Supplemental Information. lncrna Epigenetic Landscape Analysis Identifies EPIC1 as an Oncogenic lncrna that Interacts with MYC

Similar documents
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

SUPPLEMENTARY FIGURES

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figures

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Supplementary Figures

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

SUPPLEMENTARY INFORMATION

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region

Supplementary Figures

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Information

OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies

Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Table S1. Total and mapped reads produced for each ChIP-seq sample

Supplemental Table S1

SUPPLEMENTARY FIGURES

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Nature Genetics: doi: /ng Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplemental Information

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplementary Figure 1

SUPPLEMENTARY FIGURE LEGENDS

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Figure S1, Beyer et al.

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Nature Structural & Molecular Biology: doi: /nsmb.2419

Figure S1A. Blood glucose levels in mice after glucose injection

Supplementary Information Titles Journal: Nature Medicine

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

SUPPLEMENTARY INFORMATION

BIO360 Fall 2013 Quiz 1

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Supplementary Materials for

Plasma-Seq conducted with blood from male individuals without cancer.

Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs.

Supplementary Figure 1

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplemental Figure 1

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Supplementary Information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

SUPPLEMENTARY INFORMATION

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1

Nature Methods: doi: /nmeth.3115

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

Supplementary Figure 1 IL-27 IL

Supporting Information

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

SUPPLEMENTARY INFORMATION

SUPPLEMENTAL INFORMATION

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Materials for

Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

MIR retrotransposon sequences provide insulators to the human genome

SUPPLEMENTARY INFORMATION

Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR

SUPPLEMENTARY FIGURES: Supplementary Figure 1

Supplementary Information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Materials for

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

S1 Appendix: Figs A G and Table A. b Normal Generalized Fraction 0.075

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Transcription:

Cancer Cell, Volume 33 Supplemental Information lncrna Epigenetic Landscape Analysis Identifies as an Oncogenic lncrna that Interacts with and Promotes Cell-Cycle Progression in Cancer Zehua Wang, Bo Yang, Min Zhang, Weiwei Guo, Zhiyuan Wu, Yue Wang, Lin Jia, Song Li, The Cancer Genome Atlas Research Network, Wen Xie, and Da Yang

A Data collection lncrna expression data (MiTranscriptome) Identification Correlation of methylation and expression DNA methylation level of 33 TCGA cancer types DNA methylation in normal tissue Nearest lncrna and PCG to probes DNA methylation in cancer sample B C Functional analysis Expression pattern in different tissue, development phase, cancer type or cancer subtype 1. Shared. PCG 3. lncrna. Intergenic Distance to lncrna TSS lncrna Protein-coding gene Transcription direction DNA methylation alteration 1. 1 6 1 1 TSS -1-1 -1 6-1 6-1 -1 1 1 1 6 TSS Distance to PCG TSS To categorize patients into epigenetic activation or epigenetic silencing for each gene Prioritization lncrnas according to percentage of regulated patients Experimental analysis Methylated.8.6.. D Distance to lncrna TSS Coexpressed protein-coding gene and functional gene set or network Survival analysis 1 6 1 1 TSS -1-1 -1 6 1 6 1 1 TSS -1-1 -1 6 DNA methylation alteration ESCA -1 6-1 1 1 6 Distance to PCG TSS Figure S1. LncRNAs are both epigenetically activated and silenced by DNA methylation alteration in the promoter region, Related to Figure 1. (A) Flow chart of identification and functional analysis of EA and ES lncrnas in cancer. (B) Schematic of the annotation of DNA methylation probes to protein-coding genes and lncrna genes. (C) Differential DNA methylation between breast cancer and normal tissues. Density plot of average differential DNA methylation (indicated by beta values) within 1 windows in ± 1 kb from TSS sites are shown. The windows are arranged based on their distances to protein coding gene TSS (x-axis) and lncrna gene TSS (y-axis). The hypermethylation region in tumor is shown as red, whereas the hypomethylation region is shown as blue. (D) Differential DNA methylation between cancer and matched normal tissues in nine cancer types. TSS TSS -1 6-1 1 1 6-1 6-1 1 1 6 TSS 1 6 1 1 TSS -1-1 -1 6

A LINC668 RP11-539E17.5 LINC91 RP11-68O1.1 AK333 CTD-31D.3 BC581 LINC6 RP11-556E13.1 AC98973. LINC9 Nomal Tumor B LncRNA expression value DLBC ESCA LCLL MM SARC 1 3 5 6 7 CERS3-AS1 AC66.13 HAND-AS1 FGF1-IT1 LINC1158 RP3-1A9.16 DIO3OS CTD-98J1. DPP1-AS1 RP11-7E.3 HHIP-AS1 LINC1197 AK15737 CTB-1I6. RP11-59O.1 AF18619.1 AC98973. MINCR SNHG1 MFI-AS1 LINC6 BC581 LINC91 LINC88 LINC668 LINC9

C MIR666A LINC9 LINC668 LINC88 RP11 539E17.5 LINC91 RP11 68O1.1 AK333 CTD 31D.3 BC581 LINC6 MFI AS1 RP11 556E13.1 LOC1797 SNHG1 BOLA MINCR RP11 78L15. AC98973. AF18619.1 ZNF667 AS1 RP11 59O.1 CTB 1I6. AK15737 LINC1197 HHIP AS1 RP11 7E.3 DPP1 AS1 CTD 98J1. DIO3OS RP3 1A9.16 LINC1158 BOLA3 AS1 FGF1 IT1 LOC19716 SNHG18 HAND AS1 AC66.13 CERS3 AS1 F HR 3 1 1 3 CTD-13A5.3 LMO7-AS1 RP11-68O1.1 BOLA LOC119975 LINC6 CTD-31D.3 LINC668 BC35 AK333 MIR5 ZFAS1 LINC673 RP11-3J1.1 LOC1576 AC1198.1 ATPB3 ATP11A-AS1 LINC1197 ERBB MINCR RP11-1N16.3 LOC15378683 LOC1198161 BRAF RP11-69O1. CTB-1I6. CERS3-AS1 MIR138-1 EPHA5-AS1 ZNF793-AS1 TP53 ZNF667-AS1 KRAS RP11-1C8. p value <.1 <.1 <.1 <1 BC581 RP11-59O.1 LINC7 SETD AC13563.8 AF18619.1 LINC665 ARID1A PTEN LINC898 ATRX ZNF79-AS1 LINC1158 SLC6A-AS1 CTNNB1 NOTCH CCNE1 CTD-98J1. RP11-16E13. RNF3 RP11-31P5. DLX6-AS1 LINC118 PIK3CA GATA3 GNAS LINC958 CIC LINC61 PRDM1 LINC1116 LINC865 NF1 EMXOS SOX MIR666A FGF1-IT1 MEOX-AS1 BC361 RP11-573D15.8 RP11-3B7.3 D E HHIP-AS1 BCL6 Proportion Survival....6.8 1. Proportion Survival....6.8 1. Proportion Survival....6.8 1. Proportion Survival....6.8 1. RP3-1A9.16 p=. UC (5) EA (8) 6 8 1 1 OS (month) p=. ES (3) UC (16) EA (3) 6 8 1 1 OS (months) p=.6 OS (months) p=.1 ES (15) UC () 6 8 1 1 ES (6) UC (33) 6 8 1 1 LOC119797 OS (months) RP11-6H.1 TPTEP1 BC7363 APC RP11-867G3.1 IDH1 FLJ355 LINC886 AC3986.6 LOC1197851 RP11-17I1. LINC91 TP73-AS1 MEIS1-AS AC936. RP11-5H. Proportion Survival....6.8 1. Proportion Survival....6.8 1. Proportion Survival....6.8 1. Proportion Survival....6.8 1. PDZRN3-AS1 AC66.13 CDKNA RP11-195F19.9 MIR18A p=. OS (month) p=.6 UC (56) EA (85) 6 8 1 1 UC (85) EA (181) 6 8 1 1 p=. OS (months) ES (79) UC (193) 6 8 1 1 OS (months) p=. ES (196) UC (98) 6 8 1 1 RP11-89I19.1 DPP1-AS1 HPN-AS1 HAGLR EGFR OS (months) Tumor suppressor gene Oncogene ES lncrna EA lncrna Co-occurrence Mutual exclusivity MDM RP11-7E.3 SNORA69 TCONS_9157 MIR19A DM11953 SNHG18 AC863. AP51.3 GAS1RR AL13393. WT1-AS RP11-55F3.9

G..1. -.1 -. p value <.5 <5e 6 <5e 1 Mutual exclusivity Co-occurrence <5e <5e 8 SNHG1 RP11 68O1.1 RP11 556E13.1 RP11 539E17.5 RP11 78L15. MIR666A MINCR MFI AS1 LOC1797 LINC9 LINC91 LINC88 LINC668 LINC6 CTD 31D.3 BOLA BC581 AK333 AC98973. UVM UCS THYM TGCT SARC PCPG MESO LAML ESCA DLBC CHOL ACC Figure S. EA lncrnas exhibit an on or off pattern with completely no expression in normal tissues, and are associated with tumor survival and tumor gene alterations, Related to Figure. (A) Representative expression pattern of EA lncrnas in multiple cancer types, compared to normal tissues. Blue dot denotes normal tissue, and red dot denotes tumor. (B) Expression pattern of EA and ES lncrnas in cancer cell lines. White denotes low expression, and dark blue denotes high expression. (C) Correlation of EA lncrnas (top panel) and ES lncrnas (bottom panel) with survival. The size of each cycle indicates the p value calculated by Cox regression survival analysis. The heatmap indicates the hazard ratio (HR). (D, E) Overall survival (OS) of representative EA lncrna LINC91 (D) and ES lncrna AF18619.1 (E) in multiple cancer types. UC, unchanged; EA, epigenetic activation; ES, epigenetic silencing. (F) Mutual exclusivity and co-occurrence network for EA and ES lncrnas with tumor suppressor genes and oncogenes. (G) Mutual exclusivity and co-occurrence between EA lncrnas and TP53 mutation in 33 cancer types. The size of each circle indicates p value calculated by Fisher s exact test. The color indicates mutual exclusivity (blue) or co-occurrence (red).

A B D Proportion survival....6.8 1. Proportion survival....6.8 1. 1% 5% Proportion survival....6.8 1. Proportion survival....6.8 1. GSE711 logrank p =.53 Expression low high 5 1 15 Time (months) GSE685 logrank p =. Expression low high 5 1 15 Time (months) % EA p =.1 x 1-7 Normal -like Lum A p =. EA, n = 86 Non EA, n = 33 6 8 1 1 Time (months) p =.739 EA, n = 3 Non EA, n = 8 Lum B Non EA HER 6 8 1 1 Time (months) Proportion survival....6.8 1. Proportion survival....6.8 1. Basal GSE1653 logrank p =.5 Expression low high 5 1 15 Time (months) E F GSE166 logrank p =.51 Expression low high 1 3 5 6 7 Time (months) DNA mehtylatoin beta value (HM5) expression (RNA-seq) C expression.1.1.8.6... Normal -like Lum A 1. p.5 1..8.6... 3..5. 1..5. p.5 Proportion survival....6.8 1. Proportion survival....6.8 1. Lum B GSE1797 logrank p =.17 Expression low high 6 8 1 Time (months) GSE19615 logrank p =.17 Expression low high 6 8 Time (months) HER Basal MB361 ZR-75-1 MB68 MB15 MB175 EFM-19 HCC38 HCC15 T-7D HCC1569 SK-BR-3 HCC1187 EFM-19A BT BT-7 MB36 HCC195 MCF-7 HCC119 MB53 MB31 ZR-75-3 HCC1937 CAMA-1

G H Relative level Relative expression 3 1 15 1 5 RP11-78L15. HeLa 8 hr A78.1.1 1 DAC (mm) RP11-78L15. 3 3 1 HeLa 7 hr Relative level DAC (mm).1.1 1 6 1 HeLa LINC6 SK--3.1.1 1 DAC (mm) 8 hr 3 1 LINC6 A78 Relative level 8 hr 5 3 1 7.5 5..5 HeLa T-7D.1.1 1 DAC (mm) 8 hr 8 6 8 hr 7 hr Hs578T 8 hr Relative expression CTD-31D.3 6 A78 8 hr CTD-31D.3 3 1 A78cis 7 hr CTD-31D.3 6 MCF-7 8 hr 15 1 RP11-539E17.5 5 A78 8 hr RP11-539E17.5 1 5 MCF-7 8 hr RP11-539E17.5 1. 7.5 5..5 MCF-7 7 hr Relative expression 1 75 5 RP11-68O1.1 5 MCF-7 8 hr 15 1 RP11-68O1.1 5 MCF-7 7 hr 15 1 5 RP11-556E13.1 MCF-7 8 hr RP11-556E13.1 9 6 3 MCF-7 7 hr RP11-556E13.1 3 1 Hs578T 8 hr Relative expression 15 1 AC98973. 5 MCF-7 8 hr AC98973. 3 1 MCF-7 7 hr AC98973. 15 1 5 A78cis 7 hr AC98973. 15 1 75 5 5 A78cis 8 hr AC98973. 15 1 5 A78 8 hr

Figure S3. is robustly correlated with poor survival in 189 breast cancer samples and can be epigenetically activated by decitabine, Related to Figure 3. (A) The association between expression and breast cancer survival in six independent breast cancer cohorts. (B) The association between s EA status and five breast cancer subtypes. The overall p value is calculated by chi-square test. (C) Comparison of s expression in five subtypes (B). The p value is calculated by pair-wise Wilcoxon Rank Sum test. p.5, p.1. (D) s correlation with survival in luminal B (top) and HER (bottom) subtypes. (E, F) Association of DNA methylation status (E) and expression (F) in breast cancer cell lines based on lncrna expression (CCLE) and genome-wide DNA methylation data (GSE837). (G) qrt-pcr analysis of expression in A78, SK--3, and T-7D cells treated with decitabine (DAC) as indicated time and dosage. (H) qrt-pcr analysis of eight EA lncrna expression in five cell lines treated with DAC. Error bars indicate mean ± SD, n = 3 for technical replicates. p.5, p.1.

A Copy number of 5 ( x 1 / μg RNA) 7. 5. 3. 1..5.5 C Cell line RNA copy # per cell MCF1A.5 ±.6 MCF-7 8.51 ±.63 T-7D 53.95 ± 3.1 ZR-75-1 7.6 ±.3 MB31 5.36 ±.6 A78.56 ±.31 A78cis 19.6 ±.83 CAR-.87 ±.35 B - 39bp GAPDH - 15bp E. Marker MCF1A BT- BT-7 HCC1937 Hs578T MB31 MB361 MB68 MCF-7 T-7D ZR-75-1 a MCF1A BT- BT-7 HCC1937 Hs578T MB31 MB361 MB68 MCF-7 T-7D ZR-75-1 A78 A78cis IGR-1 CAR-3 CAR- CAR-8 SK--3 A78 A78cis IGR-1 CAR-3 CAR- CAR-8 SK--3 Marker HPDE AsPC-1 HPDE AsPC-1 BxPC-3 PANC-1 DU 15 BxPC-3 PANC-1 DU 15 PC-3 PC-3 A59 HeLa A-59 HeLa Hep G K56 Hep G K56 Water D kb.85-.5-.-.1- chr: 7,, 7,5, 8,, 8,5, GENCODE v MCF-7 5 -Outer 5 -Inner T-7D 5 -Outer 5 -Inner MCF-7 T-7D 3 -Outer 3 -Inner 3 -Outer 3 -Inner ENST3737.5 ENST65.1 b LOC893 uc3bik. uc6fgu.1 v3 RT-PCR v clones v1 ENST3881.1 uc6fgv.1 c CpG: 7 Layered H3KMe3 Cons 1 Verts 5 RACE 3 RACE 13 - signal 1 _

F G > v1 AGTCCGCCATTGCAAACACGAAGCTCTTCCAGAAACGCCCTCACAGACACCCCGGAAGTCACGTACCCACTCTGTAGGTGCCCCGGGGCACAGGCAAGCG GACGAGCCAGTTATCCCTCAGAGCTCCTGCTGCCTCGCCCGCTTTCTCTCGGAAACGTGAAGTGTGGCCTCAGCTGAAAGTGAGGTGGGCCTCATTCAAT CAGTTGAATTCTTCAAGAGAGAAAAACTGAAGTCCCTTAGAAGGAAAGAGTTCTGCCTTCAGACTGTCTTTGAACTTAAGACTGTAGCGTCGACTCCTGC CGGAATTTCCAGCCTGCTGGCCAGCTCTGCAGATTCACACTTGCCAGCCTCCACAATCGTGTGAGCCAATTCCTTAACTTCTCTTTCTCCGTGTATCCCT TTGGTGCTGCCTCTCTGGGGAGCCCTGACTAATATGCATGCAGATGATACGGTGCCTGGCATTCTGAATACATGCACTAAATCCACCACTTTTCCCCATT TATAGATTTGGATTAACACACTAACTTACTCATATCTGCAAGTATAAATAAAAAAAATTGCTGGTGC > v AGTCCGCCATTGCAAACACGAAGCTCTTCCAGAAACGCCCTCACAGACACCCCGGAAGTCACGTACCCACTCTGTAGGTGCCCCGGGGCACAGGCAAGCG GACGAGCCAGTTATCCCTCAGAGCTCCTGCTGCCTCGCCCGCTTTCTCTCGGAAACGTGAAGTGTGGCCTCAGCTGAAAGTGAGGTGGGCCTCATTCAAT CAGTTGAATTCTTCAAGAGAGAAAAACTGAAGTCCCTTAGAAGGAAAGAGTTCTGCCTTCAGACTGTCTTTGAACTTAAGACTGTAGCGTCGACTCCTGC CGGAATTTCCAGCCTGCTGGCCAGCTCTGCAGATTCACACTTGCCAGCCTCCACAATCTTCCTGGATTTGAAACTGAAGAAGCAAGCAATCTGGAAATGT CAGTGGATGCACACAAAGAAACAACCGCAAAAGCCTGCTCGCTCTAGCCAAGGGACAAGAATAGGGGCAGTCCATCAAGACAGAATCCTTTTAAAAAATA ACCACTCCACTCCAGCAATACCACAGAAGAATCTGGCTGTACCCCAGGTACATCAGCAAAGATAACCTTTACCTAGCAGTAAAGAGGTCCCCCTTACACT GGGAGCCCTAGTGAAGAGCAGGGACTTTCACCCCCACTTAGCAGTGATGGGGCCCCACCCACCACAGTGCCAGCAGAGACCATGTGGGAGCCAGAATCCT CATCCCTACCCAGCAGTAACAAGGAGCCCTCCTCACTGCGGGCATCAAGGGTGAGTGAGTGCAAAACCTGGGTGTCACTCGGAAGGGAAGAATGGTGTCT CCTTCCTTCCCATCCCCTGCCAGAGTGATATCACTAGGAAAAAG > v3 AGTCCGCCATTGCAAACACGAAGCTCTTCCAGAAACGCCCTCACAGACACCCCGGAAGTCACGTACCCACTCTGTAGGTGCCCCGGGGCACAGGCAAGCG GACGAGCCAGTTATCCCTCAGAGCTCCTGCTGCCTCGCCCGCTTTCTCTCGGAAACGTGAAGTGTGGCCTCAGCTGAAAGTGAGGTGGGCCTCATTCAAT CAGTTGAATTCTTCAAGAGAGAAAAACTGAAGTCCCTTAGAAGGAAAGAGTTCTGCCTTCAGACTGTCTTTGAACTTAAGACTGTAGCGTCGACTCCTGC CGGAATTTCCAGCCTGCTGGCCAGCTCTGCAGATTCACACTTGCCAGCCTCCACAATCGCAGCTGAGGCGGAGGAACCCTAAGGGCTCATTGAGATCATG GATTTGCCCTTCTATGCATTGATGGAGCACCTGCTGCCCACAGCGTCTGTATTTGGTGCTGGGATGCTGAGCCTCCTTCTTTATGAATTTTTAAAAGGAC ACTGAGATCTTCAAACAGAGGCTGCCACTCTAAGCAAACAGATCCCGAGTCCTGGACTCTGAAGCTTGGGCCCAGTTCTCCTTTTCTCCGGGTTTCAGAT CCCACTGTAAAGTGAGGGGGCCCTTCTGATTCAGGACCCGGGGAAGCCAGGGGCATGAGCATCGGTGCCTCTTCTCTATTTCAAGGACCCTTCTGGGTGT AAAGTTCTCTGAGATGCCTTACATGGATTCCCACCACTGCAAGATAACCATCGTATGTAAAGTGTTATGACCAGCAGAGTGTAATTGAAGTGCATTCCAG AGGGAAAGACAGCGGCTCAGATTCTATTGAAAGAAACATGACATAATGATACCACAGCAAAAGCCAATCTTGCTCCTTTTTA Relative level 1..5. sie3 sie sie5 sie6 Mock H Counts Counts MCF-7 PI ZR-75-1 I Relative level 1..5 shctrl she1 she J Relative growth rate 9 shctrl she1 6 she 3 1 3 Day(s) K PI shctrl she1 she Relative # of colonies 5 1 15 shctrl she1 she

Figure S. functions as an oncogenic lncrna regulating cell cycle progression, Related to Figure. (A, B) copy numbers by qrt-pcr (A) and RT-PCR analysis of the products (B) in multiple cancer-type cell lines. Copy numbers were calculated according to a standard curve of a serial dilutions of cdna from in vitro-transcribed ranging from 1 to 1 9 molecules. GAPDH was used as the internal control. (C) Quantification of RNA copy number/cell according to a standard curve of in vitro-transcribed. (D) 5 -RACE and 3 - RACE cloning of in MCF-7 and T-7D cells. (E) Alignment of with UCSC browser. a, Genomic location of in GENCODE is highlighted in background color of light yellow. The nearest protein coding genes (upstream TBC1DA and downstream FAM19A5) are also shown in the two ends. b, 's gene structure, isoforms from GENCODE (black), RefSeq (green) and UCSC (blue) annotation are enlarged. isoforms, i.e. v1, v, and v3, are also listed in the red window. c, The CpG island, H3KMe3 signal from ENCODE project and conservation tracks are presented at top. Sequences derived from 5'RACE and 3'RACE are listed in red window. signal from CCLE breast cancer cell lines are shown at bottom. (F) Sequences of isoforms cloned are shown. (G) qrt-pcr analysis of knockdown efficiency of sirnas in MCF-7 cells. (H) Cell cycle profiles of MCF-7 cells and ZR-75-1 cells treated with sirnas. (I-K) qrt-pcr analysis of expression (I), MTT assay (J), and anchorage-independent colony formation assays and representative images (K) of MCF-7 cells stably expressing shctrl and sh RNA, respectively. Error bars indicate mean ± SD, n = 3 for technical replicates. p.5, p.1.

A RNA distribution (relative fold) B E 1..5 sim1 sim 5 CDKN1A 3 1 sim1 sim 1..5 CCNA sim1 sim C RT-PCR WB 1..5 F G H Relative growth rate UCSC Gene Ensembl Gene Cyto1 Cyto Nuc1 Nuc Cyto1 Cyto Nuc1 Nuc Cyto1 Cyto Nuc1 Nuc GM1878 K56 MCF7 8 6 15 1 5 Hs578T GAPDH SNRP7 GAPDH sim1 sim U6 WCL Cyto Nuc Hs578T 1 3 Day(s) 15 1 5 (chr:q13.31) Percentage of cells T-7D WCL Cyto Nuc GAPDH T-7D WCL Cyto Nuc U6 D Gene 1 8 6 sim1 sim G/G1 S G/M Correlation coefficiency CDC WCL Cyto Nuc sim1 sim p value CDC.15 6.e-6 CDC6.1.e-1 CCNB. 1.e-9 FOXM1.1.1e-5 CDC5A.16.9e-7 CDC5.6 1.3e-15 CCNA.18 1.e-8 EF1.8.e-16 EF.17 1.7e-7 MADL1. 1.e-11 RAD51.7.e-16 1..5 Gene CDC5 sim1 sim sim1 sim Correlation coefficiency 1..5 Relative # of colonies 5 1 15 - -U6 -GAPDH SNRP7 GAPDH p value RAD51AP1.13 3.8e-5 FANCI.1.1e-11 CCNB1..1e-13 MAPK8IP..6e-1 MCM.1 1.3e-1 CDKN1A -.5 1.e-1 IL1R1 -.15 3.e-6 ITGA6 -.16 5.5e-7 MAP -.9 7.7e-3 NRP1 -. 1.7e-13 ENTPD -.1.e-5 sim1 sim sim1 sim

Figure S5. is a nuclear lncrna regulating targets expression, Related to Figure 5. (A) qrt-pcr analysis of expression and Western blot of subcellular fractionation in Hs578T (left panel) and T-7D (right panel) cells. (B) RNA-seq analysis of subcellular localization in MCF7, K56, and GM1878 cells. Subcellular localization RNA-seq data are downloaded from ENCODE. (C) RT-PCR analysis of expression levels in different subcellular fractionation of MCF-7 cells treated with sirnas. (D) Correlation between -regulated genes ( qrt-pcr validated genes in Figure 5F) and expression in TCGA tumors. (E) qrt-pcr analysis of targets expression in MCF-7 cells treated with sirnas. (F-H) MTT assay (F), cell cycle analysis (G), and anchorage-independent colony formation assays (H) of MCF-7 cells treated with sirnas (i.e., sim1 and sim). Error bars indicate mean ± SD, n = 3 for technical replicates. p.5, p.1.

A D E H 1. 1..8.6... % Input Vector Flag- v1 v v3 v1 v v3 IP: Anti-Flag IB: Anti-Flag Input IB: Anti-Flag Tumor volume (mm3) Enriched RNA (% Input) Percentage of cells(%)6.5 MCF-7..3..1. 8 6 GAPDH v1 v v3 v1 v v3 Vector Flag- G/G1 S G/M Vector Vector 1 3 5 6 7 8 Week(s) DAC (μm) GAPDH β-actin B F 11 15 1 5 1..5. Vector G Vector v1 v 1. 1 CDKN1A Enriched RNA(% Input) 1..8.6.. Enriched RNA (% Input).3..1..5. 3 1. GAPDH CCNA Flag- Vector A78 C GAPDH CDC5 CDC Cyclin A p1 β-actin GAPDH Tumor weight (mg) v1 v vector IgG RIP + μm DAC RIP + 1 μm DAC RIP + 1 μm DAC RIP + 1 μm DAC DAC (μm) β-actin 5 3 1 Vector IP Flag Input Flag- - + - + IB: Flag 11 RT-PCR Western blot 1

Figure S6. directly binds with, Related to Figure 6. (A) Binding of isoforms with proteins in 93T cells. isoforms retrieved by exogenous Flag-tagged protein with Flag RIP were detected by qrt-pcr, and Western blot of Flag- is shown (right). (B, C) qrt-pcr analysis of targets (B), RT-PCR of products, and Western blot of targets in MCF-7 stably over-expressing isoforms (C). (D) Cell cycle analysis of MCF- 7 cells with stable overexpression of and an empty vector. (E, F) Tumor growth (E), tumor size and weight (F) in MCF-7 cells with stable overexpression of and an empty vector. Error bars indicate mean ± SD (n = 6). p.5, p.1. (G) Flag-tagged retrieves RNA (left). Western blot of Flag- is shown (right). (H) IP retrieves in MCF-7 and A78 cells after decitabine (DAC) treatment as indicated. Western blot of is also shown. Error bars indicate mean ± SD, n = 3 for technical replicates. p.5, p.1.

A CDC ChIP-seq Scale chr1: 1 kb hg38 3,359,5 3,36,5 3,361,5 3,36,5 1.7 - rep1 _ 1.7 - rep _ 163.6 - si _ 163.6 - _ Scale CDC5 ChIP-seq 17.16 - rep1 _ 17.16 - rep _ 16.57 - si _ 16.57 - _ chr: 19,85, 1 kb hg38 19,95, 19,55, 19,515, ChIP-seq Scale chr: kb hg38 39,31, 39,316, 39,318, 39,3, RPL3 37.3 - rep1 _ 37.3 - rep _ 379.96 - si _ 379.96 - _ Scale NR1D1 ChIP-seq 53.9 - rep1 _ 53.9 - rep _ 37.97 - si _ 37.97 - _ chr17: kb hg38,9,,96,,98,,1, ChIP-seq Scale 1 kb hg38 chr: 39,51, 39,51,5 39,5, 39,5,5 ATF 5.8 - rep1 _ 5.8 - rep _ 995.379 - si _ 995.379 - _ Scale APEX1 ChIP-seq 6.5- rep1 _ 6.5- rep _ 396.7 - si _ 396.7 - _ chr1:,55,5 1 kb hg38,56,,56,5,57,,57,5 RPL19 Scale chr17: 1 kb hg38 39,1, 39,, 39,3, 39,, 36.76 - RPL35 Scale chr9: 8.59-1,859, 1 kb hg38 1,86,, 1,861, 1,86, ChIP-seq rep1 _ 36.76 - rep _ 36.97 - si _ 36.97 - _ ChIP-seq rep1 _ 8.59 - rep _ 673.86 - si _ 673.86 - _ B MCF-7 1..5 APEX1 1..5 ATF 1..5 RPL19. 1..5 RPL35 ZR-75-1 1..5 APEX1 1..5 ATF 1..5 RPL19. 1..5 RPL35

C D F % of Input %ofinput % of Input IP MAX.3 TRIP13..1...6 CD16 IgG Anti- Anti-MAX si si IgG band 1..63 Vector si - + - + HA- Cyclin A p1 β-actin. MCM.3..1. MXD3.15.1.5.15 AKAP9.1.5 1..36 1.5 1..81.6 EXO1...37 1.7.15 SCML.1.5.15 PRKRIR. RGS16.1.5 si 1..7 G Relative level LNA.15 TROAP.1.5.15.1.5 1..5 Input si Scr 1# # 6#.5 CKS..3..1. MAFF.3..1 1# E. RPS6KA5.1 CACNB1.15.1.5.8 TFEB.6.. Relative Luc unit 5 3 1 CCNA-Luc - - Δ- - - MAX -.5 RECQL5. RAD5L.15 APEX1.15 ATF..15.1.5.15.1.5.1.5.1.5.5.8 RBBP8.6.. + - - -.5 RPL19..15.1.5 NS + + - + - - + + - + + + - + + +.6 FOXM1...15.1.5 IgG. RPL35

Figure S7. is required for the regulatory role of in cancer, Related to Figure 7. (A) Alignment of two biological replicates of ChIP-seq in MCF-7 cells (green) and RNA-seq from (blue) and si (red) RNA treated MCF-7 cells. -regulated targets (CDC, CDC5, RPL3, and NR1D1) and non -regualted targets (ATF, APEX1, RPL19, and RPL35) are shown. (B) qrt-pcr validation of non -regualted targets expression in MCF-7 and ZR-75-1 cells with sirnas treatment. (C) ChIP-qPCR analysis of occupancy on the promoters of target genes in MCF-7 cells treated with sirnas. Non -regulated targets, i.e., APEX1, ATF, RPL19, and RPL35 are chosen as negative controls. (D) Effect of on and MAX complexes. Same quantity of lysates from MCF-7 cells with sirnas treatment was used for co-ip with anti- or anti-max antibodies. (E) Reporter assay of WT- and Δ- truncated mutant on CCNA-Luc. (F) Western blot of p1 and Cyclin A in MCF-7 cells transfected with sirnas followed by overexpression of indicated vectors. (G) qrt-pcr analysis of knockdown efficiency of LNA in MCF-7 cells. Error bars indicate mean ± SD, n = 3 for technical replicates. p.5, p.1. NS, not significant.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback