Beneficil Microes, 2014; 5(4): 437-445 Wgeningen Acdemic P u l i s h e r s Potentil proiotic Bifidocterium nimlis ssp. lctis 420 prevents weight gin nd glucose intolernce in diet-induced oese mice L.K. Stenmn 1*, A. Wget 2, C. Grret 2, P. Klopp 2, R. Burcelin 2 nd S. Lhtinen 1 1 DuPont Nutrition nd Helth, Active Nutrition, Sokeritehtntie 20, 02460 Kntvik, Finlnd; 2 INSERM1048, Institut des Mldies Métoliques et Crdiovsculires de Rngueil, Rngueil Hospitl, 31432 Toulouse, Frnce; lott.stenmn@dupont.com Astrct Received: 3 Ferury 2014 / Accepted: 19 June 2014 2014 Wgeningen Acdemic Pulishers RESEARCH ARTICLE Altertions of the gut microiot nd mucosl rrier re linked with metolic diseses. Our im ws to investigte the potentil enefit of the potentil proiotic Bifidocterium nimlis ssp. lctis 420 in reducing high-ft dietinduced ody weight gin nd dietes in mice. In the oesity model, C57Bl/6J mice were fed high-ft diet (60 energy %) for 12 weeks, nd gvged dily with B. lctis 420 (10 9 cfu) or vehicle. In the dietes model, mice were fed high-ft, ketogenic diet (72 energy % ft) for 4 weeks, with 6-week susequent tretment with B. lctis 420 (10 8-10 10 cfu/dy) or vehicle, fter which they were nlysed for ody composition. We lso nlysed glucose tolernce, plsm lipopolyscchride nd trget tissue inflmmtion using only one of the B. lctis 420 groups (10 9 cfu/dy). Intestinl cteril trnsloction nd dhesion were nlysed in seprte experiment using n Escherichi coli gvge. Body ft mss ws incresed in oth oese (10.7±0.8 g (men ± stndrd error of men) vs. 1.86±0.21 g, P<0.001) nd dietic mice (3.01±0.4 g vs. 1.14±0.15 g, P<0.001) compred to helthy controls. Tretment with B. lctis 420 significntly decresed ft mss in oese (7.83 ± 0.67 g, P=0.007 compred to oese with vehicle) nd dietic mice (1.89 ± 0.16 g, P=0.02 for highest dose). This ws reflected s reduced weight gin nd improved glucose tolernce. Furthermore, B. lctis 420 decresed plsm lipopolyscchride levels (P<0.001), liver inflmmtion (P=0.04), nd E. coli dhesion in the distl gut (P<0.05). In conclusion, B. lctis 420 reduces ft mss nd glucose intolernce in oth oese nd dietic mice. Reduced intestinl mucosl dherence nd plsm lipopolyscchride suggest mechnism relted to reduced trnsloction of gut microes. Keywords: dietes, oesity, intestinl permeility, mice, proiotics 1. Introduction A drmtic rise in the incidence of oesity over the lst decdes hs given rise to n rry of oesity-ssocited metolic disturnces. Mny of these re suspected to stem from chronic low-grde inflmmtion, which hs ecome well-recognised risk fctor for metolic disese (Hotmisligil, 2006). The cuses of low-grde inflmmtion hve long een unknown, ut recent dvnces hve reveled mechnism relted to the lekge of inflmmtory molecules from cteril origin, such s lipopolyscchrides (LPS) (Cni et l., 2007) or peptidoglycn (Amr et l., 2011; Schertzer et l., 2011) from the gut. The rise in the sl concentrtion of lood LPS is known s metolic endotoxemi. However, constnt mildly elevted plsm concentrtion of LPS is proposed to cuse lowgrde inflmmtion nd predispose to metolic disese s cuslly demonstrted in the triggering of metolic inflmmtion in mice (Cni et l., 2007) nd ssocited to the disese in humn (Pussinen et l., 2011). Metolic endotoxemi cn e induced in mice using high-ft diet (HFD) (Cni et l., 2007, 2008; Crvlho et l., 2012; De l Serre et l., 2010; Everrd et l., 2012; Kim et l., 2012; Serino et l., 2012), ut the mechnisms for incresed LPS sorption nd trnsloction towrds tissues ssocited with HFD re unknown. Proposed hypotheses include chylomicron-fcilitted LPS-trnsport ISSN 1876-2833 print, ISSN 1876-2891 online, DOI 10.3920/BM2014.0014 437
L.K. Stenmn et l. (Ghoshl et l., 2009), decresed mucosl clernce of LPS y lkline phosphtse (De l Serre et l., 2010), nd gut rrier disruption y vrious mechnisms relted to the gut microiot, such s n overly ctive gut endocnninoid system (Muccioli et l., 2010), or ltered luminl ile cid profile (Stenmn et l., 2012, 2013). Recent findings from our lortory demonstrted the key role of metolic endotoxemi in incresing predipocyte nd mcrophge prolifertion in dipose tissue (Luche et l., 2013). Circulting LPS hs een cuslly linked to the development of mouse oesity (Cni et l., 2007). As germ-free mice re resistnt to oesity cused y HFD (Bckhed et l., 2007; Rot et l., 2010), the gut microiot nd gutderived endotoxins hve een proposed to prticipte in the development of diet-induced oesity in mice. The mouse knock-out for CD14, which is required for the recognition of LPS y toll-like receptor 4, is resistnt to oesity cused y sucutneously dministered LPS (Cni et l., 2007). The LPS-TLR4 pthwy my thus ply role in the development of oesity in HFD-fed mice. Hence, we recently proposed tht the trnsloction of cteri from the intestinl mucos towrds tissues such s the dipose depot ws responsile for the triggering of metolic inflmmtion (Amr et l., 2011). The trnslocted cteri nd cteril frgments stimulted the prolifertion of dipose tissue precursors nd fvoured ody weight gin through process ssocited with LPS-induced inflmmtion of dipose tissue mcrophges (Luche et l., 2013). Hence, the former nd ltter rguments strongly suggest tht treting mucosl microil ecology would meliorte energy metolism nd ody weight mngement. It is n on-going struggle to find effective tretment strtegies for oesity nd metolic syndrome. Among newly emerging pproches, proiotics hve shown potentil efficcy in improving glucose tolernce (Andresen et l., 2010; Asemi et l., 2013) nd weight gin (Kdook et l., 2010, 2013) in humns. As we hve shown in mouse model of HFDinduced dietes, Bifidocterium lctis 420 (B420) my improve glucose tolernce nd reduce tissue inflmmtory sttus (Amr et l., 2011), suggesting enefit in metolic disese. Our im ws to study whether B420 my tret or prevent diposity y reducing metolic endotoxemi nd gut cteril trnsloction in mice. These were investigted in diet-induced oese nd dietic niml models. 2. Mterils nd methods Animls Mle C57Bl/6J mice were purchsed from Chrles River (Sulzfeld, Germny), nd housed in stndrd niml fcility with food nd wter d liitum. At eight weeks of ge, mice were llocted to one of the two experimentl designs. Oesity nd weight-relted outcomes were studied in oth models, while mechnisms were explored in the dietic model only. The experimentl procedures were pproved y the locl ethics committee of the Rngueil Hospitl. Oesity model Mice were fed HFD contining 60 energy % ft or lowft diet with 12 energy % ft for 12 weeks (Reserch Diets, New Brunswick, NJ, USA). For the entire durtion of the experiment, mice were gvged dily with the proiotic B420 (ATCC: SD6685) (10 9 cfu/dy) or wter (controls). Dietes model Dietes ws induced with ketogenic diet (KD) contining 72 energy % ft (mize oil nd lrd), 28 energy % protein nd <1 energy % crohydrte (Sfe, Augy, Frnce), which ws given for four weeks. This diet hs een previously shown to cuse fsting hyperglycemi, glucose intolernce nd insulin resistnce fter one month of feeding (Burcelin et l., 2002). This diet impirs glucose induced insulin secretion. The mice re considered hypoinsulinemic, which strongly reduces HFD-induced oesity. The nimls of this model cn e considered to hve len dietes. They cn thus e compred with the oesity model to study the effects of proiotic tretment on glucose metolism without the impct of ody weight gin. Control mice were fed stndrd chow. After the four-week consumption of the experimentl diets, mice were gvged with either B420 (10 8, 10 9 or 10 10 cfu/dy) or wter (control), for six more weeks. Only ody composition nlyses were mde for ll doses. Only the dose 10 9 cfu/dy ws used for further experimenttion. Body composition mesurements y EchoMRI The ody composition of the mice, including the ft nd len msses, ws nlysed y NMR using EchoMRI-100TM equipment (Echo Medicl Systems, Houston, TX, USA) fter six weeks (Oesity model) or four weeks (Dietes model) of tretment with or without proiotics. Intrperitonel glucose tolernce tests An intrperitonel glucose-tolernce test ws performed fter six (Oesity model) or four (Dietes model) weeks of tretment with B420 to otin n index of glucose mngement in mice. Briefly, 6-h fsted mice were injected with glucose (1 g/kg) into the peritonel cvity. The glycemi ws followed 30 min efore the glucose chllenge nd then every 30 min using glucose meter (Roche Dignostics, Bsel, Switzerlnd). An index for glucose-induced glycemi ws clculted s µm/min y dividing the men lood glucose t 30-90 y 60 min. 438 Beneficil Microes 5(4)
B420, ft mss nd glucose intolernce in oese mice Anlysis of metolic endotoxemi Plsm LPS levels were mesured with kit sed on Limulus meocyte extrct (LAL kit; Cmrex BioScience, Wlkersville, MD, USA); smples were diluted 1:50 nd heted for 10 min t 70 C. Quntifiction of tissue inflmmtion mrkers RNA ws extrcted from sucutneous dipose tissue, liver nd skeletl muscle (vstus lterlis), reverse trnscried, nd nlysed with qpcr trgeting tumour necrosis fctor lph (TNF-α), interleukin (IL)-1β, IL-6 nd plsminogen ctivtor inhiitor-1 (PAI-1), with riosoml protein PL19 (RPL19) s endogenous control for reltive quntifiction. The primers used were: TNF-α forwrd CATCTTCTCAAAATTCGAGTGACAA, reverse TGGGAGTAGACAAGGTACAACCC; IL-1β forwrd TCGCTCAGGGTCACAAGAAA, reverse CATCAGAGGCAAGGAGGAAAAC; PAI-1 forwrd ACAGCCTTTGTCATCTCAGCC, reverse CCGAACCACAAAGAGAAAGGA; IL-6 forwrd TAGTCCTTCCTACCCCAATTTCC, reverse TTGGTCCTTAGCCACTCCTTC; RPL19 forwrd GAAGGTCAAAGGGAATGTGTTCA, reverse CCTTGTCTGCCTTCAGCTTGT. An index ws clculted s the men expression of ll inflmmtion mrkers for ech tissue seprtely. Quntifiction of the trnsloction nd mucosl dherence of Escherichi coli A seprte experiment with four mice per group ws performed for trnsloction nd dherence experiments. Mice were fed with KD nd gvged with B420 (10 9 cfu/dy) or vehicle. After five weeks of tretment, mice were gvged with 10 9 cfu Escherichi coli (isolted from mouse colon), nd scrificed 2 h lter. Liver, spleen, sucutneous nd mesenteric dipose tissue, nd the corresponding gnglions were hrvested, nd luminl nd mucosl contents of ech intestinl segment were seprted. Tissues were homogenised in Luri Broth (Gico; Life Technologies, Drmstdt, Germny), plted onto mpicillin-supplemented (100 µg/ml) Luri Broth gr, nd yellow colonies were enumerted fter overnight incution t 37 C. Sttisticl nlysis Dt were nlysed using GrphPd Prism 6 (GrphPd Softwre Inc., Sn Diego, CA, USA) nd SPSS Sttistics 21 (IBM, Armonk, NY, USA). All dt were nlysed with ANOVA. If the glol P ws significnt, Bonferroni s multiple comprisons test ws used to ssess differences etween groups. For dherence nd trnsloction, zero vlues were replced with hlf of the smllest possile vlue, nd logrithm trnsformtion ws run to otin Norml distriution efore sttisticl testing. All dt re expressed s men ± stndrd error of men, nd significnces re two-sided. Differences were considered sttisticlly significnt when P<0.05. 3. Results Influence of Bifidocterium lctis 420 on weight nd ody ft mss The effect of B420 on diposity ws studied in two mouse models. In the oese prevention model, tretment with the potentil proiotic is initited together with the HFD (60 energy % ft). In this model, B420 significntly reduced weight gin compred to the high-ft control (Figure 1A). An nlysis of ody composition y EchoMRI reveled tht the increse in ody ft mss in diet-induced oese mice ws mrkedly prevented y B420 during six weeks of feeding (P=0.007), wheres there ws no effect on len mss (P=1.00) (Figure 1B). At seline, there hd een no differences in ody ft mss (Control 1.11±0.05 g, HFD 1.23±0.14 g, HFD+B420 1.29±0.19 g) or len mss (Control 19.09±0.34 g, HFD 20.44±0.24 g, HFD+B420 20.21±0.28 g). In the dietic tretment-model, mice ecome dietic following four-week induction phse eting KD (72 energy % ft). In this model, the KD group hd significntly more ft mss (P<0.001) (Supplementl Figure S1B), despite the lck of ody weight chnge (Supplementl Figure S1A). Ft mss expnsion ws meliorted y tretment with B420 t 10 10 cfu/dy (P=0.020), nd there ws mrked trend of ft mss reduction y 10 9 cfu/dy (P=0.066). Len mss ws significntly reduced in ll mice on KD (P<0.01 for ll vs. control), nd ws not ffected y B420. Glucose tolernce in Bifidocterium lctis 420-treted mice We performed intrperitonel glucose tolernce tests to HFD mice fter six weeks of ftty diet with or without B420, nd to KD mice fter four weeks of tretment. In dietinduced oese mice, the B420-treted group demonstrted significntly lower glycemi compred to ft-fed mice (Figure 2A). Respectively, glucose-stimulted glycemi ws reduced y B420 tretment (Figure 2B). Interestingly, lso the fsting lood glucose in B420-treted mice (6.9±0.4 mm) ws significntly lower compred to HFD mice (8.2±0.4 mm, P<0.05), nd comprle to tht of control mice (6.7±0.3 mm). In the dietic model with KD, the glucose-stimulted glycemi in B420-treted mice ws similr to tht of control mice (P=1.00), lthough it did not significntly differ from tht of KD mice without B420 (P=0.16) (Figure 2C-D). Beneficil Microes 5(4) 439
L.K. Stenmn et l. A Delt ody weight (%) 50 40 30 20 10 0-10 Control HFD HFD + B420 10 9 1 2 3 4 5 6 7 8 9 10 11 12 Weeks of tretment c Tissue weight (g) 25.0 20.0 15.0 15.0 12.5 10.0 7.5 5.0 2.5 0.0 Control HFD HFD + B420 10 9 Ft mss Len mss Figure 1. (A) Body weight chnge nd (B) ody composition during Bifidocterium nimlis ssp. lctis 420 (B420) tretment in diet-induced oese mice. Oese mice were fed high-ft diet (HFD) with 60 energy % ft. Body composition ws mesured with EchoMRI. Vlues re men ± stndrd error of the men from 10 mice per group. Groups without common letter differ significntly from ech other (ANOVA nd Bonferroni s multiple comprisons). B c A Blood glucose (mm) 25 20 15 10 5 Control HFD HFD + B420 10 9 c B Glycemic index 39-90 min (µm/min) 300 200 100 c C Blood glucose (mm), -30 0 30 60 90 Minutes 25 Control KD 20 KD + B420 10 9 15 10 5 0 D 300 200 100 Glycemic index 30-90 min (µm/min) Control HFD HFD B420 10 9, -30 0 30 60 90 Minutes 440 Beneficil Microes 5(4) 0 Control KD HFD B420 10 9 Figure 2. Glucose tolernce of diet-induced oese mice fter six weeks of tretment with Bifidocterium nimlis ssp. lctis 420 (B420) (A-B) nd of diet-induced dietic mice fter four weeks of tretment (C-D) in n intrperitonel glucose tolernce test. Oese mice were fed high-ft 60 energy % ft diet (HFD), wheres dietic mice were fed ketogenic 72 energy % ft diet (KD). Dietes ws induced with KD for four weeks efore proiotic tretment. An index of glucose-induced glycemi ws clculted s men lood glucose per minutes during 30-90 min fter glucose injection. Vlues re men ± stndrd error of the men from 10 mice per group (A-B) or 5-10 mice per group (C-D). Groups without common letter differ significntly from ech other (ANOVA nd Bonferroni s multiple comprisons).
B420, ft mss nd glucose intolernce in oese mice Mechnism of ction: intestinl cteril dherence nd trnsloction To investigte the possile role of metolic endotoxemi in the reduction of diposity y B420, we mesured plsm LPS levels, s well s mucosl dherence nd trnsloction of gvged E. coli in the dietic mouse model with KD. Plsm LPS levels were douled in the KD group (P<0.001) compred to control, ut restored to norml levels y B420 (P<0.001 compred to KD) (Figure 3A). Adherence ws clculted s the rtio of mucosl to luminl E. coli fter gvge. B420 sustntilly decresed mucosl dherence of gvged cteri in ileum nd cecum (P=0.034 nd P=0.021, respectively), ut not in duodenum nd jejunum (Figure 3B). There were no significnt differences in trnsloction of gvged E. coli, lthough ll tissues from B420-treted mice tended to give lower cfu counts compred to vehicle-treted mice (Figure 3C). Influence of Bifidocterium lctis 420 on heptic inflmmtion The KD incresed the expression of inflmmtory mrkers in liver (index +68% KD vs. Control, P=0.001) nd skeletl muscle (+64%, P=0.036), with tendency seen lso in sucutneous dipose tissue (+95%, glol P=0.099) (Tle 1). In B420-treted mice, ll men inflmmtory indices were lower thn in vehicle-treted KD mice (sucutneous ft -41%, liver -27%, skeletl muscle -8.3%), ut the difference ws significnt only in liver (P=0.041). A B Plsm LPS (EU/ml) 8 6 4 2 E. coli dherence to mucos 100 10 1 0.1 NS NS, Control KD KD + B420 10 9, 0 Control KD KD + B420 10 9 0.01 Duodenum Jejunum Ileum Cecum C 1,000,000 NS E. coli cfu/g of tissues 100,000 10,000 1000 100 10 Liver Spleen Sucut. dipose tissue Mesent. dipose tissue Sucut. gnglion Mesent. gnglion Figure 3. Gut rrier function in dietic mice fed with ketogenic diet (KD) nd treted with the potentil proiotic Bifidocterium nimlis ssp. lctis 420 (B420). (A) Plsm lipopolyscchride (LPS) levels were determined t week 6 of B420 tretment (n=9-10 per group). For (B) dhesion nd (C) cteril trnsloction, set of four mice per group were fed KD with concomitnt gvge of proiotic for five weeks, fter which they were gvged with Escherichi coli. Adherence ws clculted s mucosl/ luminl counts of E. coli. Trnsloction ws determined s cfu of E. coli in trget tissues. Groups without common letter differ significntly from ech other (ANOVA nd Bonferroni s multiple comprisons). Beneficil Microes 5(4) 441
L.K. Stenmn et l. Tle 1. Tissue inflmmtory mrkers in the diet-induced dietes mouse model. 1 Control KD KD + B420 10 9 ANOVA Sucutneous ft TNF-α 1.57±0.21 2 2.03±0.23 1.98±0.79 0.79 IL-1β 1.37±0.20 2.04±0.47 1.00±0.12 0.74 PAI-1 0.43±0.06 2.11±1.19 0.68±0.17 0.25 IL-6 0.75±0.12 1.85±0.45 1.07±0.35 0.11 Index 3 1.03±0.08 2.01±0.46 1.18±0.26 0.099 Liver TNF-α 1.32±0.17 2.28±0.26 1.60±0.18, 0.012 IL-1β 1.15±0.15 1.88±0.11 1.44±0.16, 0.008 PAI-1 0.98±0.12 1.77±0.29 1.35±0.37 0.17 IL-6 1.38±0.16 2.18±0.25 1.81±0.38 0.19 Index 1.21±0.09 2.03±0.13 1.48±0.18 0.002 Skeletl muscle TNF-α 0.94±0.09 1.82±0.26 1.85±0.32 0.015 IL-1β 1.00±0.11 1.63±0.16 1.21±0.21, 0.036 PAI-1 0.82±0.10 1.46±0.46 1.25±0.23 0.27 IL-6 1.06±0.17 1.33±0.15 1.70±0.46 0.30 Index 0.95±0.05 1.56±0.17 1.43±0.23, 0.021 1 n=6-10 per group. KD = ketogenic diet; B420 = Bifidocterium nimlis ssp. lctis 420. 2 Men ± stndrd error of the men; groups without common letter differ significntly from ech other (Bonferroni s multiple comprisons). 3 Index ws clculted s men of the reltive expression of the four individul cytokines. 4. Discussion We hve shown for the first time tht chronic tretment with B420 reduces ody weight gin nd ft mss ccumultion, nd improves glucose tolernce in HFDfed mice. Furthermore, B420 reduced cteril dherence to the intestinl mucos, plsm LPS levels nd heptic inflmmtion, which together point to mechnism relted to decresed cteril trnsloction y the tretment with B420. To identify the metolic effect of B420 tretment on metolic diseses we compred two different niml models. In the first model, diet-induced oesity ws induced y high-ft (60 energy %) diet, nd B420 ws gvged dily during the entire experiment to prevent oesity nd dietes. In the second model, the impct of B420 ws tested in n niml model of dietes which does not feture mjor ody weight gin: the mice were fed high-ft, KD for four weeks to induce dietes, s previously descried (Burcelin et l., 2002). The dt of the present study demonstrte tht B420 oth prevented nd treted ft mss ccumultion in two different models. Our previous work hs demonstrted B420 to lso improve glucose tolernce in the dietic model (Amr et l., 2011), lthough we could not confirm it here, which could e due to difference in the impct of the diet on this group of nimls. Nevertheless, the present work shows effectiveness in mouse model of oesity. Hence, the metolic effects of B420 were not linked to specific pthogenesis. Assuming similr effect in clinicl setting, such feture would e eneficil in treting metolic disese, since it enles effective use of the tretment in roder popultion with rnge of different pthogeneses. The present study reinforces the concept tht certin proiotics my e used in the prevention nd/or tretment of oesity nd diposity. While some previous reports hve shown vrious lctocilli (Kim et l., 2013; Prk et l., 2013; Sto et l., 2008), ifidocteri (Cno et l., 2013; Chen et l., 2011; Kondo et l., 2010) nd their comintion (Ydv et l., 2013) to reduce ody weight or ft mss in rodents nd humns, the present study is the first to show n effect for B. lctis strin nd to present new potentil mechnism for ft mss reduction. Weight reduction is stte of negtive energy lnce, which cn e conferred y three mechnisms: (1) reducing energy intke; (2) stimulting energy expenditure; or (3) inhiiting energy hrvesting or sorption y modulting gut microiot or other luminl components. We previously demonstrted tht the B420 strin reduced the impct of ft-enriched diet on insulin resistnce (Amr et l., 2011). No chnges in food intke were oserved during the tretment (dt not shown), however, the impct on glycemi suggested tht glucose ws used s n energy source, which could, in cse of oxidtion, e dissipted nd 442 Beneficil Microes 5(4)
B420, ft mss nd glucose intolernce in oese mice no longer stored. This hypothesis could contriute to the prevention of ody weight gin. In other instnces, recent report demonstrted tht proiotic product, VSL#3 comintion of four different lctocilli; three non-lctis strins of ifidocteri nd one strin of Streptococcus thermophilus reduced ody weight gin in mice y decresing feed intke (Ydv et l., 2013). However, in this study energy expenditure ws not ssessed. We do elieve tht comintion of severl mechnisms such s reduced food intke, incresed energy expenditure nd reduction of chronic inflmmtion could e responsile for the potentil eneficil effect of proiotics on ody weight gin. In the present study, we show new evidence suggesting tht the effect of B420 on diposity is relted to n improvement of intestinl rrier function. According to previous study, circulting endotoxins my induce weight-gin (Cni et l., 2007). Further, we hve recently shown tht cteril frgments, such s LPS, cn directly trigger dipose tissue precursor prolifertion to increse the numer of predipocytes (Luche et l., 2013). The ltter will then differentite into dipocytes in the presence of lrge mount of energy ville (Luche et l., 2013). Here we show tht B420 remrkly reduced metolic endotoxemi, which my hve contriuted to the ccompnying ft mss reduction nd meliortion of weight gin. In previous studies, B420 prevented mucosl pthogen dhesion nd improved tight-junction integrity in vitro (Colldo et l., 2007; Putl et l., 2008). To test our hypothesis in vivo, we used commensl E. coli isolted from mouse intestinl microiot. Two hours fter gvge, B420 hd significntly reduced mucosl dherence of the E. coli in the distl intestine, which points to the improvement of the mucosl rrier in proiotic-treted mice. Luminl LPS my trnslocte through the gut epithelium vi t lest two different routes: the prcellulr route through the tight-junctions, or trnscellulrly through enterocytes nd engged with chylomicron synthesis (Ghoshl et l., 2009). Generlly, molecules s lrge s LPS re elieved to trnslocte only trnscellulrly. Indeed, in helthy ptients LPS trnsloctes only trnscellulrly, wheres in ilel Crohn s disese ptients LPS is lso found in the prcellulr spce (Keit et l., 2008). This would point towrds n opening of the prcellulr pthwy in pthologicl stte. It hs not een definitively shown which pthwy, or oth, re ctivted in diet-induced oesity. However, previous report shows tht reduced expression of intestinl tight-junction proteins correltes with elevted intestinl permeility when mesured with fluorescent proe in the dietic mouse model (Cni et l., 2008). We hve lso studied the effect of B420 on intestinl permeility in cell culture using trnsepithelil electricl resistnce s n indictor of the intestinl rrier (Putl et l., 2008). A cell-free superntnt of B420 incresed resistnce y 240%, indicting tht B420 produces compound tht enhnces the epithelil rrier. This compound, however, ws not ny short-chin ftty cid, since the short-chin ftty cid concentrtion of the superntnt did not differ from those in the superntnts of less effective strins. Puttive mechnisms y which proiotic strins my decrese intestinl permeility include upregultion of tight-junction protein expression, ntipoptotic ctivity, promotion of mucous secretion, induction of defensin relese, nd modultion of the sumucosl immune system (Bermudez-Brito et l., 2012). All these effects re communicted vi solule peptides or surfce lignds produced y the cterium. Such mechnisms for B420 re still uncovered. In ddition to improving gut rrier function, it is likely tht there re severl complicted mechnisms ehind the effect of B420 on diposity nd glucose tolernce. Improved glucose tolernce nd slightly reduced weight gin ws recently reported for Lctocillus rhmnosus GG in mice fed with 60 energy % HFD (Kim et l., 2013). The effect ws explined with incresed levels of diponectin nd consequent phosphoryltion of AMP-ctivted protein kinse (AMPK) in skeletl muscle. AMPK ctivtion induces ftty cid oxidtion, which could hve led to incresed energy expenditure contriuting to weight loss. Interestingly, it ws shown tht the conventionlistion of germ free mice modulted muscle AMPK ctivity demonstrting role of the microiot on this mster regultor of energy metolism (Bckhed et l., 2007). Involvement of similr mechnisms in the efficcy of B420 cnnot e ruled out y the present study. 5. Conclusions The findings of this study give rise to the hypothesis tht B420 could e used s complementry tretment for oesity nd impired glucose tolernce. Our results imply enefit for the potentil proiotic B420 in reducing oesity s well s glucose intolernce in diet-induced oese mice. Improved gut rrier function my contriute to the mechnisms of ction. Such metolic effects nd prmeters will still need to e evluted in clinicl setting. Supplementl mteril Supplementry mteril cn e found online t http:// dx.doi.org/10.3920/bm2014.0014. Figure S1. Body weight chnge nd ody composition during Bifidocterium nimlis ssp. lctis 420 tretment in dietic mice with ketogenic diet. Conflict of interest Dr. Stenmn nd Dr. Lhtinen re employees of DuPont, the mnufcturer of B420. Beneficil Microes 5(4) 443
L.K. Stenmn et l. Acknowledgements We thnk Y. Brreir nd S. LeGonidec from the Animl Cre Fcility of Rngueil Hospitl (UMS US006/Inserm) nd the Phenotyping fcilities of Rngueil Hospitl (UMS US006/ANEXPLO). We lso thnk J.-J. Moret nd F. Mrtins from the Quntittive Trnscriptomic Fcility (I2MC/UMR1048 prt of Toulouse Genopole). This study ws sponsored y DuPont. References Amr, J., Cho, C., Wget, A., Klopp, P., Vchoux, C., Bermudez- Humrn, L.G., Smirnov, N., Berge, M., Sulpice, T., Lhtinen, S., Ouwehnd, A., Lngell, P., Rutonen, N., Snsonetti, P.J. nd Burcelin, R., 2011. Intestinl mucosl dherence nd trnsloction of commensl cteri t the erly onset of type 2 dietes: moleculr mechnisms nd proiotic tretment. EMBO Moleculr Medicine 3: 559-572. Andresen, A.S., Lrsen, N., Pedersen-Skovsgrd, T., Berg, R.M., Moller, K., Svendsen, K.D., Jkosen, M. nd Pedersen, B.K., 2010. Effects of Lctocillus cidophilus NCFM on insulin sensitivity nd the systemic inflmmtory response in humn sujects. British Journl of Nutrition 104: 1831-1838. Asemi, Z., Smimi, M., Tssi, Z., Nghii Rd, M., Rhimi Foroushni, A., Khormmin, H. nd Esmillzdeh, A., 2013. Effect of dily consumption of proiotic yoghurt on insulin resistnce in pregnnt women: rndomized controlled tril. Europen Journl of Clinicl Nutrition 67: 71-74. Bckhed, F., Mnchester, J.K., Semenkovich, C.F. nd Gordon, J.I., 2007. Mechnisms underlying the resistnce to diet-induced oesity in germ-free mice. Proceedings of the Ntionl Acdemy of Sciences of the USA 104: 979-984. Bermudez-Brito, M., Plz-Diz, J., Munoz-Quezd, S., Gomez- Llorente, C. nd Gil, A., 2012. Proiotic mechnisms of ction. Annls of Nutrition nd Metolism 61: 160-174. Burcelin, R., Crivelli, V., Dcost, A., Roy-Tirelli, A. nd Thorens, B., 2002. Heterogeneous metolic dpttion of C57BL/6J mice to high-ft diet. Americn Journl of Physiology: Endocrinology nd Metolism 282: E834-E842. Cni, P.D., Amr, J., Iglesis, M.A., Poggi, M., Knuf, C., Bstelic, D., Neyrinck, A.M., Fv, F., Tuohy, K.M., Cho, C., Wget, A., Delmee, E., Cousin, B., Sulpice, T., Chmontin, B., Ferrieres, J., Tnti, J.F., Gison, G.R., Csteill, L., Delzenne, N.M., Alessi, M.C. nd Burcelin, R., 2007. Metolic endotoxemi initites oesity nd insulin resistnce. Dietes 56: 1761-1772. Cni, P.D., Biiloni, R., Knuf, C., Wget, A., Neyrinck, A.M., Delzenne, N.M. nd Burcelin, R., 2008. Chnges in gut microiot control metolic endotoxemi-induced inflmmtion in high-ft dietinduced oesity nd dietes in mice. Dietes 57: 1470-1481. Cni, P.D., Neyrinck, A.M., Fv, F., Knuf, C., Burcelin, R.G., Tuohy, K.M., Gison, G.R. nd Delzenne, N.M., 2007. Selective increses of ifidocteri in gut microflor improve high-ft-dietinduced dietes in mice through mechnism ssocited with endotoxemi. Dietologi 50: 2374-2383. Cno, P.G., Sntcruz, A., Trejo, F.M. nd Snz, Y., 2013. Bifidocterium CECT 7765 improves metolic nd immunologicl ltertions ssocited with oesity in high-ft diet-fed mice. Oesity 21: 2310-2321. Crvlho, B.M., Gudgnini, D., Tsukumo, D.M., Schenk, A.A., Ltuf-Filho, P., Vssllo, J., Dis, J.C., Kuot, L.T., Crvlheir, J.B. nd Sd, M.J., 2012. Modultion of gut microiot y ntiiotics improves insulin signlling in high-ft fed mice. Dietologi 55: 2823-2834. Chen, J.J., Wng, R., Li, X.F. nd Wng, R.L., 2011. Bifidocterium longum supplementtion improved high-ft-fed-induced metolic syndrome nd promoted intestinl Reg I gene expression. Experimentl Biology nd Medicine 236: 823-831. Colldo, M.C., Meriluoto, J. nd Slminen, S., 2007. Role of commercil proiotic strins ginst humn pthogen dhesion to intestinl mucus. Letters in Applied Microiology 45: 454-460. De l Serre, C.B., Ellis, C.L., Lee, J., Hrtmn, A.L., Rutledge, J.C. nd Ryould, H.E., 2010. Propensity to high-ft diet-induced oesity in rts is ssocited with chnges in the gut microiot nd gut inflmmtion. Americn Journl of Physiology: Gstrointestinl nd Liver Physiology 299: G440-G448. Everrd, A., Geurts, L., Vn Roye, M., Delzenne, N.M. nd Cni, P.D., 2012. Tetrhydro iso-lph cids from hops improve glucose homeostsis nd reduce ody weight gin nd metolic endotoxemi in high-ft diet-fed mice. PloS One 7: e33858. Ghoshl, S., Witt, J., Zhong, J., de Villiers, W. nd Eckhrdt, E., 2009. Chylomicrons promote intestinl sorption of lipopolyscchrides. Journl of Lipid Reserch 50: 90-97. Hotmisligil, G.S., 2006. Inflmmtion nd metolic disorders. Nture 444: 860-867. Kdook, Y., Sto, M., Imizumi, K., Ogw, A., Ikuym, K., Aki, Y., Okno, M., Kgoshim, M. nd Tsuchid, T., 2010. Regultion of dominl diposity y proiotics (Lctocillus gsseri SBT2055) in dults with oese tendencies in rndomized controlled tril. Europen Journl of Clinicl Nutrition 64: 636-643. Kdook, Y., Sto, M., Ogw, A., Miyoshi, M., Uenishi, H., Ogw, H., Ikuym, K., Kgoshim, M. nd Tsuchid, T., 2013. Effect of Lctocillus gsseri SBT2055 in fermented milk on dominl diposity in dults in rndomised controlled tril. British Journl of Nutrition 110: 1696-1703. Keit, A.V., Slim, S.Y., Jing, T., Yng, P.C., Frnzen, L., Soderkvist, P., Mgnusson, K.E. nd Soderholm, J.D., 2008. Incresed uptke of non-pthogenic E. coli vi the follicle-ssocited epithelium in longstnding ilel Crohn s disese. Journl of Pthology 215: 135-144. Kim, K.A., Gu, W., Lee, I.A., Joh, E.H. nd Kim, D.H., 2012. High ft diet-induced gut microiot excertes inflmmtion nd oesity in mice vi the TLR4 signling pthwy. PloS One 7: e47713. Kim, S.W., Prk, K.Y., Kim, B., Kim, E. nd Hyun, C.K., 2013. Lctocillus rhmnosus GG improves insulin sensitivity nd reduces diposity in high-ft diet-fed mice through enhncement of diponectin production. Biochemicl nd Biophysicl Reserch Communictions 431: 258-263. 444 Beneficil Microes 5(4)
B420, ft mss nd glucose intolernce in oese mice Kondo, S., Xio, J.Z., Stoh, T., Odmki, T., Tkhshi, S., Sughr, H., Yeshim, T., Iwtsuki, K., Kmei, A. nd Ae, K., 2010. Antioesity effects of Bifidocterium reve strin B-3 supplementtion in mouse model with high-ft diet-induced oesity. Bioscience, Biotechnology, nd Biochemistry 74: 1656-1661. Luche, E., Cousin, B., Gridou, L., Serino, M., Wget, A., Brreu, C., Andre, M., Vlet, P., Courtney, M., Csteill, L. nd Burcelin, R., 2013. Metolic endotoxemi directly increses the prolifertion of dipocyte precursors t the onset of metolic diseses through CD14-dependent mechnism. Moleculr Metolism 2: 281-291. Muccioli, G.G., Nslin, D., Bckhed, F., Reigstd, C.S., Lmert, D.M., Delzenne, N.M. nd Cni, P.D., 2010. The endocnninoid system links gut microiot to dipogenesis. Moleculr Systems Biology 6: 392. Prk, D.Y., Ahn, Y.T., Prk, S.H., Huh, C.S., Yoo, S.R., Yu, R., Sung, M.K., McGregor, R.A. nd Choi, M.S., 2013. Supplementtion of Lctocillus curvtus HY7601 nd Lctocillus plntrum KY1032 in diet-induced oese mice is ssocited with gut microil chnges nd reduction in oesity. PloS One 8: e59470. Pussinen, P.J., Hvulinn, A.S., Lehto, M., Sundvll, J. nd Slom, V., 2011. Endotoxemi is ssocited with n incresed risk of incident dietes. Dietes Cre 34: 392-397. Putl, H., Slusjrvi, T., Nordstrom, M., Srinen, M., Ouwehnd, A.C., Bech Hnsen, E. nd Rutonen, N., 2008. Effect of four proiotic strins nd Escherichi coli O157:H7 on tight junction integrity nd cyclo-oxygense expression. Reserch in Microiology 159: 692-698. Rot, S., Memrez, M., Bruneu, A., Gerrd, P., Hrch, T., Moser, M., Rymond, F., Mnsourin, R. nd Chou, C.J., 2010. Germfree C57BL/6J mice re resistnt to high-ft-diet-induced insulin resistnce nd hve ltered cholesterol metolism. FASEB Journl 24: 4948-4959. Sto, M., Uzu, K., Yoshid, T., Hmd, E.M., Kwkmi, H., Mtsuym, H., Ad El-Gwd, I.A. nd Imizumi, K., 2008. Effects of milk fermented y Lctocillus gsseri SBT2055 on dipocyte size in rts. British Journl of Nutrition 99: 1013-1017. Schertzer, J.D., Tmrkr, A.K., Mglhes, J.G., Pereir, S., Biln, P.J., Fullerton, M.D., Liu, Z., Steinerg, G.R., Gicc, A., Philpott, D.J. nd Klip, A., 2011. NOD1 ctivtors link innte immunity to insulin resistnce. Dietes 60: 2206-2215. Serino, M., Luche, E., Gres, S., Bylc, A., Berge, M., Cenc, C., Wget, A., Klopp, P., Icovoni, J., Klopp, C., Mriette, J., Bouchez, O., Lluch, J., Ourne, F., Monsn, P., Vlet, P., Roques, C., Amr, J., Bouloumie, A., Theodorou, V. nd Burcelin, R., 2012. Metolic dpttion to high-ft diet is ssocited with chnge in the gut microiot. Gut 61: 543-553. Stenmn, L.K., Holm, R., Eggert, A. nd Korpel, R., 2013. A novel mechnism for gut rrier dysfunction y dietry ft: epithelil disruption y hydrophoic ile cids. Americn Journl Physiology: Gstrointestinl nd Liver Physiology 304: G227-G234. Stenmn, L.K., Holm, R. nd Korpel, R., 2012. High-ft-induced intestinl permeility dysfunction ssocited with ltered fecl ile cids. World Journl of Gstroenterology 18: 923-929. Ydv, H., Lee, J.H., Lloyd, J., Wlter, P. nd Rne, S.G., 2013. Beneficil metolic effects of proiotic vi utyrte-induced GLP-1 hormone secretion. Journl of Biologicl Chemistry 288: 25088-25097. Beneficil Microes 5(4) 445