HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

Similar documents
Supplementary Materials for

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Metabolic defects underlying dyslipidemia in abdominal obesity

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

In The Name Of God. In The Name Of. EMRI Modeling Group

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

3-Thia Fatty Acids A New Generation of Functional Lipids?

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

Supporting Information Table of content

Supplementary Information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplemental Table 1. List of primers used for real time PCR.

SUPPLEMENTARY INFORMATION

Supplementary Figure S1

Regulation of Lipid Homeostasis: Lipid Droplets

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

SUPPLEMENTARY INFORMATION

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Interplay between FGF21 and insulin action in the liver regulates metabolism

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA

NASH Bench to Bedside

SUPPLEMENTARY INFORMATION

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supporting Information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

Metabolic Syndrome. DOPE amines COGS 163

Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice

Supplementary Figure 1.

FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets

Master class Biomolecular Sciences Molecular Cell Biology.

Supplementary Table 1.

AMPK. Tomáš Kučera.

Activation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism

SUPPLEMENTARY INFORMATION

Mobilisation des lipides du tissu adipeux et insulinorésistance. Dominique Langin

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Therapeutic Targets for NASH in HIV

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies

2.5. AMPK activity

Hepatic overexpression of CD36 improves glycogen homeostasis and attenuates high-fat

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Hormones and Target Tissues

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and

Can physical exercise and exercise mimetics improve metabolic health in humans?

Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019

FGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance

Investigating the Role of Nuclear Receptors in HIV/HAART-Associated. Dyslipidemic Lipodystrophy. A Thesis. Submitted to the Faculty.

Effect of BI-1 on insulin resistance through regulation of CYP2E1

SteatoNet- Modelling steatosis identifies candidate systemic flux distribution

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk

Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Supplementary Figure 1

Factors Regulating Features of Metabolic Syndrome

Hepatic oleate regulates adipose tissue lipogenesis and fatty acid oxidation

For more information about how to cite these materials visit

Supplementary Materials

AMP-activated Protein Kinase: An Emerging Drug Target to Regulate Imbalances in Lipid and Carbohydrate Metabolism to Treat Cardio- Metabolic Diseases

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Emerging roles of SIRT1 in fatty liver diseases

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Hormonal and Metabolic Disorders of Human Immunodeficiency Virus Infection and Substance Abuse

PAX8-PPARγ Fusion Protein in thyroid carcinoma

AMP-activated protein kinase: an emerging drug target to regulate imbalances in lipid and carbohydrate metabolism to treat cardio-metabolic diseases

Adipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA

Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

Molecular Mechanisms associated with the Cancer-Cachexia Syndrome

The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Reviewer #1 (Remarks to the Author)

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.

* Author to whom correspondence should be addressed; Tel.: ; Fax:

SUPPLEMENTARY INFORMATION

Transcription:

HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD

Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte C/EBPβ/δ SREBP1 PPAR-γ Induction LPL, HSL, ap2, of lipogenic perilipin genes BUT, happens without ART and in Elite suppressors COULD HIV CAUSE????

Metabolic features of HIV (218) Less lipoatrophy Less severe dyslipidemia More generalized obesity Dysglycemia, CVD, osteoporosis, NAFLD

Could there be a direct viral cause? VPR in virally suppressed people VPR is systemic and circulates VPR acts without whole virus

Vpr in virally suppressed patients (Immunoaffinity Capillary Electrophoresis) no ART NRTI HAART HAART with undetectable VL N (2) (25) (61) (7) (25) Agarwal et al, Science Transl Med 213

Mouse Models to study VPR effects A. Vpr-Transgenic Model Inducible expression of Vpr in liver and fat PEPCK SV4 3 UT Tissue-specific promoter Tetracycline transactivator Tet repressor and DNA binding domain VP16 activation domain (teto) 7 Transgene coding region Vpr SV4 3 UT B. Circulating Vpr Model (svpr treatment) Alzet pump filled with vehicle or svpr Incision made to implant Alzet pump Mouse before and after Alzet implant

Vpr mrna Expression in Liver and Adipose Tissues of Mice Liver: Vpr + Fat: Vpr + Vpr Expressed in Liver and Adipose Tissues Also Circulates in the Blood of Mice Serum Vpr (pg/ml) Agarwal et al, Science Transl Med 213

Vpr Increases Lipolysis and Blunts Fat Oxidation Increased lipolysis Ra FFA (mmol/kg/h) 5 25 Ra FFAt Ra FFAn Ra FFA (mmol/kg/h) 4 2 Ra FFAt Ra FFAn Vehicle svpr Blunted fat oxidation during fast.76.75.77.76 RER.74.73.72.71.7 RER.75.74.73.72.71.7 Vehicle svpr Agarwal et al, Science Transl Med 213

Vpr Decreases Fat Mass Fat weight (% of body wt) svpr-treated Fat weight (% of body wt) 4.5 3 1.5 4.5 3. 1.5. IF PGF RPF Total WAT BAT IF PGF RPF Total WAT BAT Vehicle svpr

A. Insulin + + + + B. AKT-p(S473) / AKT Blood glucose (mg/dl).6.3 8 4 Vpr Causes Modest Insulin Resistance 12 Wk AKT 15 3 6 12 Min after i.p. glucose injection C. D. Blood glucose (mg/dl) Plasma triglycerides (mg/dl) 8 4 18 9 24 Wk 15 3 6 12 Min after i.p. glucose injection

VPR Mechanisms VPR acts on adipocyte differentiation VPR acts on adipocyte function Lentiviral VPR in cultured adipocytes

Early expression of Vpr Vpr Blocks Differentiation of Preadipocytes Preadipocyte proliferation Adipocyte differentiation -2d d 2d 4d 6d 8d 1d 12d Lentiviral infection Doxy induction of viral transgene expression Adipocyte differentiation medium added A 3T3-L1 rtta Vpr Vpr-R8A B. Relative mrna expression 1.4.7. Day 1 Day 2 Day 3 Pref1 Relative mrna expression 2.6 1.3. Day2 Day3 Day 4 Day 5 Day 6 PPARγ2 Relative mrna expression 1.8.9. Day 6 Day 8 Day 1 Day 12 GLUT4 Control rtta Vpr R8A

Vpr Inhibits Preadipocyte Differentiation By blocking Cell Cycle 3T3-L1 rtta Vpr Vpr-R8A

Vpr Increases Lipolysis in Mature Adipocytes Late expression of Vpr Preadipocyte proliferation Adipocyte differentiation -2d d 2d 4d 5d 6d 8d 1d 12d Lentiviral infection Adipocyte differentiation medium added Doxy induction of viral transgene expression A. FFA (meq/l).6.3. Basal Stimulated B. Fold enrichment (Input corrected) 26 13 rtta Vpr Adiponectin ap2 HSL NC Adipo NC ap2 NC HSL Ab PPARγ PPARγ GR PPARγ PPARγ GR Rosi + + - + + - Dexa - - + - - +

VPR mechanisms VPR inhibits adipocyte differentiation VPR increases lipolysis in adipocytes What are other consequences????

A. Macrophage Infiltration in Fat of Vpr Mice B. C. Vehicle svpr Vehicle svpr D E. F48+ cells / section 1 5 Average fat cell size (µm 2 ) 3 15 F. G. H. F48+ cells / section 16 8 Vehicle svpr Crown like structures /section 6 3 Vehicle svpr Average fat cell size (µm 2 ) 6 3 Vehicle svpr

HIV infection in fat HIV/SIV infected immune cells in adipose HIV is infectious but not much transcription HIV VPR could have direct effect in vivo Couturier et al AIDS 215, Couturier et al Retrovirology 216

Other consequences of VPR? VPR expressed from transgene in adipose and liver from PEPCK promoter Is there an effect on liver fat metabolism??

HIV VPR causes NASH A B Oil Red O liver (% area) 16 14 12 1 8 6 4 2

VPR increases lipid storage 14 weeks 28 weeks 16 Oil Red O liver (% area) 14 12 1 8 6 Oil Red O liver (% area) 16 14 12 1 8 6 4 4 2 2

VPR increases liver weight and TGs 5 Std 6. Vehicle svpr Liver weight (% of body weight) 3. 2.5 TG (relative density units) x1 3 2 Triglycerides (mg / gm liver) 16 12 8 1 4. 14-Wk 28-Wk 14-Wk Figure 1

Liver function enzymes in VPR mice

Vpr Increases Hepatic Lipogenesis A. mrna fold difference D. [ 14 C] fatty acids (dpm) / million hepaotocytes / h 6 3 24 x 1 2 16 12 8 4 B. mrna fold difference mrna fold difference 6 3 E. Dgat Fasn Scd-1 Acc 6 3 svpr mrna fold difference C. 4 2 Srebp1c Chrebp L-pk Dgat Fasn Scd-1 Acc Srebp1c Chrebp L-pk

Vpr increases proteins associated with liver lipogenesis SREBP1c Chrebp α-tubulin nsrebp1c nchrebp TBP FASN α-tubulin Acc-p(S79) Acc A. B. Relative protein amount (normalized to α-tubulin) 12 6 SREBP1c ChREBP Relative protein amount (normalized to TBP) 1.5 nsrebp1c nchrebp C. 3 D. FASN/α-tubulin 2.5 2 1.5 1.5 Acc-p(s79) / Acc 5 2.5 Vehicle svpr SREBP1c Chrebp α-tubulin nsrebp1c nchrebp TBP FASN α-tubulin Acc-p(S79) Acc E. F. Vehicle svpr Relative protein amount (normalized to α-tubulin) 3 2 1 SREBP1c ChREBP Relative protein amount (normalized to TBP) 6 3 Vehicle nsrebp1c svpr nchrebp G. H. FASN / α-tubulin 4 2 pacc / Acc 2 1 Vehicle svpr Vehicle svpr

Vpr Blunts Hepatic Fat Oxidation A. B..78 16 Fatty acid oxidation in liver (dpm/mg/h) 12 8 4 RER C. D. 1.2.765.75.735.72 1.5 mrna fold difference.6 mrna fold change 1.5 Pparα PPARa E. F. 1.2 1.5 Cpt1 Aox Ehhadh Hsd17b1 acaa2 Lcad Vehicle svpr mrna fold difference.6 mrna fold difference 1.5. Pparα PPARa Cpt1 Aox Ehhadh Hsd17b1 acaa2 Lcad

Vpr Inhibits Hepatic VLDL-TG Export A. B. C. MTP BA.8 1.2 mrna fold difference.6 MTP expression (normalized to α-tubulin.4 Triglycerides released into plasma (mg/dl) 7 35 min I hr 2 hr D. 2.5 E. Lpl mrna fold difference 2 1.5 1.5 Heart IF PGF Skeletal Muscle Post heparin Serum LPL mass (pg/ml) 8 6 4 2

Do these Vpr Mouse Models Explain Adipose / Liver Metabolic defects in HIV+ Humans? Lipolysis Fat oxidation Fat mass Fatty liver FGF21 Vpr Mice HIV+ Humans SAT beiging + + Circulating Vpr without intact HIV + + Koch s Postulates?

CREDITS Expression / Function Studies: Neeti Agarwal Dinakar Iyer Toni Oplt Sanjeet Patel Jeffrey Kopp Ulrich Schubert Terry Phillips Tomoshige Kino Human Samples: Maria Rodriguez-Barradas Adipose HIV Reservoir Dorothy Lewis Jacob Couturier Sara Cromer Human / Mouse Metabolic Studies: R. V. Sekhar Farook Jahoor Sue Samson Sanjeet Patel Jordan Lake

Vpr Associates With Hepatic Genes Involved in Lipid and Sterol Metabolism A. B. C.

A. Relative luciferase activity (HepG2) x 1 6 5 4 3 2 1 unrx GW3965 T9137 Vector+LXRE Vpr+LXRE LXR+LXRE Vpr+LXR+LXRE Relative luciferase activit y (Huh7) C. D. Fold enrichment (Input corrected) 9 8 7 6 5 4 3 2 1 # # # ### # # ns ## Vpr Coactivates LXR B. Thousands 2 15 1 5 LXR LXR+GW3965 Vpr Vpr+GW3965 Vpr+LXR Vpr+LXR+GW3965 # # # unrx GW3965 T9137 Vector+LXRE Vpr+LXRE LXR+LXRE Vpr+LXR+LXRE GW3965 + + - - + + Vpr - + - + - + LXR + + + + - - LXRE + + + + + + Srebp1c Lxr NC Srebp1c NC Lxr