Supplemental Figure 1 A

Similar documents
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Recombinant Protein Expression Retroviral system

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplemental Figure 1

Supplementary Figures

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

SUPPLEMENTARY INFORMATION

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Nature Genetics: doi: /ng.3731

SUPPLEMENTARY FIGURES

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

SUPPLEMENTARY INFORMATION

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplementary Information. Supplementary Figure 1

Sirt1 Hmg20b Gm (0.17) 24 (17.3) 877 (857)

Supporting Information Table of Contents

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Supplementary Figure S1 Supplementary Figure S2

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

SUPPLEMENTARY INFORMATION

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

Supplementary Figure 1

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice

SUPPLEMENTARY FIGURES AND TABLE

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

SUPPLEMENTARY FIGURES

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Supplementary Information Titles Journal: Nature Medicine

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplementary Fig. S1. Schematic diagram of minigenome segments.

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Materials and Methods

Nature Structural & Molecular Biology: doi: /nsmb.2419

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

ddm1a (PFG_3A-51065) ATG ddm1b (PFG_2B-60109) ATG osdrm2 (PFG_3A-04110) osdrm2 osdrm2 osdrm2

Supplementary Materials for

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Nature Medicine: doi: /nm.4322

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplementary Information

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors

Supplementary Materials

Supplementary Figure 1

A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

Supplementary Figures

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

Supplementary information

Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Supplemental Figures Legends and Supplemental Figures. for. pirna-guided slicing of transposon transcripts enforces their transcriptional

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Supplementary Figures

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

Recruitment of HBO1 Histone Acetylase and Blocks

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Supplementary Materials for

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Transcription:

Supplemental Figure 1 1 2 3 4 2 FLG-ZFP89 endogenous ZFP89 CTIN 1. F9 2. F9 [S/FLG-Zfp89] 3. ESC 4. ESC [2lox/FLG-Zfp89]. Zfp89 ESC Flag-ZFP89 expression/endogenous ZFP89 expression 1 1 ECCs ESCs ChIP-seq Cell type Transgene ntibody ChIP protocol Sequencing strategy FLG-ZFP89_ECC F9 ECC Multi copy S transposon FLG-ZFP89_ESC ESC 2lox single copy insertion ZFP89_ESC ESC - FLG-ZFP89_ESC #2 ESC 2lox single copy insertion ZFP89_ESC #2 ESC - No. of called MCS peaks Mean peak enrichment Mean peak p-value Mean peak FDR (%) FLG O Geen et al. 21 Illumina, single-end 917 2.2.E-14.6 FLG arish et al. 21 Illumina, single-end 1224 13.8 2.9E-7 8.3 ZFP89 (763) arish et al. 21 Illumina, single-end 111 13.6 4.E-7 69.3 FLG-ZFP89 _ECC MCS peak enrichment FLG-ZFP89 F9 ECC FLG-ZFP89 ESC (+Dox) ZFP89_763 ESC FLG-ZFP89 ESC (-Dox) Input control ESC 1 1 2 917 FLG-ZFP89_ECC ChIP-seq peaks (sorted by enrichment) FLG O Geen et al. 21 SOLiD, paired-end n.d. n.d. n.d. n.d. ZFP89 (763) O Geen et al. 21 SOLiD, paired-end n.d n.d. n.d n.d C FLG-ZFP89 ESC #2 (+Dox) ZFP89_763 ESC #2 Supplemental Figure 1. () (left panel) Western blot was performed with whole cell lysates from FLG ZFP89 expressing F9 ECCs and ESCs that were used for ChIP seq analysis. Endogenous ZFP89 and FLG ZFP89 were detected using a polyclonal ZFP89 antibody (kindly provided by Stephen Goff). (right panel) Quantification of FLG ZFP89 overexpression in F9 ECCs and ESCs using ImageJ. () Summary of ZFP89 ChIP seq strategies. Peaks were called by Model based nalysis of ChIP Seq (MCS). Peak calling was not performed with FLG ZFP89_ESC #2 and ZFP89_ESC #2 data due to the lack of proper input control data. n.d.: not determined. (C) Heat maps with mapped ChIP seq reads generated by different ChIP seq strategies. Peaks were called using Model based nalysis of ChIP Seq(MCS)withFLG ZFP89_ECC data and used as reference sites (extending 1 kb up and downstream of the peak summit). The dotted line indicates the fold enrichment value that was set as threshold for strong FLG ZFP89_ECC peaks. ChIP seq with FLG antibody in uninduced 2lox [FLG Zfp89] ESCs (not expressing FLG ZFP89) was performed as negative control.

Supplemental Figure 2 1% 1% Proportion of ERV1 elements 9% 8% 7% 6% % 4% 3% 2% 1% % Strong FLG ZFP89 peaks Genome Other ERV1 LTRIS_Mus LTRIS_Mm MMVL3 int MMERGLN int MuRRS int RLTR6_Mm RLTR6 int Proportion of peaks with target motif 9% 8% 7% 6% % 4% 3% 2% 1% % no motif PS-pro like motif PS-pro C 6 FLG-ZFP89_ECC. FLG-ZFP89_ESC.4 ZFP89_ESC mapped read 4 3 2 1 mapped read.4.3.2.1 mapped read.3.2.1 PS-pro (MmERV) non-rep peaks - 3 kb + 3kb. - 3 kb + 3kb - 3 kb + 3kb. Supplemental Figure 2. nalysis of FLG ZFP89 ChIP seq peaks. () Categorization of ERV1 elements overlapping with strong (enrichment > ) FLG ZFP89 ChIP seq peaks in F9 ECCs compared to all genomic ERV1 elements in the mouse genome. ERV1 elements were categorized according to their UCSC Repeatmasker annotation. The suffix int indicates that the repeat is an internal ERV1 sequence, all other repeats are LTR sequences. () Proportion of ChIP seq peaks that contain a perfect PS pro site or a PS pro like target motif (derived from the 1 ttop scored non repetitive FLGZFP89_ECC peaks). The 2 bp core regions of all FLG ZFP89 peaks or control regions 2 kb upstream of the ChIP seq peaks were screened for target motifs under stringency settings allowing five false hits per 1 kb. Peaks were categorized according to their enrichment over the input control. (C) NGS plots showing average FLG ZFP89_ECC, FLG ZFP89_ESC and and ZFP89_ESC ChIP seq read densities at 6 kb regions around genomic MmERV PS pro (n=93) and strong non repetitive FLG ZFP89_ECC ChIP seq peaks (n=138).

Supplemental Figure 3 FLG-ZFP89_ECC FLG-ZFP89_ECC Input Input Cacna1g Zfp36 chr11:94,264,99-94,339,883 chr7:29,19,398-29,167,883 FLG-ZFP89_ECC FLG-ZFP89_ECC Input Input Sos1 Serping1 chr17:8,788,6-8,891,87 chr2:84,6,23-84,617,184 Zfp36 target Sos1 target Cacna1g target PS-pro target LJ-QdMLPEnh- MoLTR PS-gln PS-pro dmlp neo MoLTR % of normalized plj-q titer 14 12 1 8 6 4 2 Supplemental Figure 3. Non repetitive ZFP89 target sites do not induce efficient silencing of retroviral vectors. () Integrative Genome rowser(igv) view of a selection of strong FLG ZFP89_ECC peaks near gene promoters containing PS pro like target motifs with mapped FLG ZFP89_ECC ChIPseq and Input control read densities. ()(left panel) 29 bp oligos, containing PS pro like ZFP89 target motifs identified in ChIP seq peaks close to gene promoters including 11 bp downstream flanking regions, or the PS pro sequence including the 11 bp downstream region of the Moloney Murine Leukemia Virus (MLV) PS pro were inserted upstream of the dmlp promoter of the retroviral LJQdMLPEnh vector (Modin C, Pedersen FS, Duch M. 2. Lack of shielding of primer binding site silencer mediated repression of an internal promoter in a retrovirus vector by the putative insulators scs, ED 1, and HS4. J Virol 74: 11697 1177). (right panel) F9 ECCs and NIH/3T3 fibroblasts were transduced in parallel with serial dilutions of retroviral particles containing the indicated ZFP89 target sequences. Viral titers (CFU/ml) for each vector were determined by counting resistant colonies after G418 selection. Viral titers in F9 cells were normalized to titers in NIH/3T3 cells and are shown relative to the normalized titer of a vector containingthe empty LJQdMLPEnh vector. Graphs show mean normalized titers as percent relative to the empty control vector (n=2, technical replicates). Error bars represent s.d.

Supplemental Figure 4 % of input 4. 3. 3. 2. 2. 1. 1.. KP1 % of input (normalized) 4 4 3 3 2 2 1 1 H3K9me3 % of input (normalized) 3 3 2 2 1 1 H4K2me3 F9 F9 [ps/flg- Zfp89]. 24.7 ±3.1 Fold change in expression 2. 1.8 1.6 1.4 1.2 1..8.6.4.2. F9 [ps/empty] F9 [ps/flg-zfp89] Supplemental Figure 4. Heterochromatin formation and transcriptional silencing of FLG ZFP89 target genes upon FLG ZFP89 overexpression. () ChIP qpcr analysis of FLG ZFP89 binding sites in FLG ZFP89 overexpressing F9 cells. Cross linked chromatin of F9 cells and F9 cells stably expressing FLG ZFP89 was immunoprecipitated with antibodies against KP1, H3K9me3 (bcam, ab8898) or H4K2me3 (bcam, ab93). Enrichment at target regions was determined by qpcr. Graphs show mean enrichment over input (n=3, technical replicates). Error bars represent s.d. H3K9me3 and H4K2me3 ChIP qpcr data were normalized to equal enrichment atthemest promoter, a known KP1 binding sitethatis notenriched in FLG ZFP89. () RT qpcr expression analysis of FLG ZFP89 target genes in FLG ZFP89 overexpressing F9 cells. Graphs show mean fold enrichment (n=3, technical replicates) over expression in F9cells (normalized toctin) stably transfected with an empty control vector. Error bars represent s.d.

Supplemental Figure mapped reads 6 4 2 MmERV-pro MmERV-gly FLG-ZFP89_ECC mapped read 1 8 6 4 2 VL3-pro VL3-gly FLG-ZFP89_ECC mapped reads.6.4.2 KP1 (ESC) mapped read 1.8.6.4.2 KP1 (ESC) mapped reads.8.6.4.2 SETD1 (ESC) mapped read..4.3.2.1 SETD1 (ESC).3.4 mapped reads.2.1. H3K9me3 (ESC) mapped read.3.2.1 H3K9me3 (ESC) 1 kb 6 kb Supplemental Figure. Differential repressor binding patterns at MmERV and VL3 subgroups using different PS sequences. NGS plots show average ChIP seq read densities at 1 kb or 6 kb regions around genomic MmERV pro (n=93) and MmERV gly (n=69) (left panel), and VL3 pro (n=1) and VL3 gly (n=6) elements (right panel). Yellow rectangles indicate coding regions for retroviral proteins, red rectangles indicate LTRs. In addition to FLG ZFP89 ChIP seq data from F9 ECCs, previously published KP1 (SR accession: SRR61129), SETD1 (SR accession: SRR31683) and H3K9me3 (SR accession: SRR61121) ChIP seq data (all generated in ESCs) were re aligned to the mouse genome as described in the methods section.

Supplemental Figure 6 Zfp89 GT Zfp89 KO-first FLP recombination Zfp89 FL Cre recombination Zfp89 KO (-) Supplemental Figure 6. Schematic representation of Zfp89 gene trap (GT) and knock out first (KO first) alleles used to generate mutant mice. Grey rectangles represent Zfp89 exons. The two recombination steps in which the KO first allele turns into a KO ( ) allele are shown.

Supplemental Figure 7 1. ChIP 2. ChIP H3K9me3 H3K4me3 2. % of input.8.7.6..4.3.2.1. % of input 2 2 1 1 Enrichment at VL3-pro % of input (1. ChIP) 2. 1. 1... H3K9me3 H3K4me3 IgG H3K9me3 H3K4me3 IgG 1. ChIP: H3K9me3 1. ChIP: H3K4me3 pcpgl-vl3-3 [EcoRI, sshii] CpG methylation: - + DN ladder (bp) 2 2 1 1 7 2 Supplemental Figure 7. () (left panel) H3K9me3 and H3K4me3 enrichment at ERVs and the Gapdh promoter in Zfp89 MEFs after one round of ChIP. (right panel)re ChIPanalysis of H3K9me3 and H3K4me3 atvl3 pro. Chromatin immunoprecipitated with H3K9me3 or H3K4me3 specific antibodies was immunoprecipitated a second time with the indicated antibodies. Enrichment is shown as mean percentage of the corresponding input samples (n=3, technical replicates). Error bars represent s.d. () In vitro methylation of CpG free luciferase vectors. (left) Vector map of the pcggl plasmid with an inserted VL3 pro LTR element (including PS). CpG sites and restriction sites for EcoRI and sshii are indicated. The sshii site overlaps with two CpG sites and is inhibited by CpG methylation. (right) Unmethylated and CpG methylated plasmids were digested with EcoRI and sshii and run on an agarose gel to visualize fragment lengths. The two larger fragments of the digested unmethylated plasmid are both about 2 kb long and therefore appear as a single bond.

Supplemental Figure 8 ERV expression (U) 6 4 3 2 1 VL3-pro MmERV-pro +/+ +/+ +/+ +/+ +/+ +/+ ESC MEF Relative ERV expression 12 1 8 6 4 2 E9. embryos +/+ +/+ -/+ -/+ -/- -/- VL3-pro MmERV-pro C D E Relative ERV expression 1.6 1.4 1.2 1..8.6.4.2. Luciferase activity (U) 3 2 2 1 1 E3. embryos +/+ -/- VL3-Pro Zfp89 KP1 CTIN MEF ESC ESC MEF ipsc ZFP89 CTIN WT ESC WT MEF WT ipsc ipsc Supplemental Figure 8. () RT qpcr analysis of MmERV pro and VL3 pro expression in Zfp89 GT ESCs and MEFs. ERV expression was normalized to Hprt and is shown in arbitrary units (U). Graphs show mean expression (n=3, technical replicates). Error bars represent s.d. () VL3 pro expression in Zfp89 knock out embryos. Two E9. littermate embryos of each genotype were analyzed. Values represent mean expression (normalized to Hprt) relative to one WT embryo (n=3, technical replicates). Error bars represent s.d. (C) Five to six preimplantation embryos per genotype were harvested at E3. and pooled for RN purification and RT qpcr analysis. Values represent mean expression (normalized to Gapdh) relative to Zfp89 +/+ embryos (n=3, technical replicates). Error bars represent s.d. (D) (left panel) Western blot with whole cell lysates of Zfp89 and ESCs, MEFs and ipscs using antibodies against KP1 or CTIN. (right panel) Western blot with whole cell lysates of WT ESCs, MEFs and ipscs using antibodies against ZFP89 (763) or CTIN. Cell lysates of Zfp89 ipscs were blotted to confirm the identity of the ZFP89 band. (E) Promoter activity of subcloned VL3 pro and MmERV pro LTR elements (including PS pro) in indicated cell types using dual luciferase assay in transiently transfected cells. Luciferase activity was normalized to Renilla Luciferase activity of a cotransfected plasmid. ssay was performed in triplicates. Error bars represent s.d. LTR sequences are shown in Supplemental Fig. 9.

Supplemental Figure 9 Supplemental Figure 9. lignment of VL3 pro and MmERV pro LTR sequences that have been tested for transcriptional activity (Supplemental Fig. 8E).

Supplemental Figure 1 C FLG F9 F9 [S/FLG-Zfp89] ESC ESC [2lox/FLG-Zfp89] MEF [Ctrl] MEF[S/FLG-Zfp89] MEF [Ctrl] MEF [S/FLG-Zfp89] Flag-ZFP89 Endog. ZFP89 ESC [2lox/FLG-Zfp89] ESC MEF [Ctrl] MEF [FLG-Zfp89] MEF [Ctrl] MEF [FLG-Zfp89] Input IP FLG FLG-ZFP89: - + - + KP1 FLG CTIN CTIN D E % of input 7 6 4 3 2 1 VL3-pro FLG [Ctrl] [S/FLG-Zfp89] Gapdh PS-gly / PS-pro titer 1.4 1.2 1..8.6.4.2. [Ctrl] [S/FLG- Zfp89] F G 8 ESC H3K9me3 3. MEF H3K9me3 % of input 7 6 4 3 2 1 +/+ [Ctrl] [Ctrl] [S/FLG-Zfp89] % of input 2. 2. 1. 1.. [Ctrl] [Ctrl] [S/FLG-Zfp89] VL3-pro Gapdh. VL3-pro Gapdh Supplemental Figure 1. () Western blot with whole cell lysates of FLG ZFP89 overexpressing F9 and ESCs and FLG ZFP89 complemented MEFs using antibodies against the FLG epitope or CTIN. () Western blot with whole cell lysates of FLG ZFP89 overexpressing ESCs and FLG ZFP89 complemented MEFs using antibodies against endogenous ZFP89 (kindly provided by Stephen Goff) or CTIN. (C) Wholecell lysates from Zfp89 MEFs stably transfected with S/FLG Zfp89 (+) or an empty control vector ( ) were immunoprecipitated with FLG antibody. 1% input controls and FLG immunoprecipitates were analyzed by western blot using anti FLG and anti KP1 antibodies. (D) ChIPqPCR analysis of FLG ZFP89 recruitment to VL3 pro ERVs in FLG ZFP89 complemented Zfp89 MEFs. Enrichment is shown as mean percentage of input DN (n=3, technical replicates). Error bars represent s.d. (E) Control and FLG ZFP89 complemented Zfp89 MEFs were transduced with retroviral vectors containing PS pro or the repression escape mutant PS gly upstream of a hygromycin resistance gene and treated with 2 µg/ml hygromycin for ten days to determine viral titers (CFU/ml). Graphs show the mean ratios of PS gly/ps pro viral titers as determined in three replicates. Error bars represent s.d. (F) ChIP qpcr analysis of H3K9me3 at VL3 pro elements in FLG ZFP89 complemented Zfp89 MEFs. Enrichment is shown as mean percentage of input DN (n=3, technical replicates). Error bars represent s.d. (G) NChIP qpcr analysis of H3K9me3 at VL3 pro elements in FLG ZFP89 complemented Zfp89 ESCs. Enrichment is shown as mean percentage of input DN (n=3,technical replicates). Error bars represent s.d.

Supplemental Figure 11 Zfp89 homology (%) DN Protein ds/dn ds/dn (specificity aa) M. spicilegus 98.3 99. 34.9 - M. spretus 98.8 99. 23.2 - M. caroli 97.9 99. 19.4 - M. dunni 97.2 97.9 11.6 - M. pahari 94.6 92.7 4.4 3.6 C. griseus 81.9 8.2 4.3 21. N. galili 8.7 76.6 4. 8.7 Supplemental Figure 11. Conservation of the DN binding domain of putative ZFP89 orthologues. (top) Homology and synonymous to nonsynonymous mutation ratios (ds/dn) of the 79 bp DN binding region of Zfp89 in wild Mus species relative to M. musculus. (bottom) lignment of translated ZFP89 DN binding domains identified in Muroidea species. The positions of the seven C2H2 zinc finger domains are marked by black rectangles. The amino acids known to be directly responsible for binding specificity (specificity aa) are marked by asterisks on top of the alignment. ZFP89 DN binding domains of Mus species were sequenced from genomic DN samples. The putative ZFP89 DN binding sequences of C. griseus (NCI accession: XP_3164) and N. galili (Genank: JO2639) were identified by LST searches. The JO2639 sequence contains a single nucleotide deletion in the fourth zinc finger domain, causing a frame shift mutation. The deletion, located after six consecutive adenine bases and possibly theresult of a sequencing error was manually corrected to reconstruct the ORF.

Supplemental Figure 12 Gene base Mean base log2fold change Spleen lfcse pvalue padj base mean base log2fold change MEF lfcse pvalue padj Zfp89 196. 17.8-3.46.24 6.E-48 2.3E-44 12.4 2.3-2.63.2 1.4E-26 7.E-23 Tdrd9 173. 6248.1.17.32 1.7E-7 9.8E-4 34.3 1.2 1.62.28 1.E-8 2.6E- Gm97 13.6 141.7 2.94.27 1.4E-28 2.8E-2 2.8 31..26.28 3.E-1 1.E+ Dnahc7a 9.1 84. 3.3.37 1.8E-19 7.4E-17 3. 8.4 1.48.28 1.4E-7 3.E-4 spleen RN-seq WT spleen MEF MEF H3K9me3 ESC ChIP-seq H3K9me3 WT ESC ZFP89 ESC #2 FLG-ZFP89 ESC #2 FLG-ZFP89 F9 ECC Refseq genes LTR repeats Dnah7a spleen RN-seq WT spleen MEF MEF H3K9me3 ESC ChIP-seq H3K9me3 WT ESC ZFP89 ESC #2 FLG-ZFP89 ESC #2 FLG-ZFP89 F9 ECC Refseq genes LTR repeats Cyp4f37 Supplemental Figure 12. () Statistical analysis of differential gene expression in Zfp89 GT mice. RN seq data from Zfp89 and MEFs or +/+ and spleen samples (two independent MEF lines/mice per genotype) were analysed using DESeq (nders S, Huber W. 21. Differential expression analysis for sequence count data. Genome iol 11: R16.). () RN seq and ChIP seqreaddensityatdnah7a (top) andcyp4f37 (bottom).

Supplementary methods: Re ChIP Chromatin was harvested from cross linked Zfp89 MEFs as described previously (arish et al. 21). riefly, chromatin from 1.4 1 6 cells was immunoprecipitated with 1 µg H3K9me3 (abcam ab8898), 1 µg H3K4me3 (abcam ab88). fter washing, immunoprecipitated chromatin was eluted with Re ChIP IT elution buffer (Re ChIP IT kit, ctive Motif), desalted, and immunoprecipitated for the second time with 1 µg H3K9me3 (abcam ab8898), 1 µg H3K4me3 (abcam ab88) or 1 µg unspecific IgG according to the manufacturers protocol. Target enrichment was determined by qpcr. Immunoprecipitation (IP) CellswerelysedinRIPbufferandwholecellextractswerediluted1:1inIPbuffer(1mM Tris HCl [ph 7.]; 1% NP4; 1 mm NaCl) and incubated with Flag garose beads (Sigma) over night at 4 C. eads were washed times with IP buffer before western blot analysis.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback