Supporting Information Table of content

Similar documents
Prostaglandin reductase-3 negatively modulates adipogenesis through regulation of peroxisome proliferator-activated receptor γ activity

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

SUPPLEMENTARY INFORMATION

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

2.5. AMPK activity

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Supporting Information

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

INTERACTION DRUG BODY

Supplementary Figure S1

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

SUPPLEMENTARY INFORMATION

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

acid were from Fisher Scientific (Loughborough, UK). Methanol and acetonitrile (HPLC grade) were from VWR (Lutterworth, Leicestershire, UK).

MILK BIOSYNTHESIS PART 3: FAT

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Supplemental information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Information

Examination of Mechanisms of Hepatotoxicity of Anti-diabetic PPARγ Agonists Using Applied Biosystems Rat Whole Genome Microarrays

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

Supplemental Figure 1

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supporting Information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics

Peroxisome Proliferator-Activated Receptors (PPARs) and osteoblasts and adipocytes. Welcome to the wonderful, dynamic and complex world of PPARs

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

SUPPLEMENTARY INFORMATION

/03/$15.00/0 Molecular Endocrinology 17(12): Copyright 2003 by The Endocrine Society doi: /me

OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

In The Name Of God. In The Name Of. EMRI Modeling Group

number Done by Corrected by Doctor Faisal Al-Khatibe

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

Supplementary Figure 1

Supplemental Table S1

Supplementary Figure 1.

Data Sheet. Notch Pathway Reporter Kit Catalog # 60509

Supplementary Information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

3-Thia Fatty Acids A New Generation of Functional Lipids?

Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR

Supplementary Material

SUPPLEMENTARY INFORMATION

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Supplementary Information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

Supplemental Figures

Supplementary Information

606 J. Anim. Sci Vol. 92, E-Suppl. 2/J. Dairy Sci. Vol. 97, E-Suppl. 1

T H E J O U R N A L O F C E L L B I O L O G Y

Insulin-induced gene 1 (insig-1) mrna increases dramatically in

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Peroxisome proliferator-activated receptor delta regulates lipid droplet formation and transport in goat mammary epithelial cells

Cultured 3T3L1 adipocytes dispose of excess medium glucose as lactate under abundant oxygen availability

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

LIPID METABOLISM

Berberine activates AMPK to suppress proteolytic processing, nuclear translocation and target DNA binding of SREBP-1c in 3T3-L1 adipocytes

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Pair-fed % inkt cells 0.5. EtOH 0.0

Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Supporting Information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids

number Done by Corrected by Doctor F. Al-Khateeb

Peroxisome proliferator-activated receptor- coactivator 1 (PGC-1 ) regulates triglyceride metabolism by activation of the nuclear receptor FXR

Supplementary Figures

Biochemistry: A Short Course

Transcription:

Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting Information Table I. Supporting Information Methods 1

Supporting Information Fig. S1 Fig. S1. The expression patterns of PTGR-2 and PTGR-3 mrna in tissues and cells. (A) Tissue distribution of PTGR-2 and PTGR-3 mrna from 12-wk-old mice C57BL/6 mice. (B) Expression of PTGR-2 and PTGR-3 mrna from adipose tissue of 12-wk-old lean and ob/ob mice. * P < 0.05 versus Lean. The bars indicate the means ± SE for tissue or cells from three independent replicates (n = 3). 2

Supporting Information Fig. S2 Fig. S2. Expression of lipid metabolism-related genes in genetically modified 3T3-L1 cells after 8 day hormonal induction. (A) Expression of adipogenic marker genes (lpl and cd36) in shrna control and PTGR-3-knockdown cells. (B) Expression of adipogenic marker genes (lpl and cd36) in vector control and PTGR-3-overexpressing cells. The bars indicate the means ± SE for cells from three independent replicates (n = 3). * P < 0.05 versus shluc. 3

Supporting Information Fig. S3 Fig. S3. Mass spectrum of 15-keto-PGE 2 and 13,14-dihydro-15-keto-PGE 2. (A) LC- MS/MS spectrum of standard molecule of 15-keto-PGE 2 (upper panel) and 13,14- dihydro-15-keto-pge 2 (lower panel) were identified from fragmentation of the molecular anions of 15-keto-PGE 2 (m/z 349) and 13,14-dihydro-15-keto-PGE 2 (m/z 351). (B) LC- MS/MS spectrum of PTGR-2 enzymatic reaction product. 15-keto-PGE 2 was incubated with recombinant PTGR-2 and NADPH for 30 min at 37 C. Mass spectrum of 13,14-4

dihydro-15-keto-pge 2 from enzymatic reaction product was identified by LC-MS/MS compared with standard molecule of 13,14-dihydro-15-keto-PGE 2. 5

Supporting Information Fig. S4 Fig. S4. The effect of transactivation of PGE 2 and 13,14-dihydro-15-keto-PGE 2 on ligand binding domain of PPARγ. 293 cells were transfected with expression vectors (CMX- GAL4 and CMX-GAL4-PPARγ) and UAS G 4-TK-LUC reporter plasmid for 16 hour and then incubated cells in growth medium with or without treatments (1 μm troglitazone, 10 μm PGE 2, 10 μm 13,14-dihydro-15-keto-PGE 2 and 1 μm GW9662) for 24 hour. The activity of firefly luciferase was determined and normalized to the activity of renilla luciferase. The bars indicate the means ± SE for three independent replicates (n=3). Different superscripts indicate significant difference (P 0.05). 6

Supporting Information Fig. S5 Fig. S5. The effect of 15-keto-PGE 2 on retinoid X receptor response element (RXRE)- driven luciferase activity. 293 cells were transfected with RXRE-LUC reporter plasmid for 16 hour and then incubated cells in growth medium with or without treatments (5 μm 9-cis retinoic acid and 10 μm 15-keto-PGE 2 ) for 24 hour. The activity of firefly luciferase was determined and normalized to the activity of renilla luciferase. The bars indicate the means ± SE for three independent replicates (n=3). * P < 0.05 versus DMSO. 7

Supporting Information Table I. Primer sequences for quantitative reverse transcription-pcr Gene Sequence ucp1 Sense 5 -CGTACCAAGCTGTGCGATGT-3 Anti-sense 5 -TAGAAGCCCAATGATGTTCAGT-3 ucp2 Sense 5 -CCGGGCTGGTGGTGGTC-3 Anti-sense 5 -ACACCTTTCCAGAGGCCC-3 ucp3 Sense 5 -CATCGCCAGGGAGGAAGGA-3 Anti-sense 5 -GTTGACAATGGCATTTCTTGTGA-3 pparα Sense 5 -TGCCAAGGAGTCGAGGATGT-3 Anti-sense 5 -TCGGCACCAGGAACCAA-3 pparβ/δ Sense 5 -AATGCGCTGGAGCTCGATGAC-3 Anti-sense 5 -ACTGGCTGTCAGGGTGGTTG-3 pparγ Sense 5 -CAAGAATACCAAAGTGCGATCAA-3 Anti-sense 5 -GAGCTGGGTCTTTTCAGAATAATAAG-3 atgl Sense 5 -TGTGGCCTCATTCCTCCTAC-3 Anti-sense 5 -TCGTGGATGTTGGTGGAGCT-3 hsl Sense 5 -GGCTTACTGGGCACAGATACCT-3 Anti-sense 5 -CTGAAGGCTCTGAGTTGCTCAA-3 ptgr-2 Sense 5 -CAGGGTGGAAGAGTTCAGTTT-3 Anti-sense 5 -CCAGTGTCCTCGTTCATCTTAC-3 ptgr-3 Sense 5 -GGAACTGTCAGAAGGGAAGAAA-3 Anti-sense 5 -TAACGTGGCACTTGGCTATC-3 lpl Sense 5 -GGATGGACGGTAAGAGTGATTC-3 Anti-sense 5 -ATCCAAGGGTAGCAGACAGGT-3 cd36 Sense 5 -CCCCGTGCCTCCTCCCAGAA-3 Anti-sense 5 -GGCTAGGAAACCATCCACCAGTTGC-3 fas Sense 5 -CCCTTGATGAAGAGGGATCA-3 Anti-sense 5 -GAACAAGGCGTTAGGGTTGA-3 acc Sense 5 -AACATCCCCACGCTAAACAG-3 Anti-sense 5 -CTGACAAGGTGGCGTGAAG-3 srebp-1c Sense 5 -GGAGCCATGGATTGCACATT-3 Anti-sense 5 -GCTTCCAGAGAGGAGGCCAG-3 gapdh Sense 5 -GGTGAAGGTCGGTGTGAACG-3 Anti-sense 5 -CTCGCTCCTGGAAGATGGTG-3 Abbreviations used: uncoupling protein 1, UCP1; uncoupling protein 2, UCP2; uncoupling protein 3, UCP3; peroxisome proliferator-activated receptor α, PPARα; peroxisome proliferator-activated receptor β/δ, PPARβ/δ; peroxisome proliferatoractivated receptor γ, PPARγ; adipose triglyceride lipase, ATGL; hormone sensitive lipase, HSL; sterol regulatory element-binding transcription factor-1c, SREBP-1c; acetyl- CoA carboxylase, ACC; fatty acid synthase, FAS; glycerol-3-phosphate dehydrogenase, GPDH; fatty acid translocase, CD36; lipoprotein lipase, LPL; PTGR-2, prostaglandin 8

reductase-2; PTGR-3 prostaglandin reductase-3; glyceraldehyde-3-phosphate dehydrogenase, GAPDH. 9

Supporting information methods Quantitative reverse transcription-pcr. Tissue and cellular RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed with a Transcriptor Reverse Transcriptase kit (Roche Applied Science, Indianapolis, IN, USA). Quantitative reverse transcriptase-pcr was performed using ABI PRISM 7000 sequence detector system (Applied Biosystems, Foster City, CA, USA) and KAPA SYBR FAST qpcr Kit (Kapa Biosystems, Inc., Boston, MA, USA). PCR was performed by 40 cycles of 95 C for 30 s, 58 60 C for 60 s, and 72 C for 30 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was determined as the internal control gene. The sequence of primers for quantitative reverse transcription-pcr was listed in Supporting Information Table I. The mrna expression of each gene was normalized to its GAPDH mrna expression in the same sample. Threshold cycle (C t ) values were obtained and relative gene expression was calculated using the formula (1/2) Ct target genes Ct GAPDH. Retinoid X receptor activity assay. Confluent 293T cell were incubated with reporter plasmids (retinoid X receptor response element-driven luciferase and CMV-driven renilla luciferase vectors) and lipofectamine. After 16 hour of transfection, media were changed to growth media without or with chemicals (5 μm 9-cis retinoic acid and 10 μm 15-keto- PGE 2 ). Twenty-four hours after treatment, cells were harvested for determination of luciferase activity (Dual-Glo luciferase assay system, Promega). 10

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback