p ¼ for week 3) and between OVX-V and Sham-V at week 2 ( c: p ¼ 0.001). (B) For CA, significant differences between OVX-C and OVX-V from weeks 1 to week 7 ( a: p < 0.01 for all), between Sham-C and Sham-V at week 1 ( b: p ¼ 0.001) and 2 ( b: p ¼ 0.002) were observed. Between vibration groups, significantly higher CA was shown in OVX-V than Sham-V at week 1 ( c: p ¼ 0.007) and week 5 ( c: p ¼ 0.052) (error bar ¼ 1 SD).

6 LMHFV ENHANCES OSTEOPOROTIC FRACTURE HEALING 1577 Figure 4. The representative photomicrographs showing the histomorphology of the callus of OVX and Sham groups at week 2, 4 and 8. From week 2 to week 4, the area of cartilaginous tissue (Cg) decreased while area of osseous tissue (OT) increased in the callus of all the samples, especially in vibration groups (OVX-V and Sham-V). At week 8, vibration groups showed better remodeling than control groups and more samples in OVX-V showed completed callus bridging. (Magnification: X16, H&E) (Cg ¼ cartilaginous tissue; OT ¼ osseous tissue; CtB ¼ cortical bone; IaMe ¼ intramedullary canal; and arrowhead indicated the fracture site). (OVX-V and Sham-V) had significantly higher %OTAr than the corresponding control groups (OVX-C and Sham-C) at week 2 (p < and p ¼ respectively), week 4 (p < and p ¼ respectively) and week 8 (p < and p ¼ 0.01 respectively). Comparing between OVX and Sham groups, only at week 8 was OVX-V significantly higher than Sham-V (p ¼ 0.002). Figure 5. The percentage changes of cartilaginous and osseous areas from week 2 to week 8. There were significances between: (a) OVX-C and OVX-V; (b) Sham-C and Sham-V; (c) OVX-C and Sham-C; and (d) OVX-V and Sham-V. (p < 0.05 for all) (error bar ¼ 1 SD).

7 1578 CHUNG ET AL. DISCUSSION Previously LMHFV accelerated rat osteoporotic facture healing by enhancing the callus formation, mineralization and remodeling. 15,17,18 While previous studies focused on anabolic and osteogenic responses, this study is the first to investigate the effects of LMHFV on gene expression in osteoporotic fracture healing. The results support previous studies 15,18 and confirm that LMHFV up-regulated gene expression related to chondrogenesis, osteogenesis and bone remodeling, leading to better healing responses. Moreover, the OVX-V group showed the best fracture healing response, while in the absence LMHFV stimulation, fracture healing in OVX bone (OVX-C) was the worst. The OVX bone was more sensitive towards the mechanical stimulation of LMHFV than its non-ovx counterpart. The expression of Col-2 and Col-1 genes is related to chondrogenesic and osteogenesic processes, respectively. 22 LMHFV up-regulated the expression levels of Col-2 and Col-1, resulting in enhanced callus formation and mineralization in both the vibration groups (OVX-V and Sham-V). This result was substantiated by the studies from Mukai 25 and Dumas 26, in which mechanical stimulations (pulsed ultrasound and physical stimulation respectively) significantly up-regulated Col-2 and Col-1 through enhancing chondrogenesis with increased callus width and area at the early stage of fracture healing and promoting callus mineralization (reflected by rapidly decreased %CgAr and increased %OTAr) afterwards. The ratio of RANKL/OPG reflects the level of bone remodeling during fracture healing. 22,27 With the in vitro study of Kadow Romacker 30 showing that mechanical stimulation (1100 microstrain, 0.1 Hz) of primary human osteoblasts significantly decreased the production of OPG, the soluble receptor antagonist for RANKL, thus activating RANK is related to osteoclastogenesis, the enhanced remodeling process (higher completed bridging rate of OVX-V at week 8) by LMHFV might be result from significantly suppressed expression of OPG of the OVX-V at week 8, as compared with OVX-C. LMHFV promoted osteoclastogenesis (suppressed OPG) which, in return, led to significantly higher RANKL/ OPG ratio at week 8 of the OVX-V group. In this study, the fracture healing process was promoted by LMHFV in both OVX-V and Sham-V groups. However, OVX-V showed significantly better results than Sham-V in the expression of Col-2 and Col-1 at week 2, and CW and CA at early time points. We observed that LMHFV significantly up-regulated the expression of Col-1 in OVX-V at the early stage of fracture healing, promoting intramembranous ossification and leading to significantly higher CW and CA. This finding was consistent with Shi s 15 and Cheung s 16 studies, in which increased CW and CA together with higher total tissue volume (TV) and percentage of vessel volume were found in the callus of OVX-V rats. Eastaugh-Waring 28 and Cheung 16 also demonstrated that higher CW and TV might be positively correlated with better fracture stiffness and angiogenesis, respectively, which represented an enhanced fracture healing process in OVX-V. Rubinacci et al. 29 also reported that ovariectomy sensitized rats to respond to vibration treatment (3 g and 30 Hz) on the periosteal bone apposition and endosteal resorption. This result suggested that estrogen might act as negative modulator of the mechano-sensitivity of bone cells via estrogen receptor-beta (ER-beta) signaling. Another study conducted by Jagger 30 suggested that estrogen might act on osteoblasts and the effect depended on the stage of cell differentiation in response to mechanical stimulation in rat bone. 30,31 These results might help to explain our finding that LMHFV enhanced both osteoporotic and non-osteoporotic fracture healing. The efficacy of LMHFV on osteoporotic bones was better than that on nonosteoporotic bones especially for callus formation and the expression of ossification marker (Col-1) at the early period of fracture healing. The worst fracture healing was found in the OVX-C group as compared to Sham-C group, which was consistent with previous studies. 15,24 The expression level of Col-2 of OVX-C was significantly higher at week 2 and 8, while the ratio of RANKL/OPG was significantly lower than Sham-C at week 6 and 8. These results were supported by the lower completed bridging rate of callus and significantly higher %CgAr and relatively lower % OTAr at week 8 in OVX-C group. These results were substantiated by previous reports that the impaired fracture healing was mainly found in the late period of healing 31 and higher content of cartilage in fracture callus was found in osteoporotic rats. 32 This study has some limitations. The genes examined were only four of the representative markers of the three main stages of the fracture healing process. The current study could only demonstrate that the mechanical stimulations of LMHFV were positively correlated to these four markers; however, the detailed mechanisms were not obtained. With the use of microarray technology in future investigations, more information and detailed pathways or mechanisms of how LMHFV regulates the gene expression during fracture healing may be revealed. Moreover, large variations were seen in gene expression levels, which were attributed to the heterogeneous contents of the specimens harvested (comprising the entire callus with less than 2 mm of adjacent bone). The samples contained numerous cell types from different lineages and different types of tissues. To address this problem, the use of laser microdissection techniques may provide a more accurate selection of the tissues of interest. 33 Furthermore, the differences in gene expression might not reflect changes in the corresponding gene products, so immunohistochemistry should be use to assess the protein expression among different cell types in future studies. In conclusion, this study demonstrated that LMHFV enhanced both normal and osteoporotic frac-

8 LMHFV ENHANCES OSTEOPOROTIC FRACTURE HEALING 1579 ture healing by up-regulating the gene expression of Col-2, Col-1, and RANKL/OPG ratio, resulting in the enhanced callus formation, faster mineralization and remodeling. Osteoporotic bones were also shown to be more sensitive to the LMHFV than age-matched nonosteoporotic bones which led to further acceleration of fracture healing. These findings confirm that LMHFV has great potential in clinical applications for augmentation of osteoporotic fracture healing. ACKNOWLEDGEMENT This study was supported by Direct Grant from the Chinese University of Hong Kong (Project code: ). REFERENCES 1. Osteoporosis Prevention, Diagnosis, and Therapy. NIH Consens Statement Online 2000 March 27 29; [2014, July,15]; 17(1): Giannoudis P, Tzioupis C, Almalki T, et al Fracture healing in osteoporotic fractures: is it really different? A basic science perspective. Inj 38:S Hill E, Kraus K, Lapierre K Ovariectomy impairs fracture healing after 21 days in rats. Trans Orthop Res Soc Conf Proc Abdallah B, Haack-Sørensen M, Fink T, et al Inhibition of osteoblast differentiation but not adipocyte differentiation of mesenchymal stem cells by sera obtained from aged females. Bone 39: Edelberg J, Reed M Aging and angiogenesis. Front Biosci 8:s Li L, Deng L, Chen M, et al The effect of mechanical stimulation on the proliferation and synthetic function of osteoblasts form osteoporotic rat. Sheng Wu Yi Xue Gong Cheng Xue Za Zhi 21: Silver JJ, Einhorn TA Osteoporosis and aging. Current update. Clin Orthop Relat Res Gilsanz V, Wren TA, Sanchez M, et al Low-level, high-frequency mechanical signals enhance musculoskeletal development of young women with low BMD. J Bone Miner Res 21: Rubin C, Judex S, Qin Y Low-level mechanical signals and their potential as a non-pharmacological intervention for osteoporosis. Age Aging 35:ii Flieger J, Karachalios T, Khaldi L, et al Mechanical stimulation in the form of vibration prevents postmenopausal bone loss in ovariectomized rats. Calcif Tissue Int 63: Stewart JM, Karman C, Montgomery LD, et al Plantar vibration improves leg fluid flow in perimenopausal women. Am J Physiol Regul Integr Comp Physiol 288:R Cheung WH, Mok HW, Qin L, et al High-frequency whole-body vibration improves balancing ability in elderly women. Arch Phys Med Rehabil 88: Torvinen S, Kannus P, Sievanen H, et al Effect of 8- month vertical whole body vibration on bone, muscle performance, and body balance: a randomized controlled study. J Bone Miner Res 18: Stuermer EK, Komrakova M, Werner C, et al Musculoskeletal response to whole-body vibration during fracture healing in intact and ovariectomized rats. Calcif Tissue Int 87: Shi HF, Cheung WH, Qin L, et al Low-magnitude highfrequency vibration treatment augments fracture healing in ovariectomy-induced osteoporotic bone. Bone 46: Cheung WH, Sun MH, Zheng YP, et al Stimulated angiogenesis for fracture healing augmented by low-magnitude, high-frequency vibration in a rat model-evaluation of pulsed-wave doppler, 3-D power Doppler ultrasonography and micro-ct microangiography. Ultrasound Med Biol 38: Chow DH, Leung KS, Qin L, et al Low-magnitude high-frequency vibration (LMHFV) enhances bone remodeling in osteoporotic rat femoral fracture healing. J Orthop Res 29: Leung KS, Shi HF, Cheung WH, et al Low-magnitude high-frequency vibration accelerates callus formation, mineralization, and fracture healing in rats. J Orthop Res 27: Ammann P, Bourrin S, Brunner F, et al A new selective estrogen receptor modulator HMR-3339 fully corrects bone alterations induced by ovariectomy in adult rats. Bone 35: Chung SL, Pounder NM, de Ana FJ, et al Fracture healing enhancement with low intensity pulsed ultrasound at a critical application angle. Ultrasound Med Biol 37: Einhorn TA, Bonnarens F Production of a standard closed fracture in laboratory animal bone. J Orthop Res 2: Kuroda S, Virdi AS, Dai Y, et al Patterns and localization of gene expression during intramembranous bone regeneration in the rat femoral marrow ablation model. Calcif Tissue Int 77: Cheung WH, Chow SK, Sun MH, et al Low-intensity pulsed ultrasound accelerated callus formation, angiogenesis and callus remodeling in osteoporotic fracture healing. Ultrasound Med Biol 37: Cheung W, Chin W, Qin L, et al Low intensity pulsed ultrasound enhances fracture healing in both ovariectomyinduced osteoporotic and age-matched normal bones. J Orthop Res 30: Mukai S, Ito H, Nakagawa Y, et al Transforming growth factor-beta1 mediates the effects of low-intensity pulsed ultrasound in chondrocytes. Ultrasound Med Biol 31: Dumas V, Ducharne B, Perrier A, et al Extracellular matrix produced by osteoblasts cultured under low-magnitude, high-frequency stimulation is favourable to osteogenic differentiation of mesenchymal stem cells. Calcif Tissue Int 87: Kidd LJ, Stephens AS, Kuliwaba JS, et al Temporal pattern of gene expression and histology of stress fracture healing. Bone 46: Eastaugh-Waring SJ, Joslin CC, Hardy JR, et al Quantification of fracture healing from radiographs using the maximum callus index. Clin Orthop Relat Res 467: Rubinacci A, Marenzana M, Cavani F, et al Ovariectomy sensitizes rat cortical bone to whole-body vibration. Calcif Tissue Int 82: Jagger CJ, Chow JW, Chambers TJ Estrogen suppresses activation but enhances formation phase of osteogenic response to mechanical stimulation in rat bone. J Clin Invest 98: Saxon LK, Turner CH Estrogen receptor beta: the antimechanostat? Bone 36: Xu SW, Wang JW, Li W, et al Osteoporosis impairs fracture healing of tibia in a rat osteoporotic model. Zhonghua Yi Xue Za Zhi 84: Edwards K, Logan J, Saunders N Real-time PCR: an essential guide. Horizon bioscience: Norfolk, United Kingdom.